Assessment of the Role of Free-Living and Farmed Fallow Deer (Dama dama) as A Potential Source of Human Infection with Multiple-Drug-Resistant Strains of Yersinia enterocolitica and Yersinia pseudotuberculosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Strain Isolation and Molecular Confirmation
2.3. High-Resolution Melting Analysis, Sequencing and Phylogenetic Analysis
2.4. Bioserotyping Analyses
2.5. Antimicrobial Sensitivity Analysis
3. Results
3.1. Strain Isolation and Molecular Confirmation
3.2. High-Resolution Melting, Sequencing and Phylogenetic Analysis
3.3. Bioserotyping Analysis
3.4. Antimicrobial Sensitivity Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Le Guern, A.S.; Savin, C.; Brémont, S.; Payro, G.; Bon, D.; Carniel, E.; Pizarro-Cerdá, J. First isolation of Yersinia entomophaga in human urinary tract. New Microbes New Infect. 2018, 26, 3–7. [Google Scholar] [CrossRef] [PubMed]
- EFSA (European Food Safety Authority and European Centre for Disease Prevention and Control). The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, 6406. [Google Scholar]
- Zadernowska, A.; Chajęcka-Wierzchowska, W.; Łaniewska-Trokenheim, Ł. Yersinia enterocolitica: A dangerous, but often ignored, foodborne pathogen. Food Rev. Int. 2014, 30, 53–70. [Google Scholar] [CrossRef]
- Bergann, T.; Kleemann, J.; Sohr, D. Model studies of psychrotrophia in Yersinia enterocolitica. Zentralbl. Veterinarmed. B. 1995, 42, 523–531. [Google Scholar]
- Fukushima, H.; Shimizu, S.; Inatsu, Y. Yersinia enterocolitica and Yersinia pseudotuberculosis detection in foods. J. Pathog. 2011, 735308, 735308. [Google Scholar]
- Morka, K.; Wałecka-Zacharska, E.; Schubert, J.; Dudek, B.; Woźniak-Biel, A.; Kuczkowski, M.; Wieliczko, A.; Bystroń, J.; Bania, J.; Bugla-Płoskońska, G. Genetic Diversity and Distribution of Virulence-Associated Genes in Y. enterocolitica and Y. enterocolitica-Like Isolates from Humans and Animals in Poland. Pathogens 2021, 10, 65. [Google Scholar] [CrossRef]
- Woźniak-Kosek, A.; Kot, B.; Jakubczak, A.; Grzybowski, J. Zastosowanie metody PCR do identyfikacji markerów chorobotwórczości szczepów Yersinia enterocolitica izolowanych od ludzi i świń. Med. Weter. 2001, 57, 183–186. [Google Scholar]
- Fredriksson-Ahomaa, M.; Hallanvuo, S.; Korte, T.; Siitonen, A.; Korkeala, H. Correspondence of genotypes of sporadic Yersinia enterocolitica bioserotype 4/O:3 strains from human and porcine sources. Epidemiol. Infect. 2001, 127, 37–47. [Google Scholar] [CrossRef] [Green Version]
- Fredriksson-Ahomaa, M.; Stolle, A.; Korkeala, H. Molecular epidemiology of Yersinia enterocolitica infections. FEMS Immunol. Med. Mic. 2006, 47, 315–329. [Google Scholar] [CrossRef] [Green Version]
- Backhans, A.; Fellström, C.; Lambertz, S.T. Occurrence of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis in small wild rodents. Epidemiol. Infect. 2011, 139, 1230–1238. [Google Scholar] [CrossRef]
- Joutsen, S.; Laukkanen-Ninios, R.; Henttonen, H.; Niemimaa, J.; Voutilainen, L.; Kallio, E.R.; Helle, H.; Korkeala, H.; Fredriksson-Ahomaa, M. Yersinia spp. in wild rodents and shrews in Finland. Vector Borne Zoonotic. Dis. 2017, 17, 303–311. [Google Scholar] [CrossRef] [Green Version]
- Kaneko, K.; Hamada, S.; Kasai, Y.; Hashimoto, N. Smouldering epidemic of Yersinia pseudotuberculosis in barn rats. Appl. Environ. Microbiol. 1979, 37, 1–3. [Google Scholar] [CrossRef] [Green Version]
- Altrock, A.; Seinige, D.; Kehrenberg, C. Yersinia enterocolitica isolates from wild boars hunted in Lower Saxony, Germany. Appl. Environ. Microb. 2015, 81, 4835–4840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arrausi-Subiza, M.; Gerrikagoitia, X.; Alvarez, V.; Ibabe, J.C.; Barral, M. Prevalence of Yersinia enterocolitica and Yersinia pseudotuberculosis in wild boars in the Basque Country, northern Spain. Acta Vet. Scand. 2016, 20, 4. [Google Scholar] [CrossRef] [PubMed]
- Bancerz-Kisiel, A.; Szczerba-Turek, A.; Platt-Samoraj, A.; Socha, P.; Szweda, W. Application of multiplex PCR for the evaluation of the occurrence of ail, ystA and ystB genes in Yersinia enterocolitica strains isolated from wild boars (Sus scrofa). Bull. Vet. Inst. Pulawy 2009, 53, 351–355. [Google Scholar]
- Chlebicz, A.; Śliżewska, K. Campylobacteriosis, Salmonellosis, Yersiniosis, and Listeriosis as Zoonotic Foodborne Diseases: A Review. Int. J. Environ. Res. Public Health 2018, 15, 863. [Google Scholar] [CrossRef] [Green Version]
- Fredriksson-Ahomaa, M.; Wacheck, S.; Koenig, M.; Stolle, A.; Stephan, R. Prevalence of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis in wild boars in Switzerland. Int. J. Food Microbiol. 2009, 135, 199–202. [Google Scholar] [CrossRef] [Green Version]
- Fois, F.; Piras, F.; Torpdahl, M.; Mazza, R.; Ladu, D.; Consolati, S.G.; Spanu, C.; Scarano, C.; De Santis, E.P.L. Prevalence, bioserotyping and antibiotic resistance of pathogenic Yersinia enterocolitica detected in pigs at slaughter in Sardinia. Int. J. Food Microbiol. 2019, 20, 1–6. [Google Scholar] [CrossRef]
- Gnat, S.; Trościańczyk, A.; Nowakiewicz, A.; Majer-Dziedzic, B.; Ziółkowska, G.; Dziedzic, R.; Zięba, P.; Teodorowski, O. Experimental studies of microbial populations and incidence of zoonotic pathogens in the faeces of red deer (Cervus elaphus). Lett. Appl. Microbiol. 2015, 61, 446–452. [Google Scholar] [CrossRef] [Green Version]
- Joutsen, S.; Sarno, E.; Fredriksson-Ahomaa, M.; Cernela, N.; Stephan, R. Pathogenic Yersinia enterocolitica O:3 isolated from a hunted wild alpine ibex. Epidemiol. Infect. 2013, 141, 612–617. [Google Scholar] [CrossRef] [Green Version]
- Morka, K.; Bystroń, J.; Bania, J.; Korzeniowska-Kowal, A.; Korzekwa, K.; Guz-Regner, K.; Bugla-Płoskońska, G. Identification of Yersinia enterocolitica isolates from humans, pigs and wild boars by MALDI TOF MS. BMC Microbiol. 2018, 17, 86. [Google Scholar] [CrossRef] [PubMed]
- Nikolova, S.; Tzvetkov, Y.; Najdenski, H.; Vesselinova, A. Isolation of pathogenic yersiniae from wild animals in Bulgaria. J. Vet. Med. B Infect. Dis. Vet. Public Health. 2001, 48, 203–209. [Google Scholar] [CrossRef] [PubMed]
- Reinhardt, M.; Hammerl, J.A.; Kunz, K.; Barac, A.; Nöckler, K.; Hertwig, S. Yersinia pseudotuberculosis prevalence and diversity in wild boars in Northeast Germany. Appl. Environ. Microbiol. 2018, 84, e00675-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Syczyło, K.; Platt-Samoraj, A.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Pajdak-Czaus, J.; Łabuć, S.; Procajło, Z.; Socha, P.; Chuzhebayeva, G.; Szweda, W. The prevalence of Yersinia enterocolitica in game animals in Poland. PLoS ONE. 2018, 13, e0195136. [Google Scholar] [CrossRef]
- Żmijewski, T.; Modzelewska-Kapituła, M.; Pomianowski, J. Farmed-raised fallow deer (Dama dama L.) carcass characteristics and meat nutritional value. J. Food Sci. Technol. 2020, 57, 3211–3220. [Google Scholar] [CrossRef]
- Kudrnáčová, E.; Bureš, D.; Bartoň, L.; Kotrba, R.; Ceacero, F.; Hoffman, L.C.; Koǔrimská, L. The effect of barley and lysine supplementation of pasture-based diet on growth, carcass composition and physical quality attributes of meat from farmed fallow deer (Dama dama). Animals 2019, 9, 33. [Google Scholar] [CrossRef] [Green Version]
- Asher, G.W. Studies on the Reproduction of Farmed Fallow Deer. Ph.D. Thesis, University of Canterbury, Christchurc, New Zealand, 1986. [Google Scholar]
- Kilar, J.; Duda, M.; Kilar, M. Consumer Interest in Venison in: Trends in Human Nutrition; Karwowska, M., Gustaw, W., Eds.; Wydawnictwo Naukowe PTTŻ: Kraków, Poland, 2015; pp. 101–110. [Google Scholar]
- Bottone, E.J. Yersinia enterocolitica: Revisitation of an enduring human pathogen. Clin. Microbiol. Newslett. 2015, 37, 1–8. [Google Scholar] [CrossRef]
- Robins-Browne, R.; Hartland, E. Yersinia Species. In International Handbook of Foodborne Pathogens; Miliotis, M.D., Bier, J.W., Eds.; CRC Press: Boca Raton, FL, USA, 2003; pp. 323–355. [Google Scholar]
- Gierczyński, R. Evaluation of the usefulness of selected virulence markers for identification of virulent Yersinia enterocolitica strains. III. Chromosome markers of virulence. Med. Dośw. Mikrobiol. 2000, 52, 51–65. [Google Scholar]
- Wren, B.W. The Yersiniae—A model genus to study the rapid evolution of bacterial pathogens. Nat. Rev. Microbiol. 2003, 1, 55–64. [Google Scholar] [CrossRef]
- Fredriksson-Ahomaa, M.; Stolle, A.; Stephan, R. Prevalence of pathogenic Yersinia enterocolitica in pigs slaughtered at a Swiss abattoir. Int. J. Food Microbiol. 2007, 119, 207–212. [Google Scholar] [CrossRef]
- Saari, T.N.; Douglas, A. Yersinia pseudotuberculosis mesenteric adenitis. J. Pediatr. 1974, 85, 656–659. [Google Scholar] [CrossRef]
- Bogdanovich, T.; Carniel, E.; Fukushima, H.; Skurnik, M. Use of O-antigen gene cluster-specific PCRs for the identification and O-genotyping of Yersinia pseudotuberculosis and Yersinia pestis. J. Clin. Microbiol. 2003, 41, 5103–5112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laukkanen-Ninios, R.; Didelot, X.; Jolle, K.A.; Morelli, G.; Sangal, V.; Kristo, P.; Brehony, C.; Imori, P.F.; Fukushima, H.; Siitonen, A.; et al. Population structure of the Yersinia pseudotuberculosis complex according to multilocus sequence typing. Environ. Microbiol. 2011, 13, 3114–3127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Magistrali, C.F.; Cucco, L.; Manuali, E.; Sebastiani, C.; Farneti, S.; Ercoli, L.; Pezzotti, G. A typical Yersinia pseudotuberculosis serotype O:3 isolated from hunted wild boars in Italy. Vet. Microbiol. 2014, 171, 227–231. [Google Scholar] [CrossRef]
- Salem, M.; Virtanen, S.; Korkeala, H.; Skurnik, M. Isolation and characterization of Yersinia- Specific bacteriophages from pig stools in Finland. J. Appl. Microbiol. 2014, 118, 599–608. [Google Scholar] [CrossRef]
- Harnett, N.; Lin, Y.P.; Krishnan, C. Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction. Epidemiol. Infect. 1996, 117, 59–67. [Google Scholar] [CrossRef]
- Bancerz-Kisiel, A.; Szczerba-Turek, A.; Platt-Samoraj, A.; Szweda, W. Application of multiplex PCR for the evaluation of the occurrence of ystA, ystB, ystC and ymoA genes in Yersinia enterocolitica strains from fattening pigs. Bull. Vet. Inst. Pulawy 2011, 55, 33–37. [Google Scholar]
- Bancerz-Kisiel, A.; Szczerba-Turek, A.; Platt-Samoraj, A.; Michalczyk, M.; Szweda, W. A study of single nucleotide polymorphism in the ystB gene of Yersinia enterocolitica strains isolated from various wild animal species. Ann. Agr. Env. Med. 2017, 24, 56–61. [Google Scholar] [CrossRef]
- Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generatiobn of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Green Version]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, E.; McGettigan, P.A.; MCWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatic 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
- PN-EN ISO 10273; Microbiology of Food and Animal Feed. Horizontal Method for the Detection of Microbiology of Food and Animal Feed. Horizontal Method for the Detection of Presumably Pathogenic Yersinia Enterocolitica. Polish Committee for Standardization: Polish Norm—European Norm (with appendix PN-EN ISO 10273:2005/Ap1, 2005; PN-EN ISO 10273:2005/Ap2, 2006). Polish Committee for Standardization: Warszawa, Poland, 2005.
- Wauters, G.; Kandolo, K.; Janssens, M. Revised scheme of Yersinia enterocolitica biogrouping. Contrib. Microbiol. Immunol. 1987, 9, 14–21. [Google Scholar] [PubMed]
- CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Nowakiewicz, A.; Zięba, P.; Ziółkowska, G.; Gnat, S.; Muszyńska, M.; Tomczuk, K.; Majer Dziedzic, B.; Ulbrych, Ł.; Trościańczyk, A. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus. PLoS ONE 2016, 11, e0155533. [Google Scholar] [CrossRef] [PubMed]
- Fredriksson-Ahomaa, M. Wild Boar: A reservoir of foodborne zoonoses. Foodborne Pathog. Dis. 2019, 16, 153–165. [Google Scholar] [CrossRef] [PubMed]
- Lizana, V.; Muniesa, A.; Cardells, J.; López-Ramon, J.; Aguiló-Gisbert, J.; Lomillos, J.M.; mGortázar, C. Safe Game: Hygienic Habits in Self-Consumption of Game mMeat in Eastern Spain. Foods 2022, 11, 368. [Google Scholar] [CrossRef]
- Jerrett, I.V.; Slee, K.J.; Robertson, B.I. Yersiniosis in farmed deer. Aust. Vet. J. 1990, 67, 212–214. [Google Scholar] [CrossRef]
- Henderson, T.G. The isolation of Yersinia sp. from feral and farmed deer faeces. N. Z. Vet. J. 1984, 32, 88–90. [Google Scholar] [CrossRef]
- Chapman, D.I.; Chapman, N.G.; Atherton, J.G.; Platt, H. Yersiniosis in a free-living fallow deer. Vet. Rec. 1979, 105, 573–574. [Google Scholar]
- Hubbert, W.T. Yersiniosis in fallow deer in Michigan. Am. J. Trop. Med. Hyg. 1972, 21, 458–460. [Google Scholar] [CrossRef]
- Sanford, S.E. Outbreaks of yersiniosis caused by Yersinia pseudotuberculosis in farmed cervids. J. Vet. Diagn. Investig. 1995, 7, 78–81. [Google Scholar] [CrossRef] [Green Version]
- Platt-Samoraj, A.; Kończyk-Kmiecik, K.; Bakuła, T. Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland. Pathogens 2021, 10, 1247. [Google Scholar] [CrossRef]
- Bancerz-Kisiel, A.; Szczerba-Turek, A.; Platt-Samoraj, A.; Socha, P.; Szewda, W. Bioserotypes and virulence markers of Yersinia enterocolitica strains isolated from roe deer (Capreolus capreolus) and red deer (Cervus elaphus). Pol. J. Vet. Sci. 2014, 17, 315–319. [Google Scholar] [CrossRef] [PubMed]
- Avagnina, A.; Nucera, D.; Grassi, M.A.; Ferroglio, E.; Dalmasso, A.; Civera, T. The microbiological conditions of carcasses from large game animals in Italy. Meat Sci. 2012, 91, 266–271. [Google Scholar] [CrossRef] [PubMed]
- Platt-Samoraj, A.; Syczyło, K.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Giżejewska, A.; Szweda, W. Yersinia enterocolitica strains isolated from beavers (Castor fiber). Pol. J. Vet. Sci. 2015, 18, 449–451. [Google Scholar] [CrossRef]
- Campioni, F.; Falcao, J.P. Genotypic diversity and virulence markers of Yersinia enterocolitica biotype 1A strains isolated from clinical and non-clinical origins. APMIS 2014, 122, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Stephan, R.; Joutsen, S.; Hofer, E.; Säde, E.; Björkroth, J.; Ziegler, D.; Fredriksson-Ahomaa, M. Characteristics of Yersinia enterocolitica biotype 1A strains isolated from patients and asymptomatic carriers. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 869–875. [Google Scholar] [CrossRef] [Green Version]
- Platt-Samoraj, A.; Bancerz-Kisiel, A.; Szweda, W. Zjadliwość Yersinia enterocolitica oraz znaczenie biotypu 1A w patogenezie jersiniozy. Med. Weter. 2006, 62, 1113–1115. [Google Scholar]
- Bonke, R.; Wacheck, S.; Stuber, E.; Meyer, C.; Martlbauer, E.; Fredriksson-Ahomaa, M. Antimicrobial susceptibility and distribution of β-Lactamase A (blaA) and β-Lactamase B (blaB) genes in enteropathogenic Yersinia Species. Microb. Drug Resist. 2011, 17, 575–581. [Google Scholar] [CrossRef] [PubMed]
- Szych, J.; Jakubczak, A.; Wardak, S.; Madajczak, G. Ocena wrażliwości na wybrane antybiotyki pałeczek Yersinia enterocolitica i Yersinia pseudotuberculosis izolowanych z próbek materiału klinicznego w Polsce w latach 2004–2009. Med. Dośw. Mikrobiol. 2009, 61, 311–319. [Google Scholar]
- Perkowska, K.; Platt-Samoraj, A.; Bancerz-Kisiel, A.; Lipińska, E.; Piełudź, D.; Siemionek, J.; Szweda, W. Ocena wrażliwości na chemioterapeutyki szczepów Yersinia enterocolitica wyizolowanych od świń w Polsce w latach 2000 i 2007. Med. Weter. 2013, 69, 548–551. [Google Scholar]
Gene | Primer Sequence | Product Size | Reference |
---|---|---|---|
ail | 5’TGGTTATGCGCAAAGCCATGT3’ 5’TGGAAGTGGGTTGAATTGCA3’ | 356 bp | [39] |
ystA | 5’GTCTTCATTTGGAGGATTCGGC3’ 5’AATCACTACTGACTTCGGCTGG3’ | 134 bp | [40] |
ystB | 5’TGTCAGCATTTATTCTCAACT3’ 5’GCCGATAATGTATCATCAAG3’ | 180 bp | [40] |
ystC | 5’TCGACAAGTGAGTGACGGAG3’ 5’CCCTTACTCGCGACGAAATA3’ | 284 bp | [40] |
inv | 5’GCAGAATTCGGATACCCAGCACCATGACT3’ 5’GCAGGATCCAGCCATGAACATTCCACA3’ | 689 bp | Skurnik * |
wzz | 5’GGTGATGAGCAAGTTCAAG3’ 5’GCTAAATCCACTGCTCGCTG3’ | 418 bp | [35] |
Source | Strain Number | Virulence Markers | Genotype | Biotype | Serotype | |||
---|---|---|---|---|---|---|---|---|
ail | ystA | ystB | ystC | |||||
Free-living fallow deer | 2D ITC | − | − | + | − | G3 | 1A | NT |
2D PSB | − | − | + | − | G3 | 1A | NT | |
6D ITC | − | − | + | − | G3 | 1A | NT | |
30D ITC | − | − | + | − | G3 | 1A | NT | |
31D ITC | − | − | + | − | G3 | 1A | O:9 | |
57D ITC | − | − | + | − | G1 | 1A | O:5 | |
60D ITC | − | − | + | − | G3 | 1A | NT | |
Farmed fallow deer | 22 ITC | − | − | + | − | G1 | 1A | NT |
39 ITC | − | − | + | − | G1 | 1A | NT |
Source | Sample Number | Amoxicillin/Clavulanic Acid | Ampicillin | Cefalexin | Cefotaxime | Ceftazidime | Chloramphenicol | Ciprofloxacin | Gentamycin | Kanamycin | Nalidixic Acid | Streptomycin | Trimethoprim/Sulfamethoxazole | Tetracycline |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Free-living fallow deer | 2D ITC | R | R | R | R | R | R | I | R | R | I | R | I | I |
2D PSB | R | R | R | I | I | I | S | R | R | I | R | I | I | |
6D ITC | R | R | R | I | I | I | S | R | R | I | R | I | I | |
30D ITC | R | R | R | I | I | I | I | R | R | I | R | I | I | |
31D ITC | R | R | R | I | I | I | I | R | I | I | R | S | I | |
57D ITC | R | R | R | I | I | I | S | I | I | S | R | S | I | |
60D ITC | R | R | R | I | I | I | I | I | I | I | R | S | I | |
Farmed fallow deer | 22 ITC | R | R | R | I | I | I | S | R | R | I | R | I | I |
39 ITC | R | R | R | I | I | I | S | R | R | I | R | I | I |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Odyniec, M.; Bancerz-Kisiel, A. Assessment of the Role of Free-Living and Farmed Fallow Deer (Dama dama) as A Potential Source of Human Infection with Multiple-Drug-Resistant Strains of Yersinia enterocolitica and Yersinia pseudotuberculosis. Pathogens 2022, 11, 1266. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11111266
Odyniec M, Bancerz-Kisiel A. Assessment of the Role of Free-Living and Farmed Fallow Deer (Dama dama) as A Potential Source of Human Infection with Multiple-Drug-Resistant Strains of Yersinia enterocolitica and Yersinia pseudotuberculosis. Pathogens. 2022; 11(11):1266. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11111266
Chicago/Turabian StyleOdyniec, Marta, and Agata Bancerz-Kisiel. 2022. "Assessment of the Role of Free-Living and Farmed Fallow Deer (Dama dama) as A Potential Source of Human Infection with Multiple-Drug-Resistant Strains of Yersinia enterocolitica and Yersinia pseudotuberculosis" Pathogens 11, no. 11: 1266. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11111266