Alterations of Plasma Biochemical and Immunological Parameters and Spatiotemporal Expression of TLR2 and TLR9 in Gibel Carp (Carassius auratus gibelio) after CyHV-2 Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viral Infection and Sampling
2.2. Measurements of Biochemical and Immunological Parameters in Plasma
2.3. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR
2.4. Statistical Analysis
3. Results
3.1. Clinical Signs and Mortality of Gibel Carp after CyHV-2 Infection
3.2. Changes of Biochemical Parameters in Plasma of Gibel Carp
3.3. Changes in Immunological Parameters in Plasma of Gibel Carp
3.4. Gene Expression of TLR2 in Gibel Carp after CyHV-2 Infection
3.5. Gene Expression of TLR9 in Gibel Carp after CyHV-2 Infection
3.6. Differential mRNA Expression Profiles between TLR2 and TLR9 of Gibel Carp Post CyHV-2 Infection
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fan, Y.D.; Zhou, Y.; Zeng, L.B.; Jiang, N.; Liu, W.Z.; Zhao, J.Q.; Zhong, Q.W. Identification, structural characterization, and expression analysis of toll-like receptors 2 and 3 from gibel carp (Carassius auratus gibelio). Fish Shellfish Immunol. 2018, 72, 629–638. [Google Scholar] [CrossRef] [PubMed]
- Thangaraj, R.S.; Nithianantham, S.R.; Dharmaratnam, A.; Kumar, R.; Pradhan, P.K.; Gopakumar, S.T.; Sood, N. Cyprinid herpesvirus-2 (CyHV-2): A comprehensive review. Rev. Aquac. 2020, 13, 796–821. [Google Scholar] [CrossRef]
- Luo, Y.Z.; Lin, L.; Liu, Y.; Wu, Z.X.; Gu, Z.M.; Li, L.J.; Yuan, J.F. Haematopoietic necrosis of cultured prussian carp, Carassius gibelio (Bloch), associated with Cyprinid herpesvirus 2. J. Fish Dis. 2013, 36, 1035–1039. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.Z.; Lu, L.Q.; Wang, B.Y.; Yu, J.; Wang, H. Identification of the immediate-early genes of Cyprinid Herpesvirus 2. Viruses 2020, 12, 994. [Google Scholar] [CrossRef]
- Davison, A.J.; Kurobe, T.; Gatherer, D.; Cunningham, C.; Korf, I.; Fukuda, H.; Hedrick, R.P.; Waltzek, T.B. Comparative genomics of carp herpesviruses. J. Virol. 2013, 87, 2908–2922. [Google Scholar] [CrossRef] [PubMed]
- Hedrick, R.P.; Waltzek, T.B.; McDowell, T.S. Susceptibility of koi carp, common carp, goldfish, and goldfish × common carp hybrids to Cyprinid Herpesvirus-2 and Herpesvirus-3. J. Aquat. Anim. Health 2006, 18, 26–34. [Google Scholar] [CrossRef]
- Iwasaki, A.; Medzhitov, R. Regulation of adaptive immunity by the innate immune system. Science 2010, 327, 291–295. [Google Scholar] [CrossRef]
- Rauta, P.R.; Samanta, M.; Dash, H.R.; Nayak, B.; Das, S. Toll-like receptors (TLRs) in aquatic animals: Signaling pathways, expressions and immune responses. Immunol. Lett. 2014, 158, 14–24. [Google Scholar] [CrossRef]
- Arancibia, S.A.; Beltran, C.J.; Aguirre, I.M.; Silva, P.; Peralta, A.L.; Malinarich, F.; Hermoso, M.A. Toll-like receptors are key participants in innate immune responses. Biol. Res. 2007, 40, 97–112. [Google Scholar] [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef]
- Liao, Z.; Su, J. Progresses on three pattern recognition receptor families (TLRs, RLRs and NLRs) in teleost. Dev. Comp. Immunol. 2021, 122, 104131. [Google Scholar] [CrossRef] [PubMed]
- Meijer, A.H.; Gabby-Krens, S.F.; Medina-Rodriguez, I.A.; He, S.N.; Bitter, W.; Ewa Snaar-Jagalska, B.; Spaink, H.P. Expression analysis of the toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 2004, 40, 773–783. [Google Scholar] [CrossRef] [PubMed]
- Tanekhy, M. The role of Toll-like Receptors in innate immunity and infectious diseases of teleost. Aquac. Res. 2016, 47, 1369–1391. [Google Scholar] [CrossRef]
- Kiyoshi, T.; Tsuneyasu, K.; Shizuo, A. Toll-like receptors. Annu. Rev. Immunol. 2003, 21, 335–376. [Google Scholar]
- Palti, Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011, 35, 1263–1272. [Google Scholar] [CrossRef]
- Zhu, Z.H.; Sun, Y.N.; Wang, R.X.; Xu, T.J. Evolutionary analysis of TLR9 genes reveals the positive selection of extant teleosts in Perciformes. Fish Shellfish Immunol. 2013, 35, 448–457. [Google Scholar] [CrossRef]
- Tu, X.; Liu, L.; Qi, X.Z.; Chen, W.C.; Wang, G.X.; Ling, F. Characterization of Toll-like receptor gene expression in goldfish (Carassius auratus) during Dactylogyrus intermedius infection. Dev. Comp. Immunol. 2016, 63, 78–83. [Google Scholar] [CrossRef]
- Wang, K.L.; Chen, S.N.; Huo, H.J.; Nie, P. Identification and expression analysis of sixteen Toll-like receptor genes, TLR1, TLR2a, TLR2b, TLR3, TLR5M, TLR5S, TLR7-9, TLR13a-c, TLR14, TLR21-23 in mandarin fish Siniperca chuatsi. Dev. Comp. Immunol. 2021, 121, 104100. [Google Scholar] [CrossRef]
- Zhang, X.T.; Zhang, G.R.; Shi, Z.C.; Yuan, Y.J.; Zheng, H.; Lin, L.; Wei, K.J.; Ji, W. Expression analysis of nine Toll-like receptors in yellow catfish (Pelteobagrus fulvidraco) responding to Aeromonas hydrophila challenge. Fish Shellfish Immunol. 2017, 63, 384–393. [Google Scholar] [CrossRef]
- Wei, Y.C.; Hu, S.; Sun, B.B.; Zhang, Q.H.; Qiao, G.; Wang, Z.S.; Shao, R.; Huang, G.Q.; Qi, Z.T. Molecular cloning and expression analysis of toll-like receptor genes (TLR7, TLR8 and TLR9) of golden pompano (Trachinotus ovatus). Fish Shellfish Immunol. 2017, 63, 270–276. [Google Scholar] [CrossRef]
- Wu, M.; Guo, L.; Zhu, K.C.; Guo, H.Y.; Liu, B.; Jiang, S.G.; Zhang, D.C. Genomic structure and molecular characterization of Toll-like receptors 1 and 2 from golden pompano Trachinotus ovatus (Linnaeus, 1758) and their expression response to three types of pathogen-associated molecular patterns. Dev. Comp. Immunol. 2018, 86, 34–40. [Google Scholar] [CrossRef] [PubMed]
- Mou, C.Y.; Wang, Y.; Zhang, Q.Y.; Gao, F.X.; Li, Z.; Tong, J.F.; Zhou, L.; Gui, J.F. Differential interferon system gene expression profiles in susceptible and resistant gynogenetic clones of gibel carp challenged with herpesvirus CaHV. Dev. Comp. Immunol. 2018, 86, 52–64. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.J.; Luo, D.J. Application of haematology parameters for health management in fish farms. Rev. Aquac. 2023, 15, 704–737. [Google Scholar] [CrossRef]
- Lu, J.; Lu, H.D.; Cao, G.P. Hematological and histological changes in prussian carp Carassius gibelio infected with Cyprinid Herpesvirus 2. J. Aquat. Anim. Health 2016, 28, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Liang, L.; Xie, J.; Chen, K.; Bing, X.W. Pathogenicity and biological characteristics of CyHV-2. Bull. Eur. Assoc. Fish Pathol. 2015, 35, 84–92. [Google Scholar]
- Dulbecco, R. Production of plaques in monolayer tissue cultures by single particles of an animal virus. Proc. Natl. Acad. Sci. USA 1952, 38, 747–752. [Google Scholar] [CrossRef]
- Lawrence, M.J.; Raby, G.D.; Teffer, A.K.; Jeffries, K.M.; Danylchuk, A.J.; Eliason, E.J.; Hasler, C.T.; Clark, T.D.; Cooke, S.J. Best practices for non-lethal blood sampling of fish via the caudal vasculature. J. Fish Biol. 2020, 97, 4–15. [Google Scholar] [CrossRef]
- Sudhagar, A.; El-Matbouli, M.; Kumar, G. Identification and expression profiling of toll-like receptors of brown trout (Salmo trutta) during proliferative kidney disease. Int. J. Mol. Sci. 2020, 21, 3755. [Google Scholar] [CrossRef]
- Wang, L.; He, J.; Liang, L.; Zheng, X.; Jia, P.; Shi, W.; Xie, J.; Liu, H.; Xu, P. Mass mortality caused by Cyprinid Herpesvirus 2 (CyHV-2) in Prussian carp (Carassius gibelio) in China. Bull. Eur. Assoc. Fish Pathol. 2012, 32, 164–173. [Google Scholar]
- Du-Carrée, J.L.; Morin, T.; Danion, M. Impact of chronic exposure of rainbow trout, Oncorhynchus mykiss, to low doses of glyphosate or glyphosate-based herbicides. Aquat. Toxicol. 2021, 230, 105687. [Google Scholar] [CrossRef]
- Reyes-Becerril, M.; Angulo, C.; Ascencio, F. Humoral immune response and TLR9 gene expression in Pacific red snapper (Lutjanus peru) experimentally exposed to Aeromonas veronii. Fish Shellfish Immunol. 2015, 42, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Lau-Cam, C.A. Taurine enhances the protective actions of fish oil against D-galactosamine-induced metabolic changes and hepatic lipid accumulation and injury in the rat. In Taurine 11, Advances in Experimental Medicine and Biology; Springer Nature Pte Ltd.: Singapore, 2019; Volume 1155, pp. 71–85. [Google Scholar]
- Yonar, S.M. Growth performance, haematological changes, immune response, antioxidant activity and disease resistance in rainbow trout (Oncorhynchus mykiss) fed diet supplemented with ellagic acid. Fish Shellfish Immunol. 2019, 95, 391–398. [Google Scholar] [CrossRef]
- Ayyat, M.S.; Mahmoud, H.K.; El-Hais, A.M.; Abd El-Latif, K.M. The role of some feed additives in fish fed on diets contaminated with cadmium. Environ. Sci. Pollut. Res. 2017, 24, 23636–23645. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, P.J.; Wang, B.; Lu, Y.T.; Li, L.; Li, Y.H.; Liu, S.J. Evaluation of the effects of Astragalus polysaccharides as immunostimulants on the immune response of crucian carp and against SVCV in vitro and in vivo. Comp. Biochem. Phys. C 2022, 253, 109249. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.Y.; Nie, L.; Zhu, G.; Xiang, L.X.; Shao, J.Z. Advances in research of fish immune-relevant genes: A comparative overview of innate and adaptive immunity in teleosts. Dev. Comp. Immunol. 2013, 39, 39–62. [Google Scholar] [CrossRef]
- Xia, H.; Wu, K.; Liu, W.J.; Wang, W.M.; Zhang, X.Z. Spatio-temporal expression of blunt snout bream (Megalobrama amblycephala) mIgD and its immune response to Aeromonas hydrophila. Cent. Eur. J. Immunol. 2015, 40, 132–141. [Google Scholar] [CrossRef]
- Bilal, S.; Lie, K.; Karlsen, O.A.; Hordvik, I. Characterization of IgM in Norwegian cleaner fish (lumpfish and wrasses). Fish Shellfish Immunol. 2016, 59, 9–17. [Google Scholar] [CrossRef]
- Kong, X.H.; Tang, H.R.; Zhu, Y.C.; Zhang, J.; Li, C.J.; Zhao, X.L.; Pei, C.; Zhou, Y.; Zeng, L.B. Molecular characterizations of TLR1 and TLR2 in Qihe crucian carp (Carassius auratus) and responses to stimulations of Aeromonas hydrophila and TLR ligands. Aquac. Int. 2023, 31, 1349–1374. [Google Scholar] [CrossRef]
- Gao, Q.X.; Xiao, Y.P.; Zhang, C.J.; Min, M.H.; Peng, S.M.; Shi, Z.H. Molecular characterization and expression analysis of toll-like receptor 2 in response to bacteria in silvery pomfret intestinal epithelial cells. Fish Shellfish Immunol. 2016, 58, 1–9. [Google Scholar] [CrossRef]
- He, L.B.; Wang, H.; Luo, L.F.; Jiang, S.H.; Liu, L.Y.; Li, Y.M.; Huang, R.; Liao, L.J.; Zhu, Z.Y.; Wang, Y.P. Characterization, expression analysis and localization pattern of toll-like receptor 1 (tlr1) and toll-like receptor 2 (tlr2) genes in grass carp Ctenopharyngodon idella. J. Fish Biol. 2016, 89, 1434–1440. [Google Scholar] [CrossRef]
- Hedrick, R.P.; Gilad, O.; Yun, S.; Spangenberg, J.; Marty, G.; Nordhausen, R.; Kebus, M.; Bercovier, H.; Eldar, A. A herpesvirus associated with mass mortality of juvenile and adult koi, a strain of common carp. J. Aquat. Anim. Health 2000, 12, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Qin, C.J.; Sun, J.X.; He, Y.; Wang, J.; Han, Y.W.; Li, H.T.; Liao, X.F. Diurnal rhythm and pathogens induced expression of toll-like receptor 9 (TLR9) in Pelteobagrus vachellii. Fish Shellfish Immunol. 2019, 87, 879–885. [Google Scholar] [CrossRef] [PubMed]
- Morcillo, P.; Esteban, M.A.; Cuesta, A. Effects of nodavirus (VNNV) infection on gene expression profile in the gilthead seabream cell line SAF-1. Fish Shellfish Immunol. 2013, 34, 1726. [Google Scholar] [CrossRef]
- Gao, F.Y.; Liu, J.; Lu, M.X.; Liu, Z.G.; Wang, M.; Ke, X.L.; Yi, M.M.; Cao, J.M. Nile tilapia Toll-like receptor 7 subfamily: Intracellular TLRs that recruit MyD88 as an adaptor and activate the NF-κB pathway in the immune response. Dev. Comp. Immunol. 2021, 125, 104173. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.Y.; Su, B.F.; Zhou, S.; Shang, M.; Yan, H.; Liu, F.Q.; Gao, C.B.; Tan, F.H.; Li, C. Identification and expression analysis of toll-like receptor genes (TLR8 and TLR9) in mucosal tissues of turbot (Scophthalmus maximus L.) following bacterial challenge. Fish Shellfish Immunol. 2016, 58, 309–317. [Google Scholar] [CrossRef]
- Lester, S.N.; Li, K. Toll-like receptors in antiviral innate immunity. J. Mol. Biol. 2014, 426, 1246–1264. [Google Scholar] [CrossRef]
- Zhao, F.; Li, Y.W.; Pan, H.J.; Shi, C.B.; Luo, X.C.; Li, A.X.; Wu, S.Q. Expression profiles of toll-like receptors in channel catfish (Ictalurus punctatus) after infection with Ichthyophthirius multifiliis. Fish Shellfish Immunol. 2013, 35, 993–997. [Google Scholar] [CrossRef]
- Yang, Y.C.; Ren, Y.Q.; Zhang, Y.T.; Wang, G.X.; He, Z.W.; Liu, Y.F.; Cao, W.; Wang, Y.F.; Chen, S.L.; Fu, Y.S.; et al. A new cell line derived from the spleen of the japanese flounder (Paralichthys olivaceus) and its application in viral study. Biology 2022, 11, 1697. [Google Scholar] [CrossRef]
- Farooq, M.; Batool, M.; Kim, M.S.; Choi, S. Toll-like receptors as a therapeutic target in the era of immunotherapies. Front. Cell Dev. Biol. 2021, 9, 756315. [Google Scholar] [CrossRef]
- Es-saad, S.; Tremblay, N.; Baril, M.; Lamarre, D. Regulators of innate immunity as novel targets for panviral therapeutics. Curr. Opin. Virol. 2012, 2, 622–628. [Google Scholar] [CrossRef]
Gene | Primer | Sequence (5′→3′) | Amplicon Size (bp) | GenBank No. |
---|---|---|---|---|
TLR2 | TLR2-F | ACGTTTCTGCAAGCTACGGA | 71 | KC816575.1 |
TLR2-R | TCTTTTCCTCGTCTTCGGGC | |||
TLR9 | TLR9-F | CCAGAGTCATTGGCTGGTGT | 158 | KC816577.1 |
TLR9-R | CAGTACCACAGGTCCCAACC | |||
18S rRNA | 18S-F | ATTTCCGACACGGAGAGG | 90 | XR_003280668.1 |
18S-R | CATGGGTTTAGGATACGCTC |
Sequence Features | TLR2 | TLR9 |
---|---|---|
Chromosome number | 8 | 16 |
Location | 29807236-29812111 | 11390400-11400035 |
Orientation | R | F |
mRNA accession number | KC816575.1 | KC816577.1 |
mRNA length | 2624 | 3453 |
Protein accession number | AGO57934.1 | AGO57936.1 |
Amino acid length | 791 | 1064 |
Isoelectric point | 8.63 | 8.38 |
Molecular weight (kDa) | 122.2 | 99.2 |
Subcellular location | Plasma membrane | Plasma membrane |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, J.; Hu, Y.; Xie, M.; Wu, H.; Wu, J.; Xi, B.; Song, R.; Ou, D. Alterations of Plasma Biochemical and Immunological Parameters and Spatiotemporal Expression of TLR2 and TLR9 in Gibel Carp (Carassius auratus gibelio) after CyHV-2 Infection. Pathogens 2023, 12, 1329. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111329
Gao J, Hu Y, Xie M, Wu H, Wu J, Xi B, Song R, Ou D. Alterations of Plasma Biochemical and Immunological Parameters and Spatiotemporal Expression of TLR2 and TLR9 in Gibel Carp (Carassius auratus gibelio) after CyHV-2 Infection. Pathogens. 2023; 12(11):1329. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111329
Chicago/Turabian StyleGao, Jinwei, Yiwen Hu, Min Xie, Hao Wu, Jiayu Wu, Bingwen Xi, Rui Song, and Dongsheng Ou. 2023. "Alterations of Plasma Biochemical and Immunological Parameters and Spatiotemporal Expression of TLR2 and TLR9 in Gibel Carp (Carassius auratus gibelio) after CyHV-2 Infection" Pathogens 12, no. 11: 1329. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111329