Cardiac Abnormalities in a Predictive Mouse Model of Chagas Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice and Parasites
2.2. ECG Recording and Analysis
2.3. In Vivo and Ex Vivo Bioluminescence Imaging
2.4. Cardiac Histopathological Analysis
2.5. Immunohistochemistry for iNOS Detection
2.6. RT-qPCR
2.7. Statistical Analyses
3. Results
3.1. Longitudinal ECG Monitoring of T. cruzi-Infected Mice
3.2. Analysis of Heart-Specific Infection
3.3. Upregulation of Cardiac iNOS Expression during Acute and Chronic T. cruzi Infection
3.4. Expression of Neuronal-Specific Genes in Cardiac Tissue during T. cruzi Infection
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization (WHO). 2023. Available online: https://www.who.int/news-room/fact-sheets/detail/chagas-disease-(american-trypanosomiasis) (accessed on 15 November 2023).
- Bonney, K.M.; Engman, D.M. Chagas heart disease pathogenesis: One mechanism or many? Curr. Mol. Med. 2008, 8, 510–518. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Molina, J.A.; Molina, I. Chagas disease. Lancet 2018, 391, 82–94. [Google Scholar] [CrossRef] [PubMed]
- Bonney, K.M.; Luthringer, D.J. Pathology and pathogenesis of Chagas heart disease. Annu. Rev. Pathol. 2019, 24, 421–447. [Google Scholar] [CrossRef] [PubMed]
- Pack, A.D.; Collins, M.H. Highly competent, non-exhausted CD8+ T cells continue to tightly control pathogen load throughout chronic Trypanosoma cruzi infection. PLoS Pathog. 2018, 14, e1007410. [Google Scholar] [CrossRef]
- Tarleton, R.L. CD8+ T cells in Trypanosoma cruzi infection. Semin. Immunopathol. 2015, 37, 233–238. [Google Scholar] [CrossRef]
- Malik, L.H.; Singh, G.D. The Epidemiology, Clinical manifestations, and management of Chagas heart disease. Clin. Cardiol. 2015, 38, 565–569. [Google Scholar] [CrossRef]
- Ribeiro, A.L.; Nunes, M.P. Diagnosis and management of Chagas disease and cardiomyopathy. Nat. Rev. Cardiol. 2012, 9, 576–589. [Google Scholar] [CrossRef]
- Rojas, L.Z.; Glisic, M. Electrocardiographic abnormalities in Chagas disease in the general population: A systematic review and meta-analysis. PLoS Negl. Trop. Dis. 2018, 12, e0006567. [Google Scholar] [CrossRef]
- Brito, B.O.F.; Ribeiro, A.L.P. Electrocardiogram in Chagas disease. Rev. Soc. Bras. Med. Trop. 2018, 51, 570–577. [Google Scholar] [CrossRef]
- Di Lorenzo Oliveira, C.; Nunes, M.C.P. Risk score for predicting 2-Year mortality in patients with Chagas cardiomyopathy from endemic areas: SaMi-Trop Cohort Study. J. Am. Heart Assoc. 2020, 9, e014176. [Google Scholar] [CrossRef]
- Echeverría, L.E.; Rojas, L.Z. Longitudinal strain by speckle tracking and echocardiographic parameters as predictors of adverse cardiovascular outcomes in chronic Chagas cardiomyopathy. Int. J. Cardiovasc. Imaging. 2022, 38, 1245–1255. [Google Scholar] [CrossRef] [PubMed]
- Salazar-Schettino, P.M.; Cabrera-Bravo, M. Chagas Disease in Mexico: Report of 14 Cases of Chagasic Cardiomyopathy in Children. Tohoku. J. Exp. Med. 2016, 240, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, H.O.; Guerrero, N.A. Trypanosoma cruzi strains cause different myocarditis patterns in infected mice. Acta Trop. 2014, 139, 57–66. [Google Scholar] [CrossRef]
- Queiroga, T.B.D.; Pereira, N.S. Virulence of Trypanosoma cruzi strains is related to the differential expression of innate immune receptors in the heart. Front Cell Infect. Microbiol. 2021, 11, 696719. [Google Scholar] [CrossRef] [PubMed]
- Lewis, M.D.; Francisco, A.F. Host and parasite genetics shape a link between Trypanosoma cruzi infection dynamics and chronic cardiomyopathy. Cell Microbiol. 2016, 18, 1429–1443. [Google Scholar] [CrossRef]
- Caldas, I.S.; Diniz, L.F. Host genetics background influence in the intragastric Trypanosoma cruzi infection. Acta Trop. 2017, 167, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Francisco, A.F.; Jayawardhana, S. Assessing the effectiveness of curative benznidazole treatment in preventing chronic cardiac pathology in experimental models of Chagas disease. Antimicrob. Agents Chemother. 2018, 62, e00832-18. [Google Scholar] [CrossRef]
- Tarleton, R.L.; Zhang, L. “Autoimmune rejection” of neonatal heart transplants in experimental Chagas disease is a parasite-specific response to infected host tissue. Proc. Natl. Acad. Sci. USA 1997, 94, 3932–3937. [Google Scholar] [CrossRef]
- Bonney, K.M.; Engman, D.M. Autoimmune pathogenesis of Chagas heart disease: Looking back, looking ahead. Amer. J. Pathol. 2015, 185, 1537–1547. [Google Scholar] [CrossRef]
- Lewis, M.D.; Francisco, A.F. Bioluminescence imaging of chronic Trypanosoma cruzi infections reveals tissue-specific parasite dynamics and heart disease in the absence of locally persistent infection. Cell Microbiol. 2014, 16, 1285–1300. [Google Scholar] [CrossRef]
- Lewis, M.D.; Kelly, J.M. Putting Trypanosoma cruzi dynamics at the heart of Chagas disease. Trends. Parasitol. 2016, 32, 899–911. [Google Scholar] [CrossRef] [PubMed]
- Lewis, M.D.; Fortes Francisco, A. A new experimental model for assessing drug efficacy against Trypanosoma cruzi infection based on highly sensitive in vivo imaging. J. Biomolec. Screen. 2015, 20, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Branchini, B.R.; Ablamsky, D.M. Red-emitting luciferases for bioluminescence reporter and imaging applications. Anal. Biochem. 2010, 396, 290–297. [Google Scholar] [CrossRef]
- Schuldt, A.J.T.; Hampton, T.J. Electrocardiographic and other cardiac anomalies in beta-glucuronidase-null mice corrected by nonablative neonatal marrow transplantation. Proc. Natl. Acad. Sci. USA 2004, 101, 603–608. [Google Scholar] [CrossRef] [PubMed]
- Mabe, A.M.; Hoover, D.B. Structural and functional cardiac cholinergic deficits in adult neurturin knockout mice. Cardiovasc. Res. 2009, 82, 93–99. [Google Scholar] [CrossRef] [PubMed]
- Xing, S.; Tsaih, S.W. Genetic influence on electrocardiogram time intervals and heart rate in aging mice. Am. J. Physiol. Heart Circ. Physiol. 2009, 296, H1907–H1913. [Google Scholar] [CrossRef]
- Arantes, R.M.E.; Marche, H.H.F. Interferon-gamma-induced nitric oxide causes intrinsic intestinal denervation in Trypanosoma cruzi-infected mice. Am. J. Pathol. 2004, 164, 1361–1368. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Eickhoff, C.S.; Lawrence, C.T. ECG detection of murine chagasic cardiomyopathy. J. Parasitol. 2010, 96, 758–764. [Google Scholar] [CrossRef]
- Roman-Campos, D.; Sales-Junior, P. Novel insights into the development of chagasic cardiomyopathy: Role of PI3Kinase/NO axis. Int. J. Cardiol. 2013, 167, 3011–3020. [Google Scholar] [CrossRef]
- Navarro, I.C.; Ferreira, F.M. MicroRNA transcriptome profiling in heart of Trypanosoma cruzi-infected mice: Parasitological and cardiological outcomes. PLoS Negl. Trop. Dis. 2015, 9, e0003828. [Google Scholar] [CrossRef] [PubMed]
- Vilar-Pereira, G.; Carneiro, V.C. Resveratrol reverses functional Chagas heart disease in mice. PLoS Pathog. 2016, 12, e1005947. [Google Scholar] [CrossRef] [PubMed]
- Carbajosa, S.; Rodríguez-Angulo, H.O. L-arginine supplementation reduces mortality and improves disease outcome in mice infected with Trypanosoma cruzi. PLoS Negl. Trop. Dis. 2018, 12, e0006179. [Google Scholar] [CrossRef]
- Santos-Miranda, A.; Joviano-Santos, J.V. Reactive oxygen species and nitric oxide imbalances lead to in vivo and in vitro arrhythmogenic phenotype in acute phase of experimental Chagas disease. PLoS Pathog. 2020, 16, e1008379. [Google Scholar] [CrossRef] [PubMed]
- Chuenkova, M.V.; Pereiraperrin, M. Neurodegeneration and neuroregeneration in Chagas disease. Adv. Parasitol. 2011, 76, 195–233. [Google Scholar] [PubMed]
- Zhang, Y.H.; Jin, C.Z. Molecular mechanisms of neuronal nitric oxide synthase in cardiac function and pathophysiology. J. Physiol. 2014, 592, 3189–3200. [Google Scholar] [CrossRef]
- Burger, D.E.; Lu, X. Neuronal nitric oxide synthase protects against myocardial infarction-induced ventricular arrhythmia and mortality in mice. Circulation 2009, 120, 1345–1354. [Google Scholar] [CrossRef]
- Harada, A.; Teng, J. MAP2 is required for dendrite elongation, PKA anchoring in dendrites, and proper PKA signal transduction. J. Cell Biol. 2002, 158, 541–549. [Google Scholar] [CrossRef]
- Almeida-Leite, C.M.; Galvão, L.M. Interferon-gamma induced nitric oxide mediates in vitro neuronal damage by Trypanosoma cruzi-infected macrophages. Neurobiol. Dis. 2007, 25, 170–178. [Google Scholar] [CrossRef]
- Ward, A.I.; Lewis, M.D. In vivo analysis of Trypanosoma cruzi persistence foci at single-cell resolution. mBio 2020, 11, e01242-20. [Google Scholar] [CrossRef]
- Porrello, E.R.; Mahmoud, A.I. Transient regenerative potential of the neonatal mouse heart. Science 2011, 331, 1078–1080. [Google Scholar] [CrossRef] [PubMed]
- Rassi, A., Jr.; Rassi, A. Chagas’ heart disease. Clin. Cardiol. 2000, 23, 883–889. [Google Scholar] [PubMed]
- Sabino, E.C.; Ribeiro, A.L. Ten-year incidence of Chagas cardiomyopathy among asymptomatic Trypanosoma cruzi-seropositive former blood donors. Circulation 2013, 127, 1105–1115. [Google Scholar] [CrossRef] [PubMed]
- Hevia-Montiel, N.; Perez-Gonzalez, J. Machine Learning-Based Feature Selection and Classification for the Experimental Diagnosis of Trypanosoma cruzi. Electronics 2022, 11, 785. [Google Scholar] [CrossRef]
- Tucci, A.R.; de Oliveira, F.O.R., Jr. Role of FAK signaling in chagasic cardiac hypertrophy. Braz. J. Infect. Dis. 2020, 24, 386–397. [Google Scholar] [CrossRef]
- Williams-Blangero, S.; Magalhaes, T. Electrocardiographic characteristics in a population with high rates of seropositivity for Trypanosoma cruzi infection. Am. J. Trop. Med. Hyg. 2007, 77, 495–499. [Google Scholar] [CrossRef]
- Khan, A.A.; Langston, H.C. Local association of Trypanosoma cruzi chronic infection foci and enteric neuropathic lesions at the tissue micro-domain scale. PLoS Pathogens. 2021, 17, e1009864. [Google Scholar] [CrossRef]
- Haro, P.; Hevia-Montiel, N. ECG marker evaluation for the machine-learning-based classification of acute and chronic phases of Trypanosoma cruzi infection in a murine model. Trop. Med. Infect. Dis. 2023, 8, 157. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer | Size (bp) |
---|---|---|---|
HPRT1 | GCTTGCTGGTGAAAAGGACCTCTCGAAG | CCCTGAAGTACTCATTATAGTCAAGGGCAT | 117 |
PGP9.5 | CCTGTGGTACCATCGGGTTG | GGCTCTATCTTCGGGGGACA | 125 |
SubP | CCGACTGGTCCGACAGTGAC | CGCTTGCCCATTAATCCAAA | 118 |
nNOS | ACTGACACCCTGCACCTGAAGA | GTGCGGACATCTTCTGACTTCC | 113 |
iNOS | CAGCTGGGCTGTACAAACCTT | CATTGGAAGTGAAGCGTTTCG | 95 |
eNOS | CCTCGAGTAAAGAATTGGGAAGTG | AACTTCCTTGGAAACACCAGGG | 121 |
TrKA | CGCTGAGTGCTACAACCTTC | GAAAGTCCTGCCGAGCATTC | 95 |
TrKC | TACCTGGCTTCCCAGCACTTTG | GTGTCCTCCCACCCTGTAGTAATC | 140 |
NGFR | GGTGATGGCAACCTCTACAGT | CCTCGTGGGTAAAGGAGTCTA | 139 |
TH | TCCTGCACTCCCTGTCAGAG | CACCGGCTGGTAGGTTTGAT | 95 |
VAChT | CCCTTAAGCGGGCCTTTCATTGAT | AAAGGCAAACATGACTGTGGAGGC | 96 |
MAP2 | AGTGGAGGAAGCAGCAAGTGGTGACT | GAGGAGGGAGGATGGAGGAAGGTCT | 140 |
GAPDH | TCCTGCACCACCAACTGCTT | CACGCCACAGCTTTCCAGAG | 141 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Francisco, A.F.; Sousa, G.R.; Vaughan, M.; Langston, H.; Khan, A.; Jayawardhana, S.; Taylor, M.C.; Lewis, M.D.; Kelly, J.M. Cardiac Abnormalities in a Predictive Mouse Model of Chagas Disease. Pathogens 2023, 12, 1364. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111364
Francisco AF, Sousa GR, Vaughan M, Langston H, Khan A, Jayawardhana S, Taylor MC, Lewis MD, Kelly JM. Cardiac Abnormalities in a Predictive Mouse Model of Chagas Disease. Pathogens. 2023; 12(11):1364. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111364
Chicago/Turabian StyleFrancisco, Amanda Fortes, Giovane R. Sousa, Mhairi Vaughan, Harry Langston, Archie Khan, Shiromani Jayawardhana, Martin C. Taylor, Michael D. Lewis, and John M. Kelly. 2023. "Cardiac Abnormalities in a Predictive Mouse Model of Chagas Disease" Pathogens 12, no. 11: 1364. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens12111364