Next Article in Journal
Herpesviruses and SARS-CoV-2: Viral Association with Oral Inflammatory Diseases
Next Article in Special Issue
Verification of a Rapid Analytical Method for the Qualitative Detection of Listeria spp. and Listeria monocytogenes by a Real-Time PCR Assay according to EN UNI ISO 16140-3:2021
Previous Article in Journal
Heat Treatment Augments Antigen Detection of Dirofilaria immitis in Apparently Healthy Companion Dogs (3.8% to 7.3%): Insights from a Large-Scale Nationwide Survey across the United States
Previous Article in Special Issue
Addressing Current Challenges in Poultry Meat Safety: Development of a Cultivation and Colony Hybridization Approach to Recover Enterotoxigenic Clostridium perfringens from Broiler Chicken Carcasses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus

Experimental Seafood Processing Laboratory, Coastal Research & Extension Center, Mississippi State University, Pascagoula, MS 39567, USA
*
Authors to whom correspondence should be addressed.
Submission received: 4 December 2023 / Revised: 27 December 2023 / Accepted: 4 January 2024 / Published: 6 January 2024

Abstract

:
Vibrio parahaemolyticus causes severe gastroenteritis in humans after consuming contaminated raw or undercooked seafood. A species-specific marker, the thermolabile hemolysin (tlh) gene, and two pathogenic markers, thermostable-related hemolysin (trh) and thermostable-direct hemolysin (tdh) genes, have been used to identify V. parahaemolyticus and determine its pathogenicity using both PCR and qPCR assays. To enable testing in field conditions with limited resources, this study aimed to develop a simple and rapid method to detect the species-specific (tlh) and pathogenic (trh and tdh) genes of V. parahaemolyticus using multienzyme isothermal rapid amplification (MIRA) combined with a lateral-flow dipstick (LFD). The amplification of the tlh, trh, and tdh genes could be completed within 20 min at temperatures ranging from 30 to 45 °C (p < 0.05). The test yielded positive results for V. parahaemolyticus but produced negative results for nine Vibrio species and eighteen foodborne pathogenic bacterial species. MIRA-LFD could detect 10 fg of DNA and 2 colony-forming units (CFU) of V. parahaemolyticus per reaction, demonstrating a sensitivity level comparable to that of qPCR, which can detect 10 fg of DNA and 2 CFU per reaction. Both MIRA-LFD and qPCR detected seven tlh-positive results from thirty-six oyster samples, whereas one positive result was obtained using the PCR assay. No positive results for the trh and tdh genes were obtained from any oyster samples using MIRA-LFD, PCR, and qPCR. This study suggests that MIRA-LFD is a simple and rapid method to detect species-specific and pathogenic genes of V. parahaemolyticus with high sensitivity.

1. Introduction

Vibrio parahaemolyticus is a Gram-negative halophilic bacterium that inhabits warm estuarine and marine environments worldwide [1]. It has been isolated from various fish and shellfish species, earning it a reputation as one of the critical foodborne pathogenic bacteria responsible for illness after consuming contaminated raw or undercooked seafood [2]. The U.S. Centers for Disease Control and Prevention (CDC) estimates that approximately 84,000 people have suffered from foodborne illnesses due to Vibrio infections in the U.S., even though most Vibrio infections are not officially recorded [3,4].
Two distinctive pathogenic markers, namely, the thermostable-related hemolysin encoded by the trh gene and thermostable-direct hemolysin encoded by the tdh gene, have been recognized as crucial indicators of the pathogenicity of V. parahaemolyticus-induced gastroenteritis [5,6,7,8]. Despite sharing a 67% similarity in their amino acid sequences and having similar predicted functions, both genes serve as essential pathogenic markers [9]. A study has revealed that clinical isolates demonstrate over 80 percent tdh positivity and less than 20 percent trh positivity [10]. Similarly, more than 90 percent of patients suffering from V. parahaemolyticus infections have shown tdh positivity [11]. However, V. parahaemolyticus isolates from environmental sources are generally considered avirulent to humans, as only a low number of isolates showed trh or tdh positivity [10,12]. For instance, an investigation conducted in the coastal areas of Georgia and South Carolina in the U.S. demonstrated that only 0.3% and 4.3% of V. parahaemolyticus strains possessed the trh and tdh genes, respectively [13]. As almost 90% of V. parahaemolyticus infections stem from eating undercooked or raw oysters in the U.S. [4], identifying pathogenicity (trh and/or tdh positivity) in V. parahaemolyticus is of utmost importance, not only to ensure public health but also to protect the seafood industry.
Although various genes have been selected for identifying V. parahaemolyticus, including tlh, pR72H, toxRS, toxR, and ORF8 [14,15,16,17,18], the tlh gene is currently used as the species-specific marker to identify V. parahaemolyticus according to the Bacteriological Analytical Manual (BAM) published by the U.S. Food and Drug Administration (FDA) [19]. This gene encodes the thermolabile hemolysin, which has not been reported to show virulence in humans, while most virulent isolates demonstrated trh and/or tdh positivity [2,14]. Various PCR and qPCR methods have been introduced to confirm tlh, trh, and tdh positivity, showing high sensitivity and specificity [20]. For instance, a multiplex PCR assay could detect tlh, trh, and tdh positivity from 100 CFU/10 g of oyster homogenates [14], while a multiplex qPCR assay could detect those genes from less than 10 CFU/reaction of V. parahaemolyticus [21]. Both assays showed high specificity, with no positive reactions from other Vibrio species or foodborne bacteria.
The recombinase polymerase amplification (RPA) assay has been proposed for the rapid identification of various pathogens in restricted field conditions, as PCR assays require laboratory conditions, including well-trained operators and PCR-related instruments [22,23,24]. RPA is an isothermal nucleic acid amplification method that completes target gene amplification via an enzymatic primer–protein binding process within 15 min at 37–42 °C [25]. The subsequent RPA amplicon can be visualized by using the lateral-flow dipstick (LFD) assay, enabling the result to be shown by the visualization of both the control line and positive test line on a strip within 5 min [26]. So far, four RPA detection methods have been developed to detect V. parahaemolyticus in seafood using the gyrB, NC_004605, ToxR, and tlh genes, and studies indicate that RPA-LFD is a promising method to use in field conditions [27,28,29,30]. However, there has been no RPA research on the development of two distinctive pathogenic markers (trh and tdh) of V. parahaemolyticus, while a study demonstrated the difficulty of developing RPA for both genes [30].
Recently, a new RPA method, known as multienzyme isothermal rapid amplification (MIRA), has been introduced to achieve the rapid, sensitive, and specific amplification of the target gene through the synergetic action of various functional proteins, including helicase, recombinase, single-stranded binding protein, and DNA polymerase [31]. MIRA uses a different source of recombinase (Streptomyces azure recA, SC-recA), which may enhance the stability of the reaction and resistance to interference [31]. In the present study, the MIRA-LFD assay was developed to rapidly detect not only the species-specific tlh gene but also the two pathogenic trh and tdh genes of V. parahaemolyticus for field conditions with limited resources. The sensitivity and specificity of the MIRA-LFD assay were determined and compared with those of the PCR and qPCR assays.

2. Materials and Methods

2.1. Bacterial Strains and DNA Extraction

Vibrio parahaemolyticus F11-3A served as the reference strain to determine the amplification of the tlh, trh, and tdh genes [21]. To assess the specificity of RPA-LFD, closely related Vibrio strains and other foodborne bacteria were examined (Table 1). All bacteria were cultured on tryptic soy agar (TSA, Remel, San Diego, CA, USA) or in tryptic soy broth (TSB, Remel) at 37 °C. Genomic DNA was extracted from the bacteria using the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA) following the manufacturer’s instructions. The concentration of genomic DNA was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and DNA samples with spectrophotometric ratios of 1.8 to 2.0 (A260/A280) were stored at −20 °C until use.

2.2. Primers and Probes

The tlh (Gene ID: 1190914), trh (GenBank: KP836460.1), and tdh (Gene ID: 1192010) genes were used to design primers and probes using Primer-BLAST (http://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/tools/primer-blast/, accessed on 17 March 2023), Oligo Calc: Oligonucleotide Properties Calculator (http://biotools.nubic.northwestern.edu/OligoCalc.html, accessed on 17 March 2023), and Primer3 Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi, accessed on 17 March 2023). The 5′ ends of reverse primers were labeled with biotin for attachment to the lateral-flow dipstick (LFD, HybriDetect 1, Milenia Biotec, Giessen, Germany). In addition, the LFD probe was labeled with a polymerase extension blocking group (C3 spacer) at the 5′ end, an internal abasic nucleotide analog (dSpacer tetrahydrofuran residue) replacing a nucleotide, and a carboxyfluorescein (FAM) group at the 3′ end. All primers and probes used for basic RPA and MIRA-LFD in this study are listed in Table 2.

2.3. Basic Recombinase Polymerase Amplification (Basic RPA)

To determine the optimal primer set, the basic RPA assay (TwistDx, Cambridge, UK) was conducted using the primers listed in Table 2. In brief, the reaction mixture consisted of 2.4 µL of each primer (10 µM), 29.5 µL of rehydration buffer, 11.2 µL of water, and 2 µL of genomic DNA. This mixture was transferred to a tube containing a lyophilized reaction pellet and mixed by vortexing until the entire pellet was fully resuspended. Following the addition of 2.5 µL of MgAc (280 mM), the reaction was incubated at 40 °C for 20 min using a water bath. The resulting amplicon was then electrophoresed through a 1% TBE (TBE, Alfa Aesar, Ward Hill, MA, USA) agarose gel containing the SYBR Safe DNA gel stain (Invitrogen, Waltham, MA, USA) and visualized using the Gel Doc XR+ system (Bio-Rad, Hercules, CA, USA).

2.4. Multienzyme Isothermal Rapid Amplification (MIRA) and Lateral-Flow Dipstick (LFD)

As depicted in Figure 1, the MIRA-LFD assay was carried out by combining the MIRA nfo kit (Amp-Future, Changzhou, China) with the lateral-flow dipstick (LFD). Briefly, a MIRA mixture composed of 11.5 µL of nuclease-free water, 2 µL of DNA template, 29.4 µL of A buffer, 2 µL of forward and reverse primers (10 µM), and 0.6 µL of the probe (10 µM) was added to a test tube containing a lyophilized pellet. After adding 2.5 µL of MgAc (280 mM), the tube was incubated at 40 °C for 15 min to conduct the MIRA reaction. To visualize the amplified product, which was labeled with carboxyfluorescein (FAM) and an antigenic tag (biotin), 5 µL of the MIRA product was diluted in 195 µL of HybriDetect assay buffer. The sample pad of the LFD was immersed in the diluted solution and incubated for 2 min at room temperature. The clear visualization of both test and control lines on the LFD was considered a positive result, while the appearance of only the control band on the strip was regarded as negative.

2.5. Optimization of MIRA-LFD

Genomic DNA from V. parahaemolyticus F11-3A (1 ng per reaction) was used to determine the optimization of MIRA-LFD. Various incubation temperatures for MIRA were tested, including 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, and 50 °C, with an incubation duration of 15 min. The optimal incubation durations for both MIRA and LFD were determined at a constant temperature of 40 °C. The MIRA step durations tested were 2.5, 5, 10, 15, and 20 min, while the LFD step durations tested were 1.5, 3, 5, and 10 min.

2.6. Specificity and Sensitivity of MIRA-LFD

The specificity of MIRA-LFD was validated by applying genomic DNA extracted from various Vibrio and foodborne bacterial species listed in Table 1. To determine the sensitivity of MIRA-LFD, both 10-fold serially diluted genomic DNA (ranging from 1 ng to 1 fg per reaction) and direct cultures of V. parahaemolyticus F11-3A (ranging from 2 × 104 to 2 CFU per reaction) were employed. Additionally, fresh oysters were seeded with various concentrations of V. parahaemolyticus to assess the sensitivity of MIRA-LFD. In brief, fresh oysters were shucked, pooled, blended, and then diluted with phosphate-buffered saline (PBS, pH 7.4) at a ratio of 1:4 (W/V). After confirming the absence of V. parahaemolyticus contamination using a conventional PCR assay (described below), the oyster samples were mixed with various concentrations of F11-3A (ranging from 1.8 × 104 to 1.8 CFU per reaction) for the MIRA-LFD assay.

2.7. Comparison of Vibrio Parahaemolyticus Detection in Fresh Oysters by RPA-LFD, PCR, and qPCR

Fresh oysters were procured from local markets in the Northern Gulf States, including Alabama, Florida, Louisiana, and Mississippi, between July and October. Ten oysters were aseptically shucked and blended, and 10 mL of the oyster blend was inoculated in 90 mL of alkaline peptone water (APW) and incubated overnight for enrichment. A total of 36 enrichment samples were employed for the comparative analysis of the detection capabilities of MIRA-LFD, PCR, and qPCR. Two microliters of each sample were directly utilized in the PCR, qPCR, and MIRA-LFD assays.

2.8. Polymerase Chain Reaction (PCR) and Quantitative Polymerase Chain Reaction (qPCR)

PCR was conducted to determine assay sensitivity using various genomic DNA concentrations and CFU per reaction, following the BAM guidelines of the U.S. FDA with minor modifications [14,19]. In brief, the PCR mixture included 2.5 U of DreamTaq Green DNA polymerase (Thermo Scientific, Vilnius, Lithuania), 10 mM dNTP (2.5 mM each), 1 × PCR buffer, 2 µL of the primer set (10 µM), and 2 µL of the template. The final volume of the mixture was adjusted to 25 µL with water. The amplification conditions for the tlh and tdh genes were 1 cycle at 94 °C for 10 min, followed by 30 cycles of 94 °C for 1 min, 58 °C for 1 min, and 72 °C for 2 min, with a final extension at 72 °C for 10 min. For the trh gene, the PCR conditions were 1 cycle at 94 °C for 3 min, followed by 30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 2 min, with a final extension at 72 °C for 3 min. The amplified PCR product was visualized on 1% tris-borate–EDTA agarose gel containing SYBR Safe DNA gel stain.
The qPCR assay was carried out based on a previous study with minor modifications to validate the detection limits of both bacterial DNA and CFU [21]. For tlh amplification, each 25 µL reaction mixture contained 1 × PrimeTime Gene Expression Master Mix (Integrated DNA Technologies, Coralville, IA, USA), 75 nM of each primer (tlh 884F, tlh 1091R, IAC 46F, and IAC 186R), and 150 nM of tlh and IAC probes. For tdh and trh amplification, each 25 µL reaction mixture contained the 1 × PrimeTime Gene Expression Master Mix, 200 nM of each primer (tdh 89F, tdh 321R, trh 20F, trh 292R, IAC 46F, and IAC 186R), 150 nM of IAC probes, and 75 nM of tdh and trh probes. The reactions contained various concentrations of templates and IAC DNA. The cycling consisted of an initial denaturation at 95 °C for 60 s, followed by 45 cycles of denaturation at 95 °C for 5 s and annealing at 59 °C for 45 s. The signal amplification (ΔRn) was plotted against qPCR cycles, where amplification is detected as exceeding an arbitrary threshold. The primers and probes used for PCR or qPCR are listed in Table 3.

2.9. Statistical Analysis

The intensity of the test band was quantified using Image Lab Software Version 6.0.1 (Bio-Rad, Hercules, CA, USA) and was displayed as the relative band intensity in comparison with the value of the negative control. Statistical analyses were carried out using Prism Version 9 (GraphPad, Boston, MA, USA). Significant differences were determined using an ordinary one-way ANOVA analysis (Dunnett’s multiple-comparisons test, p < 0.05), and data are presented as mean ± standard deviation (SD, n = 3).

3. Results and Discussion

3.1. Primer Selection for tlh, trh, and tdh Genes for the Application of MIRA-LFD

To identify the optimal primer set for the tlh, trh, and tdh genes, we evaluated four combinations (two forward and two reverse), one combination (one forward and one reverse), and four combinations (two forward and two reverse) of primer candidates using basic RPA (Table 1). The basic RPA procedure was conducted in a 40 °C water bath for 20 min, followed by electrophoresis of the RPA products through a 1% TBE agarose gel. Figure 2 illustrates the successful amplification of target amplicons for all primers designed for the tlh (A to D), tdh (E), and trh (F to I) genes. Despite prior research reporting the failure of eight primer pairs targeting the tdh and trh genes to produce specific amplicons [30], our designed primers demonstrated robust amplification. Our primer design adhered to specific criteria: (1) a primer size ranging from 30 to 36 bp, (2) primer GC% ranging from 20 to 70%, (3) a primer temperature ranging from 50 to 100 °C, and (4) a maximum allowable length of a nucleotide repeat set to 5, following the manufacturer’s recommendations (https://www.twistdx.co.uk/docs/default-source/RPA-assay-design/twistamp-assay-design-manual-v2-5.pdf, accessed on 17 March 2023). This approach is intended to yield clear, specific amplification bands without obvious primer dimers. The primer pair VP_TLH_F1 and VP_TLH_R1 (Figure 2A) was chosen for the tlh gene, as it amplified the shortest amplicon size, reducing the risk of primer noise occurrence, as recommended by the manufacturer. For tdh gene amplification, the pair VP_TDH_F1 and VP_TDH_R1 (Figure 2E) was employed, and VP_TRH_F1 and VP_TRH_R1 (Figure 2F) were selected for detecting the trh gene, as the resulting amplicon exhibited a GC content between 40% and 60%. Importantly, all primer pairs showed no cross-amplification when tested with the bacterial gDNA listed in Table 2.

3.2. Optimization of MIRA-LFD to Amplify tlh, trh, and tdh Genes

MIRA-LFD consists of two procedures: gene amplification using MIRA and the visualization of the test result with an LFD. The incubation temperature and time for MIRA, as well as the incubation time for the LFD, were examined to determine the optimal conditions for detecting the tlh, tdh, and trh genes of V. parahaemolyticus. As shown in Figure 3, the MIRA steps for all tlh, tdh, and trh genes could be accomplished in the temperature range of 30–45 °C. No test lines were observed for any of the genes at 25 and 50 °C. MIRA performed at 40 °C exhibited the highest band intensity among the temperatures examined for all three genes (p < 0.05). Similarly, RPA for Salmonella spp. showed a positive test line in the temperature range of 30–45 °C and displayed the highest test band intensity at 40 °C [32]. However, MIRA for Acinetobacter baumannii could amplify at 25 °C and 50 °C [33], and MIRA for Spiroplasma eriocheiris did not show amplification even at 30 °C and 40 °C [34]. Taken together, these studies indicate that the optimal temperature range of the MIRA assay is different depending on the templates, primers, and probes; therefore, the optimization of the temperature is a crucial step for the successful detection of target genes through the MIRA assay.
The incubation time of MIRA, ranging from 2.5 to 20 min, was examined for detecting the tlh, tdh, and trh genes of V. parahaemolyticus (Figure 4A). MIRA for the tlh and trh genes began to show a positive band on the strip after an incubation time of 5 min, whereas MIRA for the tdh gene exhibited a positive band after 2.5 min. The band intensities of all genes increased in a time-dependent manner up to 20 min, with no significant differences observed between 15 and 20 min. Therefore, an incubation time of 15 min was selected for the MIRA step for all three genes. Previous studies using the RPA assay demonstrated that positive bands appeared at 8 min for Salmonella spp. and 20 min for V. vulnificus [32,35]. However, recent studies using the MIRA assay have reported that the positive test line could be observed after 5 min for S. eriocheiris, A. baumannii, and Streptococcus agalactiae [33,34,36]. Since the MIRA assay applies a different source of recombinase (Streptomyces azure recA, SC-recA) compared to the RPA assay that uses the RecA/Rad 51 ortholog of bacteriophage T4, T4 UvsX, this may result in different incubation times for amplification [31].
To determine the incubation time of the lateral-flow dipstick (LFD, Milenia Genline HybriDetect), the MIRA products of the tlh, tdh, and trh genes were inoculated onto the LFD with a time range from 1.5 to 10 min. As shown in Figure 4B, there were no significant differences in band intensities among the incubation times for all genes. Therefore, an incubation time of 1.5 min was selected to visualize the tlh, tdh, and trh genes with LFD strips. Based on the result of the incubation time for both the MIRA and LFD steps, the entire identification procedure to detect the tlh, tdh, and trh genes of V. parahaemolyticus could be accomplished within 20 min, including 3 min for the sample mixture procedure.

3.3. Evaluation of the Sensitivity and Specificity of the tlh, trh, and tdh Genes

The detection limits of the MIRA-LFD assay for the tlh, tdh, and trh genes were compared to those of PCR and qPCR assays. Figure 5 depicts four ten-fold serially diluted gDNA samples (ranging from 1 pg to 1 fg), bacterial cultures (ranging from 2 × 103 CFU to 2 CFU), and seeded oysters (ranging from 1.8 × 103 CFU to 1.8 CFU) using the three genes of V. parahaemolyticus. Positive test lines were observed with as little as 10 fg of gDNA, 2 CFU of bacterial culture, and 1.8 CFU of seeded oysters for the tlh, tdh, and trh genes. Previous studies on the detection of V. parahaemolyticus using RPA assays have reported detection limits ranging from 76 to 2 CFU of bacterial culture and 10 pg of genomic DNA [27,28,29,30]. More recently, MIRA assays for various pathogens have shown detection limits ranging from 760 to 6 CFU of bacterial culture and ranging from 97 pg to 64 fg of genomic DNA [31,33,34,36,37,38].
Similar detection limit results were obtained with the qPCR assay, which could detect as little as 10 fg of gDNA for the tdh and trh genes and 1 fg of the tlh gene (Figure 6A). The qPCR assay exhibited a detection limit of 2 CFU for all genes, which is consistent with a previous study that demonstrated that the qPCR assay could detect under 10 CFU [21]. However, the PCR assay was able to detect down to 1 pg of gDNA and 200 CFU of bacterial culture (Figure 6B). This result is in line with a previous study that reported a detection limit as low as 100 CFU [14]. The current MIRA-LFD assay for the tlh, tdh, and trh genes was as sensitive as qPCR and 100 and 200 times more sensitive than PCR in terms of gDNA and CFU, respectively.
The specificity of MIRA-LFD for the tlh, tdh, and trh genes was determined using various bacteria listed in Table 1. As illustrated in Figure 7, the F11-3A strain exhibited positivity for all three genes. The 35118 strain showed positivity for the tlh and trh genes but tested negative for the tdh gene. In contrast, the 17802 strain exhibited positivity for the tlh gene but tested negative for the tdh and trh genes. All other Vibrio and foodborne pathogenic bacteria tested negative for all three genes. The results of the F11-3A, 35118, and 17802 strains regarding the tlh, tdh, and trh genes are consistent with previous studies [39,40]. Additionally, the PCR and qPCR assays exhibited concordant results for the three genes when compared with MIRA-LFD. Taken together with previous studies on MIRA-LFD, the current study indicates that MIRA-LFD is highly specific for target genes without cross-reactivity with other closely related bacteria [31,33,34].

3.4. Detection of tlh, trh, and tdh Genes from Oyster Samples

Fresh oysters were purchased from the local markets of four Northern Gulf coastal States in the U.S., and the oysters were enumerated to detect the tlh, tdh, and trh genes of V. parahaemolyticus. Each sample was prepared from ten blended oysters, and a total of 36 samples were analyzed to detect the three genes using the MIRA-LFD, PCR, and qPCR assays. As shown in Table 4, the species-specific tlh gene was detected using MIRA-LFD in 33.3%, 0%, 33.3%, and 16.6% of the oysters purchased in A, B, C, and D States, respectively. The same results were obtained using the qPCR assay. However, only 16.6% of samples from A State tested positive for the tlh gene using the PCR assay, and all samples from the other three States tested negative. Our results suggest that the MIRA-LFD assay is as sensitive as the qPCR assay, taken together with previous studies [31,38,41]. Interestingly, all oyster samples from all four States tested negative for the tdh and trh genes using the MIRA-LFD, PCR, and qPCR assays. This suggests that V. parahaemolyticus isolated from the environments may be less pathogenic compared to clinically isolated bacteria [10,11,12,13].

4. Conclusions

A rapid and simple MIRA-LFD assay has been developed to detect the species-specific tlh gene and the pathogenic-specific tdh and trh genes of V. parahaemolyticus. The careful selection of primers and probes enables the accurate amplification of the target regions of the genes by the MIRA-LFD assay, providing test results within 20 min. The assay for the three genes can detect as low as 10 pg of gDNA and 2 CFU of V. parahaemolyticus, demonstrating high specificity without the cross-detection of closely related bacteria. Further field tests indicated that MIRA-LFD has great potential for use in field conditions to detect the tlh, tdh, and trh genes of V. parahaemolyticus from oysters.

Author Contributions

Conceptualization, S.B.P. and Y.Z.; methodology, S.B.P.; software, S.B.P.; formal analysis, S.B.P.; investigation, S.B.P.; resources, Y.Z.; data curation, S.B.P.; writing—original draft preparation, S.B.P.; writing—review and editing, Y.Z.; visualization, S.B.P.; supervision, Y.Z.; project administration, Y.Z.; funding acquisition, Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by USDA-ARS-SCA agreement number 58-6066-7081 and state CRIS project number MIS 081710 for MS Center for Food Safety and Postharvest Technology.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Letchumanan, V.; Chan, K.-G.; Lee, L.-H. Vibrio parahaemolyticus: A review on the pathogenesis, prevalence, and advance molecular identification techniques. Front. Microbiol. 2014, 5, 705. [Google Scholar] [CrossRef] [PubMed]
  2. Su, Y.-C.; Liu, C. Vibrio parahaemolyticus: A concern of seafood safety. Food Microbiol. 2007, 24, 549–558. [Google Scholar] [CrossRef] [PubMed]
  3. DePaola, A.; Nordstrom, J.L.; Bowers, J.C.; Wells, J.G.; Cook, D.W. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Appl. Environ. Microbiol. 2003, 69, 1521–1526. [Google Scholar] [CrossRef] [PubMed]
  4. Froelich, B.A.; Noble, R.T. Vibrio bacteria in raw oysters: Managing risks to human health. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150209. [Google Scholar] [CrossRef] [PubMed]
  5. Broberg, C.A.; Calder, T.J.; Orth, K. Vibrio parahaemolyticus cell biology and pathogenicity determinants. Microbes Infect. 2011, 13, 992–1001. [Google Scholar] [CrossRef] [PubMed]
  6. Gutierrez West, C.K.; Klein, S.L.; Lovell, C.R. High frequency of virulence factor genes tdh, trh, and tlh in Vibrio parahaemolyticus strains isolated from a pristine estuary. Appl. Environ. Microbiol. 2013, 79, 2247–2252. [Google Scholar] [CrossRef] [PubMed]
  7. Honda, T.; Iida, T. The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct haemolysin and related haemolysins. Rev. Res. Med. Microbiol. 1993, 4, 106–113. [Google Scholar] [CrossRef]
  8. Shirai, H.; Ito, H.; Hirayama, T.; Nakamoto, Y.; Nakabayashi, N.; Kumagai, K.; Takeda, Y.; Nishibuchi, M. Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis. Infect. Immun. 1990, 58, 3568–3573. [Google Scholar] [CrossRef]
  9. Ohnishi, K.; Nakahira, K.; Unzai, S.; Mayanagi, K.; Hashimoto, H.; Shiraki, K.; Honda, T.; Yanagihara, I. Relationship between heat-induced fibrillogenicity and hemolytic activity of thermostable direct hemolysin and a related hemolysin of Vibrio parahaemolyticus. FEMS Microbiol. Lett. 2011, 318, 10–17. [Google Scholar] [CrossRef]
  10. Hongping, W.; Jilun, Z.; Ting, J.; Yixi, B.; Xiaoming, Z. Insufficiency of the Kanagawa hemolytic test for detecting pathogenic Vibrio parahaemolyticus in Shanghai, China. Diagn. Microbiol. Infect. Dis. 2011, 69, 7–11. [Google Scholar] [CrossRef]
  11. Sun, J.; Li, X.; Hu, Z.; Xue, X.; Zhang, M.; Wu, Q.; Zhang, W.; Zhang, Y.; Lu, R. Characterization of Vibrio parahaemolyticus isolated from stool specimens of diarrhea patients in Nantong, Jiangsu, China during 2018–2020. PLoS ONE 2022, 17, e0273700. [Google Scholar] [CrossRef] [PubMed]
  12. Vieira, R.H.; Costa, R.A.; Menezes, F.G.; Silva, G.C.; Theophilo, G.N.; Rodrigues, D.P.; Maggioni, R. Kanagawa-negative, tdh-and trh-positive Vibrio parahaemolyticus isolated from fresh oysters marketed in Fortaleza, Brazil. Curr. Microbiol. 2011, 63, 126–130. [Google Scholar] [CrossRef] [PubMed]
  13. Baker-Austin, C.; McArthur, J.; Tuckfield, R.C.; Najarro, M.; Lindell, A.H.; Gooch, J.; Stepanauskas, R. Antibiotic resistance in the shellfish pathogen Vibrio parahaemolyticus isolated from the coastal water and sediment of Georgia and South Carolina, USA. J. Food Prot. 2008, 71, 2552–2558. [Google Scholar] [CrossRef] [PubMed]
  14. Bej, A.K.; Patterson, D.P.; Brasher, C.W.; Vickery, M.C.; Jones, D.D.; Kaysner, C.A. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. J. Microbiol. Methods 1999, 36, 215–225. [Google Scholar] [CrossRef] [PubMed]
  15. Dileep, V.; Kumar, H.; Kumar, Y.; Nishibuchi, M.; Karunasagar, I.; Karunasagar, I. Application of polymerase chain reaction for detection of Vibrio parahaemolyticus associated with tropical seafoods and coastal environment. Lett. Appl. Microbiol. 2003, 36, 423–427. [Google Scholar] [CrossRef] [PubMed]
  16. Lee, C.-Y.; Pan, S.-F.; Chen, C.-H. Sequence of a cloned pR72H fragment and its use for detection of Vibrio parahaemolyticus in shellfish with the PCR. Appl. Environ. Microbiol. 1995, 61, 1311–1317. [Google Scholar] [CrossRef]
  17. Myers, M.L.; Panicker, G.; Bej, A.K. PCR detection of a newly emerged pandemic Vibrio parahaemolyticus O3: K6 pathogen in pure cultures and seeded waters from the Gulf of Mexico. Appl. Environ. Microbiol. 2003, 69, 2194–2200. [Google Scholar] [CrossRef]
  18. Okura, M.; Osawa, R.; Iguchi, A.; Arakawa, E.; Terajima, J.; Watanabe, H. Genotypic analyses of Vibrio parahaemolyticus and development of a pandemic group-specific multiplex PCR assay. J. Clin. Microbiol. 2003, 41, 4676–4682. [Google Scholar] [CrossRef]
  19. Kaysner, C.A.; DePaola, A.; Jones, J. Bacteriological Analytical Manual Chapter 9: Vibrio; Food and Drug Administration: Silver Spring, MD, USA, 2004. Available online: https://www.fda.gov/food/laboratory-methods-food/bam-chapter-9-vibrio (accessed on 11 August 2023).
  20. Drake, S.L.; DePaola, A.; Jaykus, L.A. An overview of Vibrio vulnificus and Vibrio parahaemolyticus. Compr. Rev. Food Sci. Food Saf. 2007, 6, 120–144. [Google Scholar] [CrossRef]
  21. Nordstrom, J.L.; Vickery, M.C.; Blackstone, G.M.; Murray, S.L.; DePaola, A. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 2007, 73, 5840–5847. [Google Scholar] [CrossRef]
  22. Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [PubMed]
  23. Li, J.; Macdonald, J.; Von Stetten, F. A comprehensive summary of a decade development of the recombinase polymerase amplification. Analyst 2019, 144, 31–67. [Google Scholar] [CrossRef] [PubMed]
  24. Tan, M.; Liao, C.; Liang, L.; Yi, X.; Zhou, Z.; Wei, G. Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Front. Cell. Infect. Microbiol. 2022, 12, 1744. [Google Scholar] [CrossRef] [PubMed]
  25. Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [PubMed]
  26. Park, S.B.; Chang, S.K. Development of Recombinase Polymerase Amplification Combined with Lateral Flow Dipstick Assay To Detect Hemolysin Gene of Vibrio vulnificus in Oysters. J. Food Prot. 2022, 85, 1716–1725. [Google Scholar] [CrossRef] [PubMed]
  27. Geng, Y.; Tan, K.; Liu, L.; Sun, X.X.; Zhao, B.; Wang, J. Development and evaluation of a rapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood. BMC Microbiol. 2019, 19, 186. [Google Scholar] [CrossRef] [PubMed]
  28. Jiang, W.; Ren, Y.; Han, X.; Xue, J.; Shan, T.; Chen, Z.; Liu, Y.; Wang, Q. Recombinase polymerase amplification-lateral flow (RPA-LF) assay combined with immunomagnetic separation for rapid visual detection of Vibrio parahaemolyticus in raw oysters. Anal. Bioanal. Chem. 2020, 412, 2903–2914. [Google Scholar] [CrossRef] [PubMed]
  29. Ma, B.; Li, J.; Chen, K.; Yu, X.; Sun, C.; Zhang, M. Multiplex recombinase polymerase amplification assay for the simultaneous detection of three foodborne pathogens in seafood. Foods 2020, 9, 278. [Google Scholar] [CrossRef] [PubMed]
  30. Yang, X.; Zhao, P.; Dong, Y.; Shen, X.; Shen, H.; Li, J.; Jiang, G.; Wang, W.; Dai, H.; Dong, J. An improved recombinase polymerase amplification assay for visual detection of Vibrio parahaemolyticus with lateral flow strips. J. Food Sci. 2020, 85, 1834–1844. [Google Scholar] [CrossRef]
  31. Heng, P.; Liu, J.; Song, Z.; Wu, C.; Yu, X.; He, Y. Rapid detection of Staphylococcus aureus using a novel multienzyme isothermal rapid amplification technique. Front. Microbiol. 2022, 13, 1027785. [Google Scholar] [CrossRef]
  32. Gao, W.; Huang, H.; Zhu, P.; Yan, X.; Fan, J.; Jiang, J.; Xu, J. Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish. Bioprocess Biosyst. Eng. 2018, 41, 603–611. [Google Scholar] [CrossRef] [PubMed]
  33. Hu, W.-W.; He, J.-W.; Guo, S.-L.; Li, J. Development and evaluation of a rapid and sensitive multienzyme isothermal rapid amplification with a lateral flow dipstick assay for detection of Acinetobacter baumannii in spiked blood specimens. Front. Cell. Infect. Microbiol. 2022, 12, 1010201. [Google Scholar] [CrossRef] [PubMed]
  34. Guo, Y.; Zhang, L.; Yang, Y.; Li, J.; Luan, X.; Gong, S.; Ma, Y.; Gu, W.; Du, J.; Meng, Q. Development and application of the MIRA and MIRA-LFD detection methods of Spiroplasma eriocheiris. J. Invertebr. Pathol. 2023, 201, 108017. [Google Scholar] [CrossRef] [PubMed]
  35. Yang, X.; Zhao, P.; Dong, Y.; Chen, S.; Shen, H.; Jiang, G.; Zhu, H.; Dong, J.; Gao, S. An isothermal recombinase polymerase amplification and lateral flow strip combined method for rapid on-site detection of Vibrio vulnificus in raw seafood. Food Microbiol. 2021, 98, 103664. [Google Scholar] [CrossRef] [PubMed]
  36. Zhu, L.; Gong, F.; Liu, X.; Sun, X.; Yu, Y.; Shu, J.; Pan, Z. Integrating filter paper extraction, isothermal amplification, and lateral flow dipstick methods to detect Streptococcus agalactiae in milk within 15 min. Front. Vet. Sci. 2023, 10, 1100246. [Google Scholar] [CrossRef] [PubMed]
  37. Ma, Q.; Yao, J.; Yuan, S.; Liu, H.; Wei, N.; Zhang, J.; Shan, W. Development of a lateral flow recombinase polymerase amplification assay for rapid and visual detection of Cryptococcus Neoformans/C. gattii in cerebral spinal fluid. BMC Infect. Dis. 2019, 19, 108. [Google Scholar]
  38. Wang, Y.; Niu, J.; Sun, M.; Li, Z.; Wang, X.; He, Y.; Qi, J. Rapid and Sensitive Detection of Streptococcus iniae in Trachinotus ovatus Based on Multienzyme Isothermal Rapid Amplification. Int. J. Mol. Sci. 2023, 24, 7733. [Google Scholar] [CrossRef]
  39. Glover, W.A. Laboratory Method for Vibrio parahaemolyticus (V.p.) Enumeration and Detection through MPN and Real-Time PCR. In Proceedings of the Interstate Shellfish Sanitation Conference (ISSC), Columbia, SC, USA, 13 March 2015. [Google Scholar]
  40. Rizvi, A.V.; Bej, A.K. Multiplexed real-time PCR amplification of tlh, tdh and trh genes in Vibrio parahaemolyticus and its rapid detection in shellfish and Gulf of Mexico water. Antonie Van Leeuwenhoek 2010, 98, 279–290. [Google Scholar] [CrossRef]
  41. Ji, C.; Feng, Y.; Sun, R.; Gu, Q.; Zhang, Y.; Ma, J.; Pan, Z.; Yao, H. Development of a multienzyme isothermal rapid amplification and lateral flow dipstick combination assay for bovine coronavirus detection. Front. Vet. Sci. 2022, 9, 1059934. [Google Scholar] [CrossRef]
Figure 1. The schematic and workflow of MIRA-LFD for detecting tlh, tdh, and trh genes of Vibrio parahaemolyticus. This assay consists of three steps—mixing, amplification, and development—all completed within 20 min. During the MIRA procedure, the amplicon is labeled with FAM and biotin through the reaction of primers, probe, accessory protein, recombinase, single-chain binding protein, helicase, and recombinase. The LFD has both a test line that reacts with the biotin of the amplicon and a control line containing an anti-rabbit antibody that reacts with an antibody conjugated with a gold nanoparticle.
Figure 1. The schematic and workflow of MIRA-LFD for detecting tlh, tdh, and trh genes of Vibrio parahaemolyticus. This assay consists of three steps—mixing, amplification, and development—all completed within 20 min. During the MIRA procedure, the amplicon is labeled with FAM and biotin through the reaction of primers, probe, accessory protein, recombinase, single-chain binding protein, helicase, and recombinase. The LFD has both a test line that reacts with the biotin of the amplicon and a control line containing an anti-rabbit antibody that reacts with an antibody conjugated with a gold nanoparticle.
Pathogens 13 00057 g001
Figure 2. Validation of primers for the amplification of tlh (A–D), tdh (E), and trh (F–I) genes using basic RPA. (A) VP_TLH_F1 and R1 (226 bp), (B) VP_TLH_F1 and R1-2 (256 bp), (C) VP_TLH_F2 and R2 (369 bp), (D) VP_TLH_F2 and R2-2 (312 bp), (E) VP_TDH_F1 and R1 (238 bp), (F) VP_TRH-F1 and R1 (243 bp), (G) VP_TRH-F1 and R1-2 (266 bp), (H) VP_TRH-F2 and R2 (243 bp), and (I) VP_TRH-F2 and R2-2 (208 bp). “M” is an abbreviation for the molecular-weight size marker.
Figure 2. Validation of primers for the amplification of tlh (A–D), tdh (E), and trh (F–I) genes using basic RPA. (A) VP_TLH_F1 and R1 (226 bp), (B) VP_TLH_F1 and R1-2 (256 bp), (C) VP_TLH_F2 and R2 (369 bp), (D) VP_TLH_F2 and R2-2 (312 bp), (E) VP_TDH_F1 and R1 (238 bp), (F) VP_TRH-F1 and R1 (243 bp), (G) VP_TRH-F1 and R1-2 (266 bp), (H) VP_TRH-F2 and R2 (243 bp), and (I) VP_TRH-F2 and R2-2 (208 bp). “M” is an abbreviation for the molecular-weight size marker.
Pathogens 13 00057 g002
Figure 3. Optimization of temperature (from 25 °C to 50 °C) for tlh, trh, and tdh genes using MIRA. MIRA reactions were conducted for 15 min, and LFD assays were performed for 1.5 min. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished. Data represent the means of three independent replicates (one-way ANOVA, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 3. Optimization of temperature (from 25 °C to 50 °C) for tlh, trh, and tdh genes using MIRA. MIRA reactions were conducted for 15 min, and LFD assays were performed for 1.5 min. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished. Data represent the means of three independent replicates (one-way ANOVA, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Pathogens 13 00057 g003
Figure 4. Optimization of MIRA and LFD incubation time for tlh, trh, and tdh genes. MIRA reactions (A) were conducted at 40 °C, and LFD assays (B) were performed at room temperature. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished. Data represent the means of three independent replicates (one-way ANOVA, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 4. Optimization of MIRA and LFD incubation time for tlh, trh, and tdh genes. MIRA reactions (A) were conducted at 40 °C, and LFD assays (B) were performed at room temperature. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished. Data represent the means of three independent replicates (one-way ANOVA, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Pathogens 13 00057 g004
Figure 5. Evaluation of sensitivity of MIRA-LFD for the detection of tlh, trh, and tdh genes. The genomic DNA ((A) gDNA ranging from 1 pg to 1 fg), direct bacterial culture ((B) ranging from 2 × 103 to 2 CFU), and seeded oyster ((C) gDNA ranging from 1 pg to 1 fg) were subjected to the MIRA-LFD assay. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished.
Figure 5. Evaluation of sensitivity of MIRA-LFD for the detection of tlh, trh, and tdh genes. The genomic DNA ((A) gDNA ranging from 1 pg to 1 fg), direct bacterial culture ((B) ranging from 2 × 103 to 2 CFU), and seeded oyster ((C) gDNA ranging from 1 pg to 1 fg) were subjected to the MIRA-LFD assay. LFD strips exhibited an upper control line and a lower test line when the MIRA reaction was successfully accomplished.
Pathogens 13 00057 g005
Figure 6. Evaluation of sensitivity of qPCR (A) and PCR (B) for the detection of tlh, trh, and tdh genes. Various concentrations of genomic DNA (gDNA) and direct bacterial culture (CFU) were subject to the detection of each gene using qPCR and PCR methods.
Figure 6. Evaluation of sensitivity of qPCR (A) and PCR (B) for the detection of tlh, trh, and tdh genes. Various concentrations of genomic DNA (gDNA) and direct bacterial culture (CFU) were subject to the detection of each gene using qPCR and PCR methods.
Pathogens 13 00057 g006
Figure 7. Evaluation of specificity of MIRA-LFD using genomic DNA from Vibrio and other foodborne pathogenic bacteria. The MIRA-LFD assay exhibited a positive test line for the positive control V. parahaemolyticus F11-3A for the tlh, trh, and tdh genes.
Figure 7. Evaluation of specificity of MIRA-LFD using genomic DNA from Vibrio and other foodborne pathogenic bacteria. The MIRA-LFD assay exhibited a positive test line for the positive control V. parahaemolyticus F11-3A for the tlh, trh, and tdh genes.
Pathogens 13 00057 g007
Table 1. Bacteria used in this study and their amplification results for tlh, trh, and tdh genes using MIRA-LFD, PCR, and qPCR.
Table 1. Bacteria used in this study and their amplification results for tlh, trh, and tdh genes using MIRA-LFD, PCR, and qPCR.
BacteriaMIRA-LFDPCRqPCR
tlhtrhtdhtlhtrhtdhtlhtrhtdh
Vibrio parahaemolyticus F11-3A+++++++++
Vibrio parahaemolyticus ATCC 17802+++
Vibrio parahaemolyticus ATCC 35118++++++
Vibrio vulnificus ATCC 33147
Vibrio vulnificus ATCC 27562
Vibrio vulnificus ATCC 33815
Vibrio metschnikovii ATCC 7708
Vibrio fluvialis ATCC 33809
Vibrio mimicus ATCC 33655
Vibrio furnissii ATCC 35627
Vibrio cholerae ATCC 39315
Vibrio alginolyticus ATCC 33840
Escherichia coli ATCC 51739
Escherichia coli K-12
Escherichia coli O157:H7 ATCC 43895
Listeria monocytogenes F5069
Lactobacillus buchneri ATCC 12936
Listeria innocua ATCC 33090
Salmonella enterica Serovar Typhimurium 14028
Salmonella enterica Serovar Gaminara F2712
Salmonella enterica Serovar Montevideo ATCC BAA-1735
Salmonella enterica Serovar Senftenburg ATCC 43845
Salmonella enterica Serovar Enteritidis E190-88
Salmonella enterica Serovar Choleraesuis ATCC 10708
Bacillus subtilis ATCC 9372
Clostridium perfringens ATCC 13124
Enterococcus faecalis ATCC 344
Lactobacillus acidophilus NRRL B1910
Staphylococcus aureus ATCC 25923
Shigella flexineri ATCC 12022
+: presence, −: absence.
Table 2. Primers and probes for the amplification of tlh, trh, and tdh genes using basic RPA and MIRA-LFD.
Table 2. Primers and probes for the amplification of tlh, trh, and tdh genes using basic RPA and MIRA-LFD.
AssayNamesSequences (5′-3′)LocationAmplicon Size (bp)
Basic RPAVP_TLH_F1AAAAACAATCACACTATTAACTGCATTACTCC
VP_TLH_R1GTCAATGGTGAAGTAGCTACCATCTTCGTTTTT6–231226
VP_TLH_R1-2TTTAAATGAAACGGAGCTCCACCAGTAGCC6–261256
VP_TLH_F2CTCAGTTTAAGTACTCAACACAAGAAGAGAT
VP_TLH_R2CTAAGTTGTTGCTACTTTCTAGCATTTTCT869–1237369
VP_TLH_R2-2TTGGATGCGTGACATCCCAGAACACAAACT869–1180312
VP_TDH_F1CTGTGAACATTAATGATAAAGACTATACAA
VP_TDH_R1ATTACCAATATATTACCACTACCACTCTCATA284–521238
VP_TRH_F1ACTCTACTTTGCCTTCAGTTTGCTATTGGCTTC
VP_TRH-R1GAAGTCGTGAAAATAGATTGACCGTGAACGCT12–254243
VP_TRH-R1-2AGGCGCTTAACCATTTTGAGCCTGAAGTCGTGA12–277266
VP_TRH-F2AGCGCCTATATGACGGTAAATATTAATGGAAAT
VP_TRH_R2CATATGCCCATTTCCGCTCTCATATGCTTCGA271–513243
VP_TRH-R2-2TGACGAAATATTCTGGCGTTTCATCCAAATA271–478208
MIRA-LFDVP_TLH_F1AAAAACAATCACACTATTAACTGCATTACTCC
VP_PROBE/56-FAM/TTCAGCGTCTGAAGTGATCAGCACGCAAGA/idSp/AACCAAACCTATACC/3SpC3/
VP_TLH_R1 _BiotinBiotin-GTCAATGGTGAAGTAGCTACCATCTTCGTTTTT6–231
VP_TDH_F1CTGTGAACATTAATGATAAAGACTATACAA
VP_TDH_Probe/56-FAM/AGCTTCAACATTCCTATGATTCTGTAGCTA/idSp/CTTTGTTGGTGAAGA/3SpC3/
VP_TDH_R1_BiotinBiotin-ATTACCAATATATTACCACTACCACTCTCATA284–521
VP_TRH_F1ACTCTACTTTGCCTTCAGTTTGCTATTGGCTTC
VP_TRH_Probe/56-FAM/TGAGCTACTATTTGTCGTTAGAAATACAAC/idSp/ATAAAAACTGAATCA/3SpC3/
VP_TRH_R1_BiotinBiotin-GAAGTCGTGAAAATAGATTGACCGTGAACGCT12–254
Table 3. Primers and probes for the amplification of tlh, trh, and tdh genes using PCR and qPCR.
Table 3. Primers and probes for the amplification of tlh, trh, and tdh genes using PCR and qPCR.
AssayNamesSequences (5′-3′)Amplicon Size (bp)Ref.
PCRVPTLH_LAAAGCGGATTATGCAGAAGCACTG [14]
VPTRH_RGCTACTTTCTAGCATTTTCTCTGC450
VPTRH-LTTGGCTTCGATATTTTCAGTATCT
VPTRH-RCATAACAAACATATGCCCATTTCCG486
VPTDH-LGTAAAGGTCTCTGACTTTTGGAC
VPTDH-RTGGAATAGAACCTTCATCTTCACC270
qPCRtlh 884 FACTCAACACAAGAAGAGATCGACCA [21]
tlh probe/JOE/CGCTCGCGTTCACGAAACCGT/BHQ2
tlh 1091RGATGAGCGGTTGATGTCCAA
trh 20FTTGCTTTCAGTTTGCTATTGGCT
trh probe/FAM/AGAAATACAACAATCAAAACTGA/MGBNFQ
trh 292RTGTTTACCGTCATATAGGCGCTT
tdh 89FTCCCTTTTCCTGCCCCC
tdh probe/FAM/TGACATCCTACATGACTGTG/MGBNFQ
tdh 321RCGCTGCCATTGTATAGTCTTTATC
IAC 46FGACATCGATATGGGTGCCG
IAC Probe/Cy5/TCTCATGCGTCTCCCTGGTGAATGTG/BHQ2
IAC 186RCGAGACGATGCAGCCATTC
Table 4. Comparison of amplification results for tlh, trh, and tdh genes among MIRA-LFD, PCR, and qPCR using oyster samples from four U.S. States.
Table 4. Comparison of amplification results for tlh, trh, and tdh genes among MIRA-LFD, PCR, and qPCR using oyster samples from four U.S. States.
Statestlhtdhtrh
MIRA-LFDPCRqPCRMIRA-LFDPCRqPCRMIRA-LFDPCRqPCR
A2/6 (33.3% *)1/6 (16.6%)2/6 (33.3%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)
B0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)
C2/6 (33.3%)0/6 (0%)2/6 (33.3%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)0/6 (0%)
D3/18 (16.6%)0/18 (0%)3/18 (16.6%)0/18 (0%)0/18 (0%)0/18 (0%)0/18 (0%)0/18 (0%)0/18 (0%)
* The percentage indicates positive results from the oyster samples examined.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Park, S.B.; Zhang, Y. Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus. Pathogens 2024, 13, 57. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens13010057

AMA Style

Park SB, Zhang Y. Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus. Pathogens. 2024; 13(1):57. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens13010057

Chicago/Turabian Style

Park, Seong Bin, and Yan Zhang. 2024. "Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus" Pathogens 13, no. 1: 57. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens13010057

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop