High-Resolution Melting PCR as Rapid Genotyping Tool for Brucella Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. wgSNP Analyses
2.2. DNA
2.3. HRM-PCR
2.4. Assessment of HRM-PCR Performances
3. Results
3.1. SNP-Based Phylogeny of the Brucella Genus
3.2. Development of HRM-PCR Scheme
3.3. Assessment of HRM-PCR Performances
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Scholz, H.C.; Banai, M.; Cloeckaert, A.; Kampfer, P.; Whatmore, A.M. Brucella. In Bergey’s Manual of Systematics of Archaea and Bacteria; John Wiley and Sons: Hoboken, NJ, USA, 2018; pp. 1–38. [Google Scholar]
- Foster, J.; Beckstrom-Sternberg, S.M.; Pearson, T.; Beckstrom-Sternberg, J.S.; Chain, P.S.G.; Roberto, F.F.; Hnath, J.; Brettin, T.; Keim, P. Whole-Genome-Based Phylogeny and Divergence of the Genus Brucella. J. Bacteriol. 2009, 191, 2864–2870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foster, J.T.; Price, L.B.; Beckstrom-Sternberg, S.M.; Pearson, T.; Brown, W.D.; Kiesling, D.M.; Allen, C.A.; Liu, C.M.; Beckstrom-Sternberg, J.; Roberto, F.F.; et al. Genotyping of Brucella species using clade specific SNPs. BMC Microbiol. 2012, 12, 110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corbel, M.J.; WHO. Brucellosis in Humans and Animals; WHO Press: Geneva, Switzerland, 2006. [Google Scholar]
- Whatmore, A.M.; Foster, J.T. Emerging diversity and ongoing expansion of the genus Brucella. Infect. Genet. Evol. 2021, 92, 104865. [Google Scholar] [CrossRef] [PubMed]
- OIE. Brucellosis (infection with B. abortus, B. melitensis and B. suis). In OIE Terrestrial Manual; OIE: Paris, France, 2016.suis). In OIE Terrestrial Manual; OIE: Paris, France, 2016. [Google Scholar]
- Moreno, E.; Cloeckaert, A.; Moriyón, I. Brucella evolution and taxonomy. Vet. Microbiol. 2002, 90, 209–227. [Google Scholar] [CrossRef]
- Osterman, B.; Moriyon, I. International Committee on Systematics of Prokaryotes; Subcommittee on the taxonomy of Brucella. Int. J. Syst. Evol. Microbiol. 2006, 56, 1173–1175. [Google Scholar] [CrossRef] [Green Version]
- Foster, G.; Osterman, B.S.; Godfroid, J.; Jacques, I.; Cloeckaert, A. Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts. Int. J. Syst. Evol. Microbiol. 2007, 57, 2688–2693. [Google Scholar] [CrossRef] [Green Version]
- Audic, S.; Lescot, M.; Claverie, J.-M.; Scholz, H.C. Brucella microti: The genome sequence of an emerging pathogen. BMC Genom. 2009, 10, 352. [Google Scholar] [CrossRef] [Green Version]
- Jaý, M.; Girault, G.; Perrot, L.; Taunay, B.; Vuilmet, T.; Rossignol, F.; Pitel, P.-H.; Picard, E.; Ponsart, C.; Mick, V. Phenotypic and Molecular Characterization of Brucella microti-Like Bacteria from a Domestic Marsh Frog (Pelophylax ridibundus). Front. Vet. Sci. 2018, 5, 283. [Google Scholar] [CrossRef]
- Jaÿ, M.; Freddi, L.; Mick, V.; Durand, B.; Girault, G.; Perrot, L.; Taunay, B.; Vuilmet, T.; Azam, D.; Ponsart, C.; et al. Brucella microti-like prevalence in French farms producing frogs. Transbound. Emerg. Dis. 2019, 67, 617–625. [Google Scholar] [CrossRef]
- Rónai, Z.; Kreizinger, Z.; Dán, A.; Drees, K.P.; Foster, J.T.; Bányai, K.; Marton, S.; Szeredi, L.; Jánosi, S.; Gyuranecz, M. First isolation and characterization of Brucella microti from wild boar. BMC Vet. Res. 2015, 11, 147. [Google Scholar] [CrossRef] [Green Version]
- Scholz, H.C.; Nöckler, K.; Göllner, C.; Bahn, P.; Vergnaud, G.; Tomaso, H.; Al Dahouk, S.; Kampfer, P.; Cloeckaert, A.; Maquart, M.; et al. Brucella inopinata sp. nov., isolated from a breast implant infection. Int. J. Syst. Evol. Microbiol. 2010, 60, 801–808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whatmore, A.M.; Davison, N.; Cloeckaert, A.; Al Dahouk, S.; Zygmunt, M.; Brew, S.D.; Perrett, L.L.; Koylass, M.S.; Vergnaud, G.; Quance, C.; et al. Brucella papionis sp. nov., isolated from baboons (Papio spp.). Int. J. Syst. Evol. Microbiol. 2014, 64, 4120–4128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scholz, H.C.; Revilla-Fernandez, S.; Al Dahouk, S.; Hammerl, J.A.; Zygmunt, M.S.; Cloeckaert, A.; Koylass, M.; Whatmore, A.M.; Blom, J.; Vergnaud, G.; et al. Brucella vulpis sp. nov., isolated from mandibular lymph nodes of red foxes (Vulpes vulpes). Int. J. Syst. Evol. Microbiol. 2016, 66, 2090–2098. [Google Scholar] [CrossRef] [PubMed]
- Scholz, H.C.; Mühldorfer, K.; Shilton, C.; Benedict, S.; Whatmore, A.; Blom, J.; Eisenberg, T. The Change of a Medically Important Genus: Worldwide Occurrence of Genetically Diverse Novel Brucella Species in Exotic Frogs. PLoS ONE 2016, 11, e0168872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eisenberg, T.; Hamann, H.-P.; Kaim, U.; Schlez, K.; Seeger, H.; Schauerte, N.; Melzer, F.; Tomaso, H.; Scholz, H.C.; Koylass, M.S.; et al. Isolation of potentially novel Brucella spp. from frogs. Appl. Environ. Microbiol. 2012, 78, 3753–3755. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; Urushadze, L.; Osikowicz, L.; McKee, C.; Kuzmin, I.; Kandaurov, A.; Babuadze, G.; Natradze, I.; Imnadze, P.; Kosoy, M. Molecular Survey of Bacterial Zoonotic Agents in Bats from the Country of Georgia (Caucasus). PLoS ONE 2017, 12, e0171175. [Google Scholar] [CrossRef]
- Scholz, H.; Vergnaud, G. Molecular characterisation of Brucella species. Rev. Sci. Tech. Off. Int. Epiz. 2013, 32, 149–162. [Google Scholar] [CrossRef] [Green Version]
- Verger, J.-M.; Grimont, F.; Grimont, P.A.D.; Grayon, M. Brucella, a Monospecific Genus as Shown by Deoxyribonucleic Acid Hybridization. Int. J. Syst. Bacteriol. 1985, 35, 292–295. [Google Scholar] [CrossRef]
- Gee, J.E.; De, B.K.; Levett, P.N.; Whitney, A.M.; Novak, R.T.; Popovic, T. Use of 16S rRNA gene sequencing for rapid confirmatory identification of Brucella isolates. J. Clin. Microbiol. 2004, 42, 3649–3654. [Google Scholar] [CrossRef] [Green Version]
- Alton, G.G.; Jones, L.M.; Pietz, D.E. Laboratory Techniques in Brucellosis; WHO: Geneva, Switzerland, 1975. [Google Scholar]
- Yu, W.L.; Nielsen, K. Review of Detection of Brucella sp. by Polymerase Chain Reaction. Croat. Med. J. 2010, 51, 306–313. [Google Scholar] [CrossRef] [Green Version]
- Al Dahouk, S.; Tomaso, H.; Prenger-Berninghoff, E.; Splettstoesser, W.D.; Scholz, H.C.; Neubauer, H. Identification of Bruicella Species and Biotypes using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). Crit. Rev. Microbiol. 2005, 31, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Le Flèche, P.; Jacques, I.; Grayon, M.; Al Dahouk, S.; Bouchon, P.; Denoeud, F.; Nöckler, K.; Neubauer, H.; Guilloteau, L.A.; Vergnaud, G. Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay. BMC Microbiol. 2006, 6, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Al Dahouk, S.; Le Flèche, P.; Nöckler, K.; Jacques, I.; Grayon, M.; Scholz, H.C.; Tomaso, H.; Vergnaud, G.; Neubauer, H. Evaluation of Brucella MLVA typing for human brucellosis. J. Microbiol. Methods 2007, 69, 137–145. [Google Scholar] [CrossRef] [PubMed]
- Whatmore, A.M.; Perrett, L.L.; MacMillan, A.P. Characterisation of the genetic diversity of Brucella by multilocus sequencing. BMC Microbiol. 2007, 7, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whatmore, A.M.; Koylass, M.S.; Muchowski, J.; Edwards-Smallbone, J.; Gopaul, K.K.; Perrett, L.L. Extended Multilocus Sequence Analysis to Describe the Global Population Structure of the Genus Brucella: Phylogeography and Relationship to Biovars. Front. Microbiol. 2016, 7, 2049. [Google Scholar] [CrossRef] [PubMed]
- Konstantinidis, K.T.; Tiedje, J.M. Genomic insights that advance the species definition for prokaryotes. Proc. Natl. Acad. Sci. USA 2005, 102, 2567–2572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mesureur, J.; Ranaldi, S.; Monnin, V.; Girard, V.; Arend, S.; Welker, M.; O’Callaghan, D.; Lavigne, J.-P.; Keriel, A. A Simple and Safe Protocol for Preparing Brucella Samples for Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry Analysis. J. Clin. Microbiol. 2016, 54, 449–452. [Google Scholar] [CrossRef] [Green Version]
- O’Callaghan, D.; Whatmore, A. Brucella genomics as we enter the multi-genome era. Briefings Funct. Genom. 2011, 10, 334–341. [Google Scholar] [CrossRef] [Green Version]
- Sankarasubramanian, J.; Vishnu, U.S.; Gunasekaran, P.; Rajendhran, J. A genome-wide SNP-based phylogenetic analysis distinguishes different biovars of Brucella suis. Infect. Genet. Evol. 2016, 41, 213–217. [Google Scholar] [CrossRef]
- Tan, K.-K.; Tan, Y.-C.; Chang, L.-Y.; Lee, K.W.; Nore, S.S.; Yee, W.-Y.; Isa, M.N.M.; Jafar, F.L.; Hoh, C.-C.; AbuBakar, S. Full genome SNP-based phylogenetic analysis reveals the origin and global spread of Brucella melitensis. BMC Genom. 2015, 16, 93. [Google Scholar] [CrossRef] [Green Version]
- Holzapfel, M.; Girault, G.; Keriel, A.; Ponsart, C.; O’Callaghan, D.; Mick, V. Comparative Genomics and in vitro Infection of Field Clonal Isolates of Brucella melitensis Biovar 3 Did Not Identify Signature of Host Adaptation. Front. Microbiol. 2018, 9, 2505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vergnaud, G.; Girault, G.; Thierry, S.; Pourcel, C.; Madani, N.; Blouin, Y. Comparison of French and Worldwide Bacillus anthracis Strains Favors a Recent, Post-Columbian Origin of the Predominant North-American Clade. PLoS ONE 2016, 11, e0146216. [Google Scholar] [CrossRef] [Green Version]
- Girault, G.; Blouin, Y.; Vergnaud, G.; Derzelle, S. High-throughput sequencing of Bacillus anthracis in France: Investigating genome diversity and population structure using whole- genome SNP discovery. BMC Genom. 2014, 15, 288. [Google Scholar] [CrossRef] [Green Version]
- Blouin, Y.; Hauck, Y.; Soler, C.; Fabre, M.; Vong, R.; Dehan, C.; Cazajous, G.; Massoure, P.-L.; Kraemer, P.; Jenkins, A.; et al. Significance of the identification in the Horn of Africa of an exceptionally deep branching Mycobacterium tuberculosis clade. PLoS ONE 2012, 7, e52841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Girault, G.; Wattiau, P.; Saqib, M.; Martin, B.; Vorimore, F.; Singha, H.; Engelsma, M.; Roest, H.; Spicic, S.; Grunow, R.; et al. High-resolution melting PCR analysis for rapid genotyping of Burkholderia mallei. Infect. Genet. Evol. 2018, 63, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Girault, G.; Thierry, S.; Cherchame, E.; Derzelle, S. Application of High-Throughput Sequencing: Discovery of Informative SNPs to Subtype Bacillus anthracis. Adv. Biosci. Biotechnol. 2014, 5, 669–677. [Google Scholar] [CrossRef] [Green Version]
- Gopaul, K.K.; Sells, J.; Lee, R.; Beckstrom-Sternberg, S.M.; Foster, J.T.; Whatmore, A.M. Development and assessment of multiplex high resolution melting assay as a tool for rapid single-tube identification of five Brucella species. BMC Res. Notes 2014, 7, 903. [Google Scholar] [CrossRef] [Green Version]
- Winchell, J.M.; Wolff, B.J.; Tiller, R.; Bowen, M.D.; Hoffmaster, A.R. Rapid identification and discrimination of Brucella isolates by use of real-time PCR and high-resolution melt analysis. J. Clin. Microbiol. 2010, 48, 697–702. [Google Scholar] [CrossRef] [Green Version]
- Wattam, A.R.; Abraham, D.; Dalay, O.; Disz, T.L.; Driscoll, T.; Gabbard, J.L.; Gillespie, J.J.; Gough, R.; Hix, D.; Kenyon, R.; et al. PATRIC, the bacterial bioinformatics database and analysis resource. Nucleic Acids Res. 2014, 42, D581–D591. [Google Scholar] [CrossRef] [Green Version]
- Huang, W.; Li, L.; Myers, J.R.; Marth, G.T. ART: A next-generation sequencing read simulator. Bioinformatics 2012, 28, 593–594. [Google Scholar] [CrossRef] [Green Version]
- Wattam, A.R.; Foster, J.T.; Mane, S.P.; Beckstrom-Sternberg, S.M.; Beckstrom-Sternberg, J.M.; Dickerman, A.W.; Keim, P.; Pearson, T.; Shukla, M.; Ward, D.V.; et al. Comparative Phylogenomics and Evolution of the Brucellae Reveal a Path to Virulence. J. Bacteriol. 2014, 196, 920–930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dwibedi, C.; Birdsell, D.; Lärkeryd, A.; Myrtennäs, K.; Öhrman, C.; Nilsson, E.; Karlsson, E.; Hochhalter, C.; Rivera, A.; Maltinsky, S.; et al. Long-range dispersal moved Francisella tularensis into Western Europe from the East. Microb. Genom. 2016, 2, e000100. [Google Scholar] [CrossRef] [PubMed]
- Kevin, M.; Girault, G.; Caspar, Y.; Cherfa, M.A.; Mendy, C.; Tomaso, H.; Gavier-Widen, D.; Escudero, R.; Maurin, M.; Durand, B.; et al. Phylogeography and Genetic Diversity of Francisella tularensis subsp. holarctica in France (1947–2018). Front. Microbiol. 2020, 11, 287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mesureur, J.; Arend, S.; Cellière, B.; Courault, P.; Cotte-Pattat, P.-J.; Totty, H.; Deol, P.; Mick, V.; Girard, V.; Touchberry, J.; et al. A MALDI-TOF MS database with broad genus coverage for species-level identification of Brucella. PLoS Neglected Trop. Dis. 2018, 12, e0006874. [Google Scholar] [CrossRef] [PubMed]
- da Silva, D.A.V.; Brendebach, H.; Grutzke, J.; Dieckmann, R.; Soares, R.M.; de Lima, J.T.R.; Keid, L.B.; Hofreuter, D.; Al Dahouk, S. MALDI-TOF MS and genomic analysis can make the difference in the clarification of canine brucellosis outbreaks. Sci. Rep. 2020, 10, 19256. [Google Scholar] [CrossRef] [PubMed]
Species Targeted | Genomic Position (16M ref) | Forward Primer (5′-3′) | Forward Primer Coordinates (16M ref) | Reverse Primer (5′-3′) | Reverse Primer Coordinates (16M ref) | Locus Tag | Locus Tag Information | Amplicon Size (bp) | Targeted Allele (Related to Column 1) | Other Allele (Related to All Other Brucella) |
---|---|---|---|---|---|---|---|---|---|---|
B. abortus | 609866 | acgaagaagcgatctcgatg | 609832-609851 | aggaaaggccgatgatgtaa | 609905-609924 | BMEI0587 | coml, competence lipoprotein | 93 | T | C |
B. melitensis | 375209 | cggtccgggccacctttacg | 375164-375183 | ggcccggcaattgctcctga | 375225-375244 | NR | NR | 81 | C | T |
B. suis-B. canis | 687223 | ctggcggaaaaggatttgat | 687162-687181 | aatcacgacaaaccacagca | 687232-687251 | BMEI0664 | sugar transport system permease protein | 90 | T | C |
B. suis biovar 1 | 656162 | tgacatggaccctgttttcc | 656196-656215 | cagcgtgacactgaacatgg | 656138-656157 | BMEI0629 | hypothetical protein | 78 | G | A |
B. suis biovar 2 | 221777 | agaccttgcgcttgaacg | 221821-221838 | gccacactgctgagttcg | 221755-221772 | BMEI0215 | (di)nucleoside polyphosphate hydrolase | 84 | T | C |
B. suis biovar 3 | 1368151 | gtatggcggaatgcagga | 1368178-1368195 | cacaaacgccagtgaacg | 1368132-1368149 | NR | NR | 64 | A | G |
B. suis biovar 4 | 2026823 | aagatcgccgtcgtctcg | 2026873-2026890 | ggccacaacagcctgaac | 2026801-2026818 | NR | NR | 90 | A | G |
B. suis biovar 5 | 159143 | cttccgttgaagggcaatc | 159161-159179 | gcctcgaaaacgaaatcatc | 159085-159104 | NR | NR | 95 | C | T |
B. canis | 937299 | gagaactgacccgatggaaa | 937238-937257 | caagggaaccgaatatctgc | 937302-937231 | NR | NR | 84 | C | T |
B. microti | 1111504 | aactgccggatgtgaaaaag | 1111529-1111548 | aaggatcgaggcgtcataaa | 1111478-1111497 | NR | NR | 71 | C | T |
Marine Brucella | 1237960 | gcgatttcattgcccttg | 1237892-1237909 | ttgaaatgggcttcatcca | 1237961-1237979 | NR | NR | 88 | A | G |
B. ceti 1 | 318627 | aatgccgcaatcttcatctt | 318637-318656 | cctctgcgcgacagtttaag | 318587-318606 | NR | NR | 70 | A | C |
B. ceti 2 | 121188 | ctcgctcccaaacactaccc | 121150-121169 | cgttcgccccttatatttga | 121220-121239 | NR | NR | 90 | C | T |
B. pinnipedialis | 369804 | tgcgggatttcaaggataag | 369821-369840 | aagatcgccagatcgtgct | 369768-369786 | BMEI0358 | deoxyuridine 5′-triphosphate nucleotidohydrolase | 73 | T | C |
B. ovis | 576553 | atgggctttggcggtatt | 576495-576512 | cgcccaggtagagctttg | 576558-576575 | BMEI0556 | alpha-ketoglutarate permease | 81 | T | C |
B. neotomae | 1010822 | atggcgaattcgatgaaaag | 1010854-1010873 | tgtcttcacagacgggaatg | 1010775-1010794 | NR | NR | 99 | T | G |
B. melitensis Rev 1 | 139509 | cttcacgccatgcttctttt | 139556-139575 | atgctcaccaccttcaacg | 139483-139501 | BMEI0141 | dihydrolipoamide succinyltransferase component (e2) of 2-oxoglutarate dehydrogenase complex | 93 | T | C |
Expected SNP Profile (Inclusivity Test) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Reference DNA | Field DNA | Total | ||||||||
Expected Allele | Other Allele | Total | % | Expected Allele | Other Allele | Total | % | |||
Primers | B. abortus | 11 | 0 | 11 | 100 | 96 | 0 | 96 | 100 | 107 |
B. melitensis | 6 | 0 | 6 | 100 | 232 | 0 | 232 | 100 | 238 | |
B. melitensis Rev1 | 2 | 0 | 2 | 100 | 6 | 0 | 6 | 100 | 8 | |
B. suis/canis | 6 | 0 | 6 | 100 | 589 | 0 | 589 | 100 | 595 | |
B. suis biovar 1 | 1 | 0 | 1 | 100 | 26 | 0 | 26 | 100 | 27 | |
B. suis biovar 2 | 1 | 0 | 1 | 100 | 194 | 0 | 194 | 100 | 195 | |
B. suis biovar 3 | 1 | 0 | 1 | 100 | 2 | 0 | 2 | 100 | 3 | |
B. suis biovar 4 | 1 | 0 | 1 | 100 | 0 | 0 | 0 | NA | 1 | |
B. suis biovar 5 | 1 | 0 | 1 | 100 | 0 | 0 | 0 | NA | 1 | |
B. canis | 1 | 0 | 1 | 100 | 82 | 0 | 82 | 100 | 83 | |
B. marine | 3 | 0 | 3 | 100 | 14 | 0 | 14 | 100 | 17 | |
B. ceti group 1 | 1 | 0 | 1 | 100 | 8 | 0 | 8 | 100 | 9 | |
B. ceti group 2 | 1 | 0 | 1 | 100 | 4 | 0 | 4 | 100 | 5 | |
B. pinnipedialis | 1 | 0 | 1 | 100 | 2 | 0 | 2 | 100 | 3 | |
B. microti | 1 | 0 | 1 | 100 | 68 | 0 | 68 | 100 | 69 | |
B. ovis | 1 | 0 | 1 | 100 | 88 | 0 | 88 | 100 | 89 | |
B. neotomae | 1 | 0 | 1 | 100 | 0 | 0 | 0 | NA | 1 | |
Total DNA | 40 | 1411 | 1451 |
Other SNP Profile (Exclusion Test) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Reference DNA | Field DNA | Total | ||||||||
Expected Allele | Other Allele | Total | % | Expected Allele | Other Allele | Total | % | |||
Primers | B. abortus | 0 | 16 | 16 | 100 | 0 | 218 | 218 | 100 | 234 |
B. melitensis | 0 | 21 | 21 | 100 | 0 | 66 | 66 | 100 | 87 | |
B. melitensis Rev1 | 0 | 26 | 26 | 100 | 0 | 56 | 56 | 100 | 82 | |
B. suis/canis | 0 | 22 | 22 | 100 | 0 | 43 | 43 | 100 | 65 | |
B. suis biovar 1 | 0 | 26 | 26 | 100 | 0 | 297 | 297 | 100 | 323 | |
B. suis biovar 2 | 0 | 25 | 25 | 100 | 0 | 63 | 63 | 100 | 88 | |
B. suis biovar 3 | 0 | 28 | 28 | 100 | 0 | 94 | 94 | 100 | 122 | |
B. suis biovar 4 | 0 | 25 | 25 | 100 | 0 | 52 | 52 | 100 | 77 | |
B. suis biovar 5 | 0 | 25 | 25 | 100 | 0 | 54 | 54 | 100 | 79 | |
B. canis | 0 | 26 | 26 | 100 | 0 | 64 | 64 | 100 | 90 | |
B. marine | 0 | 24 | 24 | 100 | 0 | 57 | 57 | 100 | 81 | |
B. ceti group 1 | 0 | 26 | 26 | 100 | 0 | 63 | 63 | 100 | 89 | |
B. ceti group 2 | 0 | 26 | 26 | 100 | 0 | 68 | 68 | 100 | 94 | |
B. pinnipedialis | 0 | 26 | 26 | 100 | 0 | 70 | 70 | 100 | 96 | |
B. microti | 0 | 26 | 26 | 100 | 0 | 59 | 59 | 100 | 85 | |
B. ovis | 0 | 28 | 28 | 100 | 0 | 42 | 42 | 100 | 70 | |
B. neotomae | 0 | 27 | 27 | 100 | 0 | 45 | 45 | 100 | 72 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Girault, G.; Perrot, L.; Mick, V.; Ponsart, C. High-Resolution Melting PCR as Rapid Genotyping Tool for Brucella Species. Microorganisms 2022, 10, 336. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10020336
Girault G, Perrot L, Mick V, Ponsart C. High-Resolution Melting PCR as Rapid Genotyping Tool for Brucella Species. Microorganisms. 2022; 10(2):336. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10020336
Chicago/Turabian StyleGirault, Guillaume, Ludivine Perrot, Virginie Mick, and Claire Ponsart. 2022. "High-Resolution Melting PCR as Rapid Genotyping Tool for Brucella Species" Microorganisms 10, no. 2: 336. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10020336