Enterococcus faecalis Shields Porphyromonas gingivalis in Dual-Species Biofilm in Oxic Condition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Development of Biofilm and Incubation
2.3. Experimental Groupings
2.4. Quantitative Analysis of Bacterial Cell Viability
2.5. Biofilm Protein and Thickness Analysis with CLSM
2.6. Data Analysis
3. Results
3.1. Sequential Model I
3.2. Sequential Model II
3.3. Co-Culture Model
3.4. Biofilm Thickness
3.5. Biofilm Protein Visualization
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rosen, H.; Klebanoff, S.J. Bactericidal activity of a superoxide anion-generating system. A model for the polymorphonuclear leukocyte. J. Exp. Med. 1979, 149, 27–39. [Google Scholar] [PubMed]
- Brawn, K.; Fridovich, I. DNA strand scission by enzymically generated oxygen radicals. Arch. Biochem. Biophys. 1981, 206, 414–419. [Google Scholar] [PubMed]
- Harley, J.B.; Flaks, J.G.; Goldfine, H.; Bayer, M.E.; Rasmussen, H. Hyperbaric oxygen toxicity and ribosome destruction in Escherichia coli K12. Can. J. Microbiol. 1981, 27, 44–51. [Google Scholar] [CrossRef]
- Hajishengallis, G. Periodontitis: From microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 2015, 15, 30–44. [Google Scholar]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [PubMed]
- Paster, B.J.; Olsen, I.; Aas, J.A.; Dewhirst, F.E. The breadth of bacterial diversity in the human periodontal pocket and other oral sites. Periodontology 2000 2006, 42, 80–87. [Google Scholar]
- Kriebel, K.; Hieke, C.; Müller-Hilke, B.; Nakata, M.; Kreikemeyer, B. Oral Biofilms from Symbiotic to Pathogenic Interactions and Associated Disease—Connection of Periodontitis and Rheumatic Arthritis by Peptidylarginine Deiminase. Front. Microbiol. 2018, 9, 53. [Google Scholar]
- Molander, A.; Reit, C.; Dahlén, G.; Kvist, T. Microbiological status of root-filled teeth with apical periodontitis. Int. Endod. J. 1998, 31, 1–7. [Google Scholar]
- Siqueira, J.F., Jr.; Rôças, I.N. Polymerase chain reaction–based analysis of microorganisms associated with failed endodontic treatment. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endodontol. 2004, 97, 85–94. [Google Scholar]
- Endo, M.; Ferraz, C.; Zaia, A.A.; Almeida, J.F.A.; Gomes, B.P.F.A. Quantitative and qualitative analysis of microorganisms in root-filled teeth with persistent infection: Monitoring of the endodontic retreatment. Eur. J. Dent. 2013, 7, 302–309. [Google Scholar]
- Bystrom, A.; Claesson, R.; Sundqvist, G. The antibacterial effect of camphorated paramonochlorophenol, camphorated phenol and calcium hydroxide in the treatment of infected root canals. Dent. Traumatol. 1985, 1, 170–175. [Google Scholar]
- Love, R.M. Enterococcus faecalis—A mechanism for its role in endodontic failure. Int. Endod. J. 2001, 34, 399–405. [Google Scholar] [PubMed]
- Evans, M.; Davies, J.K.; Sundqvist, G.; Figdor, D. Mechanisms involved in the resistance of Enterococcus faecalis to calcium hydroxide. Int. Endod. J. 2002, 35, 221–228. [Google Scholar] [PubMed]
- Sedgley, C.M.; Lennan, S.L.; Appelbe, O.K. Survival of Enterococcus faecalis in root canals ex vivo. Int. Endod. J. 2005, 38, 735–742. [Google Scholar] [CrossRef]
- Neelakantan, P.; Romero, M.; Vera, J.; Daood, U.; Khan, A.U.; Yan, A.; Cheung, G.S.P. Biofilms in Endodontics—Current Status and Future Directions. Int. J. Mol. Sci. 2017, 18, 1748. [Google Scholar]
- Kim, M.-A.; Rosa, V.; Min, K.-S. Characterization of Enterococcus faecalis in different culture conditions. Sci. Rep. 2020, 10, 21867. [Google Scholar]
- Gomes, B.P.; Berber, V.B.; Kokaras, A.S.; Chen, T.; Paster, B.J. Microbiomes of endodontic-periodontal lesions before and after chemomechanical preparation. J. Endod. 2015, 41, 1975–1984. [Google Scholar]
- Rovai, E.D.S.; Matos, F.D.S.; Kerbauy, W.D.; Cardoso, F.G.D.R.; Martinho, F.C.; Oliveira, L.D.D.; Valera, M.C.; Carvalho, C.A.T. Microbial profile and endotoxin levels in primary periodontal lesions with secondary endodontic involvement. Braz. Dent. J. 2019, 30, 356–362. [Google Scholar]
- Diaz, P.I.; Zilm, P.S.; Rogers, A.H. Fusobacterium nucleatum supports the growth of Porphyromonas gingivalis in oxygenated and carbon-dioxide-depleted environments. Microbiology 2002, 148, 467–472. [Google Scholar]
- Smalley, J.W.; Birss, A.J.; Silver, J. The periodontal pathogen Porphyromonas gingivalis harnesses the chemistry of the μ-oxo bishaem of iron protoporphyrin IX to protect against hydrogen peroxide. FEMS Microbiol. Lett. 2000, 183, 159–164. [Google Scholar]
- Diaz, P.; Valm, A. Microbial Interactions in Oral Communities Mediate Emergent Biofilm Properties. J. Dent. Res. 2020, 99, 18–25. [Google Scholar] [PubMed]
- Bartnicka, D.; Karkowska-Kuleta, J.; Zawrotniak, M.; Satała, D.; Michalik, K.; Zielinska, G.; Bochenska, O.; Kozik, A.; Ciaston, I.; Koziel, J.; et al. Adhesive protein-mediated cross-talk between Candida albicans and Porphyromonas gingivalis in dual species biofilm protects the anaerobic bacterium in unfavorable oxic environment. Sci. Rep. 2019, 9, 4376. [Google Scholar] [PubMed]
- de Oliveira, R.V.D.; Bonafé, F.S.S.; Spolidorio, D.M.P.; Koga-Ito, C.Y.; de Farias, A.L.; Kirker, K.R.; James, G.A.; Brighenti, F.L. Streptococcus mutans and actinomyces naeslundii interaction in dual-species biofilm. Microorganisms 2020, 8, 194. [Google Scholar]
- Thurnheer, T.; Belibasakis, G. Streptococcus oralis maintains homeostasis in oral biofilms by antagonizing the cariogenic pathogen Streptococcus mutans. Mol. Oral Microbiol. 2018, 33, 234–239. [Google Scholar] [PubMed] [Green Version]
- Burmølle, M.; Ren, D.; Bjarnsholt, T.; Sørensen, S.J. Interactions in multispecies biofilms: Do they actually matter? Trends Microbiol. 2014, 22, 84–91. [Google Scholar] [PubMed]
- Bai, F.; Cai, Z.; Yang, L. Recent progress in experimental and human disease-associated multi-species biofilms. Comput. Struct. Biotechnol. J. 2019, 17, 1234–1244. [Google Scholar]
- Joshi, R.V.; Gunawan, C.; Mann, R. We Are One: Multispecies Metabolism of a Biofilm Consortium and Their Treatment Strategies. Front. Microbiol. 2021, 12, 635432. [Google Scholar]
- Shin, J.M.; Luo, T.; Lee, K.H.; Guerreiro, D.; Botero, T.M.; McDonald, N.J.; Rickard, A.H. Deciphering Endodontic Microbial Communities by Next-generation Sequencing. J. Endod. 2018, 44, 1080–1087. [Google Scholar]
- Manoil, D.; Al-Manei, K.; Belibasakis, G.N. A Systematic Review of the Root Canal Microbiota Associated with Apical Periodontitis: Lessons from Next-Generation Sequencing. Proteom. Clin. Appl. 2020, 14, 1900060. [Google Scholar]
- Fox, E.; Cowley, E.; Nobile, C.; Hartooni, N.; Newman, D.; Johnson, A. Anaerobic bacteria grow within Candida albicans biofilms and induce biofilm formation in suspension cultures. Curr. Biol. 2014, 24, 2411–2416. [Google Scholar]
- Kowalski, C.H.; Morelli, K.A.; Schultz, D.; Nadell, C.D.; Cramer, R.A. Fungal biofilm architecture produces hypoxic microenvironments that drive antifungal resistance. Proc. Natl. Acad. Sci. USA 2020, 117, 22473–22483. [Google Scholar] [CrossRef] [PubMed]
- Diaz, P.I.; Rogers, A.H. The effect of oxygen on the growth and physiology of Porphyromonas gingivalis. Oral Microbiol. Immunol. 2004, 19, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Smalley, J.W.; Olczak, T. Heme acquisition mechanisms of Porphyromonas gingivalis—strategies used in a polymicrobial community in a heme-limited host environment. Mol. Oral Microbiol. 2017, 32, 1–23. [Google Scholar]
- Siqueira, J.F., Jr.; Rôças, I.N. Exploiting molecular methods to explore endodontic infections: Part 1—Current molecular technologies for microbiological diagnosis. J. Endod. 2005, 31, 411–423. [Google Scholar] [CrossRef]
- Rousseau, A.; Villena, I.; Dumètre, A.; Escotte-Binet, S.; Favennec, L.; Dubey, J.P.; Aubert, D.; La Carbona, S. Evaluation of propidium monoazide–based qPCR to detect viable oocysts of Toxoplasma gondii. Parasitol. Res. 2019, 118, 999–1010. [Google Scholar] [PubMed]
- Sicard, A.; Merfa, M.V.; Voeltz, M.; Zeilinger, A.R.; De La Fuente, L.; Almeida, R.P.P. Discriminating between viable and membrane-damaged cells of the plant pathogen Xylella fastidiosa. PLoS ONE 2019, 14, e0221119. [Google Scholar]
- Lopez, M.F.; Berggren, K.; Chernokalskaya, E.; Lazarev, A.; Robinson, M.; Patton, W.F. A comparison of silver stain and SYPRO Ruby Protein Gel Stain with respect to protein detection in two-dimensional gels and identification by peptide mass profiling. Electrophor. Int. J. 2000, 21, 3673–3683. [Google Scholar] [CrossRef]
- Bradshaw, D.J.; Marsh, P.D.; Watson, G.K.; Allison, C. Role of Fusobacterium nucleatum and Coaggregation in Anaerobe Survival in Planktonic and Biofilm Oral Microbial Communities during Aeration. Infect. Immun. 1998, 66, 4729–4732. [Google Scholar] [CrossRef]
- Portenier, I.; Waltimo, T.M.; Haapasalo, M. Enterococcus faecalis–the root canal survivor and ‘star’ in post-treatment disease. Endod. Top. 2003, 6, 135–159. [Google Scholar] [CrossRef]
- Rodríguez-Niklitschek, C.; Oporto, G.H. Clinical implications of Enterococcus faecalis microbial contamination in root canals of devitalized teeth: Literature review. Rev. Odontol. Mex. 2015, 19, 181–186. [Google Scholar] [CrossRef]
- Lukic, D.; Karygianni, L.; Flury, M.; Attin, T.; Thurnheer, T. Endodontic-Like Oral Biofilms as Models for Multispecies Interactions in Endodontic Diseases. Microorganisms 2020, 8, 674. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.B.; Bassler, B.L. Quorum sensing in bacteria. Annu. Rev. Microbiol. 2001, 55, 165–199. [Google Scholar] [CrossRef] [PubMed]
- Hancock, L.E.; Perego, M. The Enterococcus faecalis fsr two-component system controls biofilm development through production of gelatinase. J. Bacteriol. 2004, 186, 5629–5639. [Google Scholar] [CrossRef] [PubMed]
- Dunny, G.M.; Berntsson, R.P.-A. Enterococcal Sex Pheromones: Evolutionary Pathways to Complex, Two-Signal Systems. J. Bacteriol. 2016, 198, 1556–1562. [Google Scholar] [CrossRef] [PubMed]
- Clewell, D.B.; Francia, M.V.; Flannagan, S.E.; An, F.Y. Enterococcal plasmid transfer: Sex pheromones, transfer origins, relaxases, and the Staphylococcus aureus issue. Plasmid 2002, 48, 193–201. [Google Scholar] [CrossRef]
- He, L.; Wang, H.; Zhang, R.; Li, H. The regulation of Porphyromonas gingivalis biofilm formation by ClpP. Biochem. Biophys. Res. Commun. 2019, 509, 335–340. [Google Scholar] [CrossRef]
- Strateva, T.; Atanasova, D.; Savov, E.; Petrova, G.; Mitov, I. Incidence of virulence determinants in clinical Enterococcus faecalis and Enterococcus faecium isolates collected in Bulgaria. Braz. J. Infect. Dis. 2016, 20, 127–133. [Google Scholar] [CrossRef]
- Lins, R.X.; Andrade, A.D.O.; Junior, R.H.; Wilson, M.J.; Lewis, M.A.; Williams, D.W.; Fidel, R.A.S. Antimicrobial resistance and virulence traits of Enterococcus faecalis from primary endodontic infections. J. Dent. 2013, 41, 779–786. [Google Scholar] [CrossRef]
- Saffari, F.; Sobhanipoor, M.H.; Shahravan, A.; Ahmadrajabi, R. Virulence genes, antibiotic resistance and capsule locus polymorphisms in Enterococcus faecalis isolated from canals of root-filled teeth with periapical lesions. Infect. Chemother. 2018, 50, 340–345. [Google Scholar] [CrossRef]
- Frank, K.L.; Barnes, A.M.; Grindle, S.M.; Manias, D.A.; Schlievert, P.M.; Dunny, G.M. Use of recombinase-based in vivo expression technology to characterize Enterococcus faecalis gene expression during infection identifies in vivo-expressed antisense RNAs and implicates the protease Eep in pathogenesis. Infect. Immun. 2012, 80, 539–549. [Google Scholar] [CrossRef]
- Chávez de Paz, L.E.; Lemos, J.A.; Wickström, C.; Sedgley, C.M. Role of (p) ppGpp in biofilm formation by Enterococcus faecalis. Appl. Environ. Microbiol. 2012, 78, 1627–1630. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dale, J.L.; Cagnazzo, J.; Phan, C.Q.; Barnes, A.M.T.; Dunny, G.M. Multiple Roles for Enterococcus faecalis Glycosyltransferases in Biofilm-Associated Antibiotic Resistance, Cell Envelope Integrity, and Conjugative Transfer. Antimicrob. Agents Chemother. 2015, 59, 4094–4105. [Google Scholar] [CrossRef] [PubMed]
- Zoletti, G.O.; Pereira, E.M.; Schuenck, R.P.; Teixeira, L.M.; Siqueira, J.F.; dos Santos, K.R.N. Characterization of virulence factors and clonal diversity of Enterococcus faecalis isolates from treated dental root canals. Res. Microbiol. 2011, 162, 151–158. [Google Scholar] [CrossRef]
- Kayaoglu, G.; Ørstavik, D. Virulence factors of Enterococcus faecalis: Relationship to endodontic disease. Crit. Rev. Oral Biol. Med. 2004, 15, 308–320. [Google Scholar] [CrossRef]
- Tendolkar, P.M.; Baghdayan, A.S.; Gilmore, M.S.; Shankar, N. Enterococcal surface protein, Esp, enhances biofilm formation by Enterococcus faecalis. Infect. Immun. 2004, 72, 6032–6039. [Google Scholar] [CrossRef]
- How, K.Y.; Song, K.P.; Chan, K.G. Porphyromonas gingivalis: An overview of periodontopathic pathogen below the gum line. Front. Microbiol. 2016, 7, 53. [Google Scholar] [CrossRef]
- Jia, L.; Han, N.; Du, J.; Guo, L.; Luo, Z.; Liu, Y. Pathogenesis of Important Virulence Factors of Porphyromonas gingivalis via Toll-Like Receptors. Front. Cell. Infect. Microbiol. 2019, 9, 262. [Google Scholar] [CrossRef]
- Mohammed, M.M.A.; Pettersen, V.K.; Nerland, A.H.; Wiker, H.G.; Bakken, V. Quantitative proteomic analysis of extracellular matrix extracted from mono- and dual-species biofilms of Fusobacterium nucleatum and Porphyromonas gingivalis. Anaerobe 2017, 44, 133–142. [Google Scholar] [CrossRef]
- Chung, W.O.; Demuth, D.R.; Lamont, R.J. Identification of a Porphyromonas gingivalis Receptor for the Streptococcus gordonii SspB Protein. Infect. Immun. 2000, 68, 6758–6762. [Google Scholar] [CrossRef]
- Frankenberg, L.; Brugna, M.; Hederstedt, L. Enterococcus faecalis Heme-Dependent Catalase. J. Bacteriol. 2002, 184, 6351–6356. [Google Scholar] [CrossRef]
- Almstrand, R.; Daims, H.; Persson, F.; Sörensson, F.; Hermansson, M. New methods for analysis of spatial distribution and coaggregation of microbial populations in complex biofilms. Appl. Environ. Microbiol. 2013, 79, 5978–5987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Breen, C.J.; Raverdeau, M.; Voorheis, H.P. Development of a quantitative fluorescence-based ligand-binding assay. Sci. Rep. 2016, 6, 25769. [Google Scholar] [CrossRef] [PubMed]
- Polasko, A.L.; Ramos, P.; Kaner, R.B.; Mahendra, S. A multipronged approach for systematic in vitro quantification of catheter-associated biofilms. J. Hazard. Mater. Lett. 2021, 2, 100032. [Google Scholar] [CrossRef]
Organisms and Strains | (a) Primer Sequences (5′ → 3′) | (b) DNA Probe Sequences (5′ → 3′) |
---|---|---|
Enterococcus faecalis (ATCC 47077) | Forward: GTTTATGCCGCATGGCATAAGAG Reverse: CAGGTCGGCTATGCA | 6FAM-CGGCTCACCAAGGCCA-TAMRA |
Porphyromonas gingivalis (ATCC 33277) | Forward: ACCTTACCCGGGATTGAAATG Reverse: CAACCATGCAGCACCTACATAGAA | 6FAM-ATGACTGATGGTGAAAACCGTCTTCCCTTC-TAMRA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tan, H.C.; Cheung, G.S.P.; Chang, J.W.W.; Zhang, C.; Lee, A.H.C. Enterococcus faecalis Shields Porphyromonas gingivalis in Dual-Species Biofilm in Oxic Condition. Microorganisms 2022, 10, 1729. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10091729
Tan HC, Cheung GSP, Chang JWW, Zhang C, Lee AHC. Enterococcus faecalis Shields Porphyromonas gingivalis in Dual-Species Biofilm in Oxic Condition. Microorganisms. 2022; 10(9):1729. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10091729
Chicago/Turabian StyleTan, Huan Chang, Gary Shun Pan Cheung, Jeffrey Wen Wei Chang, Chengfei Zhang, and Angeline Hui Cheng Lee. 2022. "Enterococcus faecalis Shields Porphyromonas gingivalis in Dual-Species Biofilm in Oxic Condition" Microorganisms 10, no. 9: 1729. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10091729