Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Diets
2.3. Feeding Trial
2.4. Sample Collection
2.5. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR
2.6. Determination of Intestinal Enzyme Activity
2.7. DNA Extraction and High Throughput Sequencing of Intestinal Microbiota
2.8. Sequencing Data Analysis of Intestinal Microbiota
2.9. Statistical Analysis
3. Results
3.1. Effects of TSO on Nutrient Digestion and Absorption, as well as Anti-Oxidative Capacity in the Intestine at the End of Growing-Out Period
3.2. Effect of TSO on the Intestinal Barrier Function at the End of Growing-Out Period
3.3. Effects of TSO on Nutrient Digestion and Absorption, Antioxidative Capacity and Barrier Function of the Intestine at the End of FOF Period
3.4. Changes of Intestinal Microbiota Community Complexity under Fish Oil Finishing Strategy
3.5. Changes of Intestinal Microbiota Composition under Fish Oil Finishing Strategy
3.6. Specific Changes of Intestinal Microbiota in Response to FOF Strategy
4. Discussion
4.1. Effects of FOF on Nutrient Digestion and Absorption, Anti-Oxidative Capacity and Barrier Function of the Intestine
4.2. Effect of FOF on Intestinal Microbiota
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2022; FAO: Rome, Italy, 2022. [Google Scholar]
- Lee, S.; Aya, F.A.; Won, S.; Hamidoghli, A.; Bai, S.C. Effects of Replacing Dietary Fish Oil with Beef Tallow on Growth Perfor mance, Serological Parameters, and Fatty Acid Composition in Juvenile Olive Flounder, Paralichthys Olivaceus. J. World Aquac. Soc. 2020, 51, 393–406. [Google Scholar] [CrossRef]
- Milian-Sorribes, M.C.; Martinez-Llorens, S.; Cruz-Castellon, C.; Jover-Cerda, M.; Tomas-Vidal, A. Effect of Fish Oil Replacement and Probiotic Addition on Growth, Body Composition and Histological Parameters of Yellowtail (Seriola dumerili). Aquac. Nutr. 2021, 27, 3–16. [Google Scholar] [CrossRef]
- You, C.; Chen, B.; Wang, M.; Wang, S.; Zhang, M.; Sun, Z.; Juventus, A.J.; Ma, H.; Li, Y. Effects of Dietary Lipid Sources on the Intestinal Microbiome and Health of Golden Pompano (Trachinotus ovatus). Fish Shellfish Immunol. 2019, 89, 187–197. [Google Scholar] [CrossRef] [PubMed]
- Turchini, G.M.; Torstensen, B.E.; Ng, W.K. Fish Oil Replacement in Finfish Nutrition. Rev. Aquac. 2009, 1, 10–57. [Google Scholar] [CrossRef]
- Ghamkhar, R.; Hicks, A. Sustainable Aquafeeds: Using Aquafarmer Preference to Inform a Multi-Criteria Decision Analysis. ACS Agric. Sci. Technol. 2021, 1, 270–280. [Google Scholar] [CrossRef]
- Glencross, B.; Hawkins, W.; Curnow, J. Evaluation of Canola Oils as Alternative Lipid Resources in Diets for Juvenile Red Seabream, Pagrus Auratus. Aquac. Nutr. 2003, 9, 305–315. [Google Scholar] [CrossRef]
- Trullas, C.; Tres, A.; Saldo, J.; Fontanillas, R.; Sala, R. Quality Characteristics of Fillets of Rainbow Trout Fed Acid or Re-Esterified Rapeseed Oils as Dietary Fat Sources. Aquaculture 2017, 480, 22–31. [Google Scholar] [CrossRef]
- Mock, T.S.; Francis, D.S.; Jago, M.K.; Miles, P.C.; Glencross, B.D.; Smullen, R.P.; Keast, R.S.J.; Turchini, G.M. Seasonal Effects on Growth and Product Quality in Atlantic Salmon Fed Diets Containing Terrestrial Oils as Assessed by a Long-Term, on-Farm Growth Trial. Aquac. Nutr. 2021, 27, 477–490. [Google Scholar] [CrossRef]
- Izquierdo, M.S.; Montero, D.; Robaina, L.; Caballero, M.J.; Rosenlund, G.; Gines, R. Alterations in Fillet Fatty Acid Profile and Flesh Quality in Gilthead Seabream (Sparus aurata) Fed Vegetable Oils for a Long Terin Period. Recovery of Fatty Acid Profiles by Fish Oil Feeding. Aquaculture 2005, 250, 431–444. [Google Scholar] [CrossRef] [Green Version]
- Cui, K.; Li, X.; Chen, Q.; Li, Q.; Gao, S.; Tan, P.; Mai, K.; Ai, Q. Effect of Replacement of Dietary Fish Oil with Four Vegetable Oils on Prostaglandin E-2 Synthetic Pathway and Expression of Inflammatory Genes in Marine Fish Larimichthys Crocea. Fish Shellfish Immunol. 2020, 107, 529–536. [Google Scholar] [CrossRef]
- Ayisi, C.L.; Zhao, J.; Wu, J.-W. Replacement of Fish Oil with Palm Oil: Effects on Growth Performance, Innate Immune Response, Antioxidant Capacity and Disease Resistance in Nile Tilapia (Oreochromis niloticus). PLoS ONE 2018, 13, e0196100. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Xu, C.; Yang, X.; Qian, D.; Gu, Z.; Jia, Y.; Li, E. Growth, Antioxidant Capacity, Intestine Histology and Lipid Metabolism of Juvenile Red Claw Crayfish, Cherax Quadricarinatus, Fed Different Lipid Sources. Aquac. Nutr. 2021, 27, 261–273. [Google Scholar] [CrossRef]
- Parrino, V.; Cappello, T.; Costa, G.; Cannava, C.; Sanfilippo, M.; Fazio, F.; Fasulo, S. Comparative Study of Haematology of Two Teleost Fish (Mugil cephalus and Carassius auratus) from Different Environments and Feeding Habits. Eur. Zool. J. 2018, 85, 194–200. [Google Scholar] [CrossRef] [Green Version]
- Kesbic, O.S.; Parrino, V.; Acar, U.; Yilmaz, S.; lo Paro, G.; Fazio, F. Effects of Monterey Cypress (Cupressus macrocarpa Hartw) Leaf Essential Oil as a Dietary Supplement on Growth Performance and Haematological and Biochemical Parameters of Common Carp (Cyprinus carpio L.). Ann. Anim. Sci. 2020, 20, 1411–1426. [Google Scholar] [CrossRef]
- Acar, U.; Parrino, V.; Kesbic, O.S.; lo Paro, G.; Saoca, C.; Abbate, F.; Yilmaz, S.; Fazio, F. Effects of Different Levels of Pomegranate Seed Oil on Some Blood Parameters and Disease Resistance against Yersinia Ruckeri in Rainbow Trout. Front. Physiol. 2018, 9, 596. [Google Scholar] [CrossRef] [PubMed]
- Rombenso, A.N.; Trushenski, J.T.; Schwarz, M.H. Beef Tallow Is Suitable as a Primary Lipid Source in Juvenile Florida Pompano Feeds. Aquac. Nutr. 2017, 23, 1274–1286. [Google Scholar] [CrossRef]
- Liao, Z.; Sun, Z.; Bi, Q.; Gong, Q.; Sun, B.; Wei, Y.; Liang, M.; Xu, H. Application of the Fish Oil-Finishing Strategy in a Lean Marine Teleost, Tiger Puffer (Takifugu rubripes). Aquaculture 2021, 534, 736306. [Google Scholar] [CrossRef]
- Bell, J.G.; Tocher, D.R.; Henderson, R.J.; Dick, J.R.; Crampton, V.O. Altered Fatty Acid Compositions in Atlantic Salmon (Salmo salar) Fed Diets Containing Linseed and Rapeseed Oils Can Be Partially Restored by a Subsequent Fish Oil Finishing Diet. J. Nutr. 2003, 133, 2793–2801. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Sun, Y.; Wang, L.; Li, X.; Xu, Y. Synbiotic Dietary Supplement Affects Growth, Immune Responses and Intestinal Microbiota of Apostichopus Japonicas. Fish Shellfish Immunol. 2017, 68, 232–242. [Google Scholar] [CrossRef]
- Nayak, S.K. Probiotics and Immunity: A Fish Perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef]
- Xiao, L.; Estelle, J.; Kiilerich, P.; Ramayo-Caldas, Y.; Xia, Z.K.; Feng, Q.; Liang, S.S.; Pedersen, A.O.; Kjeldsen, N.J.; Liu, C.; et al. A Reference Gene Catalogue of the Pig Gut Microbiome. Nat. Microbiol. 2016, 1, 16161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartviksen, M.; Vecino, J.L.G.; Ringo, E.; Bakke, A.-M.; Wadsworth, S.; Krogdahl, A.; Ruohonen, K.; Kettunen, A. Alternative Dietary Protein Sources for Atlantic Salmon (Salmo salar L.) Effect on Intestinal Microbiota, Intestinal and Liver Histology and Growth. Aquac. Nutr. 2014, 20, 381–398. [Google Scholar] [CrossRef] [Green Version]
- Gatesoupe, F.-J.; Huelvan, C.; le Bayon, N.; Severe, A.; Aasen, I.M.; Degnes, K.F.; Mazurais, D.; Panserat, S.; Zambonino-Infante, J.L.; Kaushik, S.J. The Effects of Dietary Carbohydrate Sources and Forms on Metabolic Response and Intestinal Microbiota in Sea Bass Juveniles, Dicentrarchus Labrax. Aquaculture 2014, 422, 47–53. [Google Scholar] [CrossRef] [Green Version]
- Desai, A.R.; Links, M.G.; Collins, S.A.; Mansfield, G.S.; Drew, M.D.; van Kessel, A.G.; Hill, J.E. Effects of Plant-Based Diets on the Distal Gut Microbiome of Rainbow Trout (Oncorhynchus mykiss). Aquaculture 2012, 350, 134–142. [Google Scholar] [CrossRef] [Green Version]
- Bureau of Fisheries; Ministry of Agriculture (Eds.) Chinese Fishery Statistical Yearbook; China Agriculture Press: Beijing, China, 2022. [Google Scholar]
- Xu, H.G.; Ai, Q.H.; Mai, K.S.; Xu, W.; Wang, J.; Ma, H.M.; Zhang, W.B.; Wang, X.J.; Liufu, Z.G. Effects of Dietary Arachidonic Acid on Growth Performance, Survival, Immune Response and Tissue Fatty Acid Composition of Juvenile Japanese Seabass, Lateolabrax Japonicus. Aquaculture 2010, 307, 75–82. [Google Scholar] [CrossRef]
- Jensen, E.C. Real-Time Reverse Transcription Polymerase Chain Reaction to Measure MRNA: Use, Limitations, and Presentation of Results. Anat. Rec. 2012, 295, 1–3. [Google Scholar] [CrossRef]
- Magoc, T.; Salzberg, S.L. FLASH: Fast Length Adjustment of Short Reads to Improve Genome Assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [Green Version]
- Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-Filtering Vastly Improves Diversity Estimates from Illumina Amplicon Sequencing. Nat. Methods 2013, 10, 57–59. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahe, F. VSEARCH: A Versatile Open Source Tool for Metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [Green Version]
- Consortium, H.M.; Haas, B.J.; Gevers, D.; Earl, A.M.; Feldgarden, M.; Ward, D.V.; Giannoukos, G.; Ciulla, D.; Tabbaa, D.; Highlander, S.K.; et al. Chimeric 16S RRNA Sequence Formation and Detection in Sanger and 454-Pyrosequenced PCR Amplicons. Genome Res. 2011, 21, 494–504. [Google Scholar] [CrossRef]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian Classifier for Rapid Assignment of RRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glockner, F.O. The SILVA Ribosomal RNA Gene Database Project: Improved Data Processing and Web-Based Tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple Sequence Alignment with Improved Accuracy and Speed. In Proceedings of the Computational Systems Bioinformatics Conference, Stanford, CA, USA, 19 August 2004. [Google Scholar]
- Huguet, C.T.; Norambuena, F.; Emery, J.A.; Hermon, K.; Turchini, G.M. Dietary N-6/n-3 LC-PUFA Ratio, Temperature and Time Interactions on Nutrients and Fatty Acids Digestibility in Atlantic Salmon. Aquaculture 2015, 436, 160–166. [Google Scholar] [CrossRef]
- Fonseca-Madrigal, J.; Pineda-Delgado, D.; Martinez-Palacios, C.; Rodriguez, C.; Tocher, D.R. Effect of Salinity on the Biosynthesis of N-3 Long-Chain Polyunsaturated Fatty Acids in Silverside Chirostoma Estor. Fish Physiol. Biochem. 2012, 38, 1047–1057. [Google Scholar] [CrossRef]
- Rossmeisl, M.; Jelenik, T.; Jilkova, Z.; Slamova, K.; Kus, V.; Hensler, M.; Medrikova, D.; Povysil, C.; Flachs, P.; Mohamed-Ali, V.; et al. Prevention and Reversal of Obesity and Glucose Intolerance in Mice by DHA Derivatives. Obesity 2009, 17, 1023–1031. [Google Scholar] [CrossRef] [PubMed]
- Belayev, L.; Marcheselli, V.L.; Khoutorova, L.; de Turco, E.B.R.; Busto, R.; Ginsberg, M.D.; Bazan, N.G. Docosahexaenoic Acid Complexed to Albumin Elicits High-Grade Ischemic Neuroprotection. Stroke 2005, 36, 118–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.S.; Lee, K.J. Dietary Protein Requirement of Juvenile Tiger Puffer (Takifugu rubripes). Aquaculture 2009, 287, 219–222. [Google Scholar] [CrossRef]
- Ye, C.; Wu, Y.; Sun, Z.; Wang, A. Dietary Protein Requirement of Juvenile Obscure Puffer, Takifugu Obscurus. Aquac. Res. 2017, 48, 2064–2073. [Google Scholar] [CrossRef]
- Kato, A.; Doi, H.; Nakada, T.; Sakai, H.; Hirose, S. Takifugu Obscurus Is a Euryhaline Fugu Species Very Close to Takifugu Rubripes and Suitable for Studying Osmoregulation. BMC Physiol. 2005, 5, 18. [Google Scholar] [CrossRef] [Green Version]
- Ou, W.; Hu, H.; Yang, P.; Dai, J.; Ai, Q.; Zhang, W.; Zhang, Y.; Mai, K. Dietary Daidzein Improved Intestinal Health of Juvenile Turbot in Terms of Intestinal Mucosal Barrier Function and Intestinal Microbiota. Fish Shellfish Immunol. 2019, 94, 132–141. [Google Scholar] [CrossRef]
- de Roy, K.; Marzorati, M.; Negroni, A.; Thas, O.; Balloi, A.; Fava, F.; Verstraete, W.; Daffonchio, D.; Boon, N. Environmental Conditions and Community Evenness Determine the Outcome of Biological Invasion. Nat. Commun. 2013, 4, 1383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kassen, R.; Rainey, P.B. The Ecology and Genetics of Microbial Diversity. Annu. Rev. Microbiol. 2004, 58, 207–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.; Li, L.; Gao, Q.; Dong, S.; Shi, S. Deep-Sea Cage Culture Altered Microbial Community Composition in the Sediments of the Yellow Sea Cold Water Mass. Mar. Pollut. Bull. 2022, 183, 114081. [Google Scholar] [CrossRef] [PubMed]
- Kong, Q.; He, X.; Feng, Y.; Miao, M.; Wang, Q.; Du, Y.; Xu, F. Pollutant Removal and Microorganism Evolution of Activated Sludge under Ofloxacin Selection Pressure. Bioresour. Technol. 2017, 241, 849–856. [Google Scholar] [CrossRef]
- Pelikan, C.; Wasmund, K.; Glombitza, C.; Hausmann, B.; Herbold, C.W.; Flieder, M.; Loy, A. Anaerobic Bacterial Degradation of Protein and Lipid Macromolecules in Subarctic Marine Sediment. ISME J. 2021, 15, 833–847. [Google Scholar] [CrossRef]
- Li, Y.; Yang, P.; Zhang, Y.; Ai, Q.; Xu, W.; Zhang, W.; Zhang, Y.; Hu, H.; Liu, J.; Mai, K. Effects of Dietary Glycinin on the Growth Performance, Digestion, Intestinal Morphology and Bacterial Community of Juvenile Turbot, Scophthalmus maximus L. Aquaculture 2017, 479, 125–133. [Google Scholar] [CrossRef]
- Kong, Y.; Liao, Z.; Ma, X.; Liang, M.; Xu, H.; Mai, K.; Zhang, Y. Effects of Different Dietary Lipid Levels on Intestinal Mucosal Barrier and Microbial Community of Juvenile Tiger Puffer Takifugu Rubripes. Aquac. Nutr. 2021, 27, 1626–1639. [Google Scholar] [CrossRef]
- Martinez Cruz, P.; Ibanez, A.L.; Monroy Hermosillo, O.A.; Ramirez Saad, H.C. Use of Probiotics in Aquaculture. ISRN Microbiol. 2012, 2012, 916845. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Fu, L.; Lin, J. Probiotic (Bacillus coagulans) cells in the diet benefit the white shrimp litopenaeus vannamei. J. Shellfish Res. 2012, 31, 855–860. [Google Scholar] [CrossRef]
- Shen, W.Y.; Fu, L.L.; Li, W.F.; Zhu, Y.R. Effect of Dietary Supplementation with Bacillus Subtilis on the Growth, Performance, Immune Response and Antioxidant Activities of the Shrimp (Litopenaeus vannamei). Aquac. Res. 2010, 41, 1691–1698. [Google Scholar] [CrossRef]
- Hao, K.; Liu, J.Y.; Ling, F.; Liu, X.L.; Lu, L.; Xia, L.; Wang, G.X. Effects of Dietary Administration of Shewanella Haliotis D4, Bacillus Cereus D7 and Aeromonas Bivalvium D15, Single or Combined, on the Growth, Innate Immunity and Disease Resistance of Shrimp, Litopenaeus Vannamei. Aquaculture 2014, 428, 141–149. [Google Scholar] [CrossRef]
- Douglas, F.; Hambleton, R.; Rigby, G.J. An Investigation of the Oxidation-Reduction Potential and of the Effect of Oxygen on the Germination and Outgrowth of Clostridium Butyricum Spores, Using Platinum Electrodes. J. Appl. Bacteriol. 1973, 36, 625–633. [Google Scholar] [CrossRef] [PubMed]
- Junghare, M.; Subudhi, S.; Lal, B. Improvement of Hydrogen Production under Decreased Partial Pressure by Newly Isolated Alkaline Tolerant Anaerobe, Clostridium Butyricum TM-9A: Optimization of Process Parameters. Int. J. Hydrog. Energy 2012, 37, 3160–3168. [Google Scholar] [CrossRef]
- Ringo, E.; Hoseinifar, S.H.; Ghosh, K.; van Doan, H.; Becks, B.R.; Song, S.K. Lactic Acid Bacteria in Finfish—An Update. Front. Microbiol. 2018, 9, 1818. [Google Scholar] [CrossRef] [Green Version]
- Naseer, M.I.; Bibi, F.; Alqahtani, M.H.; Chaudhary, A.G.; Azhar, E.I.; Kamal, M.A.; Yasir, M. Role of Gut Microbiota in Obesity, Type 2 Diabetes and Alzheimer’s Disease. CNS Neurol. Disord. -Drug Targets 2014, 13, 305–311. [Google Scholar] [CrossRef]
- Ivanov, I.I.; Honda, K. Intestinal Commensal Microbes as Immune Modulators. Cell Host Microbe 2012, 12, 496–508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, J.F.; Johnson, R.C.; Magnarelli, L.A.; Hyde, F.W.; Andreadis, T.G. New Infectious Spirochete Isolated from Short-Tailed Shrews and White-Footed Mice. J. Clin. Microbiol. 1987, 25, 1490–1494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, R.M.; Wiens, G.D.; Salinas, I. Analysis of the Gut and Gill Microbiome of Resistant and Susceptible Lines of Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2019, 86, 497–506. [Google Scholar] [CrossRef]
- Tapia-Paniagua, S.T.; Vidal, S.; Lobo, C.; Prieto-Alamo, M.J.; Jurado, J.; Cordero, H.; Cerezuela, R.; Garcia de la Banda, I.; Esteban, M.A.; Balebona, M.C.; et al. The Treatment with the Probiotic Shewanella Putrefaciens Pdp11 of Specimens of Solea Senegalensis Exposed to High Stocking Densities to Enhance Their Resistance to Disease. Fish Shellfish Immunol. 2014, 41, 209–221. [Google Scholar] [CrossRef]
- Wang, R.; Pan, X.; Xu, Y. Altered Intestinal Microbiota Composition Associated with Enteritis in Yellow Seahorses Hippocampus Kuda (Bleeker, 1852). Curr. Microbiol. 2020, 77, 730–737. [Google Scholar] [CrossRef]
- Zhang, X.H.; He, X.X.; Austin, B. Vibrio Harveyi: A Serious Pathogen of Fish and Invertebrates in Mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghanei-Motlagh, R.; Mohammadian, T.; Gharibi, D.; Khosravi, M.; Mahmoudi, E.; Zarea, M.; El-Matbouli, M.; Menanteau-Ledouble, S. Quorum Quenching Probiotics Modulated Digestive Enzymes Activity, Growth Performance, Gut Microflora, Haemato-Biochemical Parameters and Resistance against Vibrio Harveyi in Asian Seabass (Lates calcarifer). Aquaculture 2021, 531, 735874. [Google Scholar] [CrossRef]
- Guardiola, F.A.; Cuesta, A.; Arizcun, M.; Meseguer, J.; Esteban, M.A. Comparative Skin Mucus and Serum Humoral Defence Mechanisms in the Teleost Gilthead Seabream (Sparus aurata). Fish Shellfish Immunol. 2014, 36, 545–551. [Google Scholar] [CrossRef] [PubMed]
- Tran, L.; Nunan, L.; Redman, R.M.; Mohney, L.L.; Pantoja, C.R.; Fitzsimmons, K.; Lightner, D.V. Determination of the Infectious Nature of the Agent of Acute Hepatopancreatic Necrosis Syndrome Affecting Penaeid Shrimp. Dis. Aquat. Org. 2013, 105, 45–55. [Google Scholar] [CrossRef]
- Han, J.E.; Tang, K.F.J.; Tran, L.H.; Lightner, D.V. Photorhabdus Insect-Related (Pir) Toxin-like Genes in a Plasmid of Vibrio Parahaemolyticus, the Causative Agent of Acute Hepatopancreatic Necrosis Disease (AHPND) of Shrimp. Dis. Aquat. Org. 2015, 113, 33–40. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zokaeifar, H.; Balcazar, J.L.; Saad, C.R.; Kamarudin, M.S.; Sijam, K.; Arshad, A.; Nejat, N. Effects of Bacillus Subtilis on the Growth Performance, Digestive Enzymes, Immune Gene Expression and Disease Resistance of White Shrimp, Litopenaeus Vannamei. Fish Shellfish Immunol. 2012, 33, 683–689. [Google Scholar] [CrossRef] [Green Version]
- Chattaraj, S.; Ganguly, A.; Mandal, A.; das Mohapatra, P.K. A Review of the Role of Probiotics for the Control of Viral Diseases in Aquaculture. Aquac. Int. 2022, 30, 2513–2539. [Google Scholar] [CrossRef]
- Digang, Z.; Aiying, L. Effect of Lactobacillus Supplementation on Growth and Disease Resistance in Tilapia. J. South. Argiculture 2011, 42, 328–331. [Google Scholar]
- Wu, Y.-S.; Chu, Y.-T.; Chen, Y.-Y.; Chang, C.-S.; Lee, B.-H.; Nan, F.-H. Effects of Dietary Lactobacillus Reuteri and Pediococcus Acidilactici on the Cultured Water Qualities, the Growth and Non-Specific Immune Responses of Penaeus Vannamei. Fish Shellfish Immunol. 2022, 127, 176–186. [Google Scholar] [CrossRef]
- Qin, C.; Zhang, Z.; Wang, Y.; Li, S.; Ran, C.; Hu, J.; Xie, Y.; Li, W.; Zhou, Z. EPSP of L. Casei BL23 Protected against the Infection Caused by Aeromonas Veronii via Enhancement of Immune Response in Zebrafish. Front. Microbiol. 2017, 8, 2406. [Google Scholar] [CrossRef]
- Xiaoting, Z.; Yafei, D.; Hongbiao, D.; Keng, Y.; Yingying, Y.; Jiasong, Z. Effects of Lactobacillus Plantarum on Growth Performance, Gut Histology and Activity of Digestive Enzymes in Pacific White Leg Shrimp, Litopenaeus Vannamei. Fish. Sci. 2016, 35, 1–6. [Google Scholar]
- Foysal, M.J.; Alam, M.; Kawser, A.Q.M.R.; Hasan, F.; Rahman, M.M.; Tay, C.-Y.; Prodhan, M.S.H.; Gupta, S.K. Meta-Omits Technologies Reveals Beneficiary Effects of Lactobacillus Plantarum as Dietary Supplements on Gut Microbiota, Immune Response and Disease Resistance of Nile Tilapia (Oreochromis niloticus). Aquaculture 2020, 520, 734974. [Google Scholar] [CrossRef]
- Zhang, C.-N.; Zhang, J.-L.; Guan, W.-C.; Zhang, X.-F.; Guan, S.-H.; Zeng, Q.-H.; Cheng, G.-F.; Cui, W. Effects of Lactobacillus Delbrueckii on Immune Response, Disease Resistance against Aeromonas Hydrophila, Antioxidant Capability and Growth Performance of Cyprinus Carpio Huanghe Var. Fish Shellfish Immunol. 2017, 68, 84–91. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.P.; Lu, Y.; Zhang, Y.; Ning, Z.M.; Li, Y.; Zhao, Q.; Lu, H.Y.; Huang, R.; Xia, X.Q.; Feng, Q.; et al. The Draft Genome of the Grass Carp (Ctenopharyngodon idellus) Provides Insights into Its Evolution and Vegetarian Adaptation. Nat. Genet. 2015, 47, 625–631. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Biddle, A.; Stewart, L.; Blanchard, J.; Leschine, S. Untangling the Genetic Basis of Fibrolytic Specialization by Lachnospiraceae and Ruminococcaceae in Diverse Gut Communities. Diversity 2013, 5, 627–640. [Google Scholar] [CrossRef] [Green Version]
- Thoetkiattikul, H.; Mhuantong, W.; Laothanachareon, T.; Tangphatsornruang, S.; Pattarajinda, V.; Eurwilaichitr, L.; Champreda, V. Comparative Analysis of Microbial Profiles in Cow Rumen Fed with Different Dietary Fiber by Tagged 16S RRNA Gene Pyrosequencing. Curr. Microbiol. 2013, 67, 130–137. [Google Scholar] [CrossRef]
- Levine, U.Y.; Looft, T.; Allen, H.K.; Stanton, T.B. Butyrate-Producing Bacteria, Including Mucin Degraders, from the Swine Intestinal Tract. Appl. Environ. Microbiol. 2013, 79, 3879–3881. [Google Scholar] [CrossRef] [Green Version]
- Chassard, C.; Delmas, E.; Robert, C.; Lawson, P.A.; Bernalier-Donadille, A. Ruminococcus champanellensis Sp Nov., a Cellulose-Degrading Bacterium from Human Gut Microbiota. Int. J. Syst. Evol. Microbiol. 2012, 62, 138–143. [Google Scholar] [CrossRef] [Green Version]
- Flint, H.J.; Bayer, E.A.; Rincon, M.T.; Lamed, R.; White, B.A. Polysaccharide Utilization by Gut Bacteria: Potential for New Insights from Genomic Analysis. Nat. Rev. Microbiol. 2008, 6, 121–131. [Google Scholar] [CrossRef]
- Trachsel, J.; Humphrey, S.; Allen, H.K. Butyricicoccus porcorum sp. nov., a Butyrate-Producing Bacterium from Swine Intestinal Tract. Int. J. Syst. Evol. Microbiol. 2018, 68, 1737–1742. [Google Scholar] [CrossRef]
- Shi, Y.; Cao, X.; Ye, Z.; Xu, Y.; Wang, Y.; Li, Z.; Hang, W.; He, N. Role of Dietary Schizochytrium sp. in Improving Disease Resistance of Zebrafish Metabolic and Microbial Analysis. Aquaculture 2021, 539, 736631. [Google Scholar] [CrossRef]
- Pan, X.; Wu, T.; Zhang, L.; Song, Z.; Tang, H.; Zhao, Z. In Vitro Evaluation on Adherence and Antimicrobial Properties of a Candidate Probiotic Clostridium Butyricum CB2 for Farmed Fish. J. Appl. Microbiol. 2008, 105, 1623–1629. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.F.; Zhang, Y.; Dong, H.B.; Wang, Y.; Zheng, X.T.; Zhang, J.S. Effect of Dietary Clostridium Butyricum on Growth, Intestine Health Status and Resistance to Ammonia Stress in Pacific White Shrimp Litopenaeus Vannamei. Fish Shellfish Immunol. 2017, 65, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Ringo, E.; van Doan, H.; Lee, S.; Song, S.K. Lactic Acid Bacteria in Shellfish: Possibilities and Challenges. Rev. Fish. Sci. Aquac. 2020, 28, 139–169. [Google Scholar] [CrossRef]
- Rios-Covian, D.; Ruas-Madiedo, P.; Margolles, A.; Gueimonde, M.; de los Reyes-Gavilan, C.G.; Salazar, N. Intestinal Short Chain Fatty Acids and Their Link with Diet and Human Health. Front. Microbiol. 2016, 7, 185. [Google Scholar] [CrossRef] [Green Version]
- Scott, K.P.; Gratz, S.W.; Sheridan, P.O.; Flint, H.J.; Duncan, S.H. The Influence of Diet on the Gut Microbiota. Pharmacol. Res. 2013, 69, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Fang, C.L.; Sun, H.; Wu, J.; Niu, H.H.; Feng, J. Effects of Sodium Butyrate on Growth Performance, Haematological and Immunological Characteristics of Weanling Piglets. J. Anim. Physiol. Anim. Nutr. 2014, 98, 680–685. [Google Scholar] [CrossRef]
- Liu, W.S.; Yang, Y.O.; Zhang, J.L.; Gatlin, D.M.; Ringo, E.; Zhou, Z.G. Effects of Dietary Microencapsulated Sodium Butyrate on Growth, Intestinal Mucosal Morphology, Immune Response and Adhesive Bacteria in Juvenile Common Carp (Cyprinus carpio) Pre-Fed with or without Oxidised Oil. Br. J. Nutr. 2014, 112, 15–29. [Google Scholar] [CrossRef] [Green Version]
- Estensoro, I.; Ballester-Lozano, G.; Benedito-Palos, L.; Grammes, F.; Martos-Sitcha, J.A.; Mydland, L.-T.; Calduch-Giner, J.A.; Fuentes, J.; Karalazos, V.; Ortiz, A.; et al. Dietary Butyrate Helps to Restore the Intestinal Status of a Marine Teleost (Sparus aurata) Fed Extreme Diets Low in Fish Meal and Fish Oil. PLoS ONE 2016, 11, e0166564. [Google Scholar] [CrossRef] [Green Version]
- Zoran, D.L.; Turner, N.D.; Taddeo, S.S.; Chapkin, R.S.; Lupton, J.R. Wheat Bran Diet Reduces Tumor Incidence in a Rat Model of Colon Cancer Independent of Effects on Distal Luminal Butyrate Concentrations. J. Nutr. 1997, 127, 2217–2225. [Google Scholar] [CrossRef] [Green Version]
- Hofmanova, J.; Strakova, N.; Vaculova, A.H.; Tylichova, Z.; Safarikova, B.; Skender, B.; Kozubik, A. Interaction of Dietary Fatty Acids with Tumour Necrosis Factor Family Cytokines during Colon Inflammation and Cancer. Mediat. Inflamm. 2014, 2014, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Chen, Z.; Dai, J.; Yang, P.; Xu, W.; Ai, Q.; Zhang, W.; Zhang, Y.; Zhang, Y.; Mai, K. Sodium Butyrate Supplementation in High-Soybean Meal Diets for Turbot (Scophthalmus maximus L.): Effects on Inflammatory Status, Mucosal Barriers and Microbiota in the Intestine. Fish Shellfish Immunol. 2019, 88, 65–75. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, A.; Qazi, J.I. Probiotic Antagonism of Sphingomonas sp. against Vibrio Anguillarum Exposed Labeo Rohita Fingerlings. Adv. Life Sci. 2014, 4, 156–165. [Google Scholar]
- Ricaboni, D.; Mailhe, M.; Khelaifia, S.; Raoult, D.; Million, M. Romboutsia Timonensis, a New Species Isolated from Human Gut. New Microbes New Infect. 2016, 12, 6–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mangifesta, M.; Mancabelli, L.; Milani, C.; Gaiani, F.; de’Angelis, N.; de’Angelis, G.L.; van Sinderen, D.; Ventura, M.; Turroni, F. Mucosal Microbiota of Intestinal Polyps Reveals Putative Biomarkers of Colorectal Cancer. Sci. Rep. 2018, 8, 13974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Wu, S.G.; Wirth, S.; Hao, Y.T.; Wang, W.W.; Zou, H.; Li, W.X.; Wang, G.T. Diversity and Activity of Cellulolytic Bacteria, Isolated from the Gut Contents of Grass Carp (Ctenopharyngodon idellus) (Valenciennes) Fed on Sudan Grass (Sorghum sudanense) or Artificial Feedstuffs. Aquac. Res. 2016, 47, 153–164. [Google Scholar] [CrossRef]
- Farre, R.; Fiorani, M.; Rahiman, S.A.; Matteoli, G. Intestinal Permeability, Inflammation and the Role of Nutrients. Nutrients 2020, 12, 1185. [Google Scholar] [CrossRef]
- Martinez-Guryn, K.; Hubert, N.; Frazier, K.; Urlass, S.; Musch, M.W.; Ojeda, P.; Pierre, J.F.; Miyoshi, J.; Sontag, T.J.; Cham, C.M.; et al. Small Intestine Microbiota Regulate Host Digestive and Absorptive Adaptive Responses to Dietary Lipids. Cell Host Microbe 2018, 23, 458–469.e5. [Google Scholar] [CrossRef]
Ingredients | FO | SO | PO | BT |
---|---|---|---|---|
Fish meal | 40.00 | 40.00 | 40.00 | 40.00 |
Soybean meal | 16.00 | 16.00 | 16.00 | 16.00 |
Soybean protein concentrate | 4.00 | 4.00 | 4.00 | 4.00 |
Wheat meal | 21.48 | 21.48 | 21.48 | 21.48 |
Beer yeast | 5.00 | 5.00 | 5.00 | 5.00 |
Casein | 4.00 | 4.00 | 4.00 | 4.00 |
Mineral premix 1 | 0.50 | 0.50 | 0.50 | 0.50 |
Vitamin premix 1 | 0.20 | 0.20 | 0.20 | 0.20 |
Monocalcium phosphate | 1.00 | 1.00 | 1.00 | 1.00 |
Vitamin C | 0.20 | 0.20 | 0.20 | 0.20 |
Choline chloride | 0.20 | 0.20 | 0.20 | 0.20 |
Attractant | 0.30 | 0.30 | 0.30 | 0.30 |
Ethoxyquin | 0.02 | 0.02 | 0.02 | 0.02 |
Mold inhibitor | 0.10 | 0.10 | 0.10 | 0.10 |
Fish oil | 6.00 | |||
Soybean oil | 6.00 | |||
Palm oil | 6.00 | |||
Beef tallow | 6.00 | |||
Lecithin | 1.00 | 1.00 | 1.00 | 1.00 |
Proximate composition | ||||
Crude protein | 51.39 | 50.67 | 50.60 | 50.80 |
Crude lipid | 10.09 | 10.37 | 10.37 | 9.94 |
Ash | 10.13 | 10.19 | 10.24 | 10.19 |
Gene | GenBank Accession no. | Sequences of Primers (5′→3′) | Annealing Temp./°C |
---|---|---|---|
IL-1β | NM_001280090.1 | F: CATCACCCGCTGACCATGAA R: CATCCCTGAACTCGGTGCTC | 62 |
TNF-α | AB183465.1 | F: CTACTGGAACGGAAGGCAAGAGATG R: GATGCGGCTCAGCGTGTAGTG | 60 |
TGF-β | NM_001280047.1 | F: GCTCGATACCTCACTACTCGCTTAATC R: TCACAGAACAGCCGAAGTTGGAAG | 61 |
IL-8 | XM_035638413 | F: GGCAGACCCCTTGAAGAATA R: TGGTGAACCCTTCCCATTAT | 61 |
Claudin4 | DR441341.1 | F: TATTCTTTGGTGCTGCTCGGT R: TCTTGGGCGGAGCAATGTTA | 62 |
Claudin7 | AY554347.1 | F: ATTCTTTGGTGCTGCTCGGT R: AGCAATGTTAGCTGCGTCCT | 60 |
Claudin18 | KU238180.1 | F: CCAACTGCATTGATGACGAG R: GACCCCGGATACGATGAAGA | 60 |
JAM-A | XM_003971244.3 | F: CAAAAACGGCGTGCCTCTAC R: CCGAGTCCGACCTTGATGTT | 60 |
ZO-1 | XM_011610300.2 | F: AGAGGTTACCCAAGGCCAGT R: CGTCCTGTCCCAGGAACAAA | 62 |
β-actin | XM_003964421.2 | F: ATCGTGCGTGACATCAAGGAGAAG R: TGTCCGTCAGGCAGCTCGTAG | 61 |
Observed Species | Chao1 | Ace | Shannon | Simpson | |
---|---|---|---|---|---|
At the end of growing-out period | |||||
FO | 3527.33 ± 58.15 b | 3632.64 ± 48.98 c | 3799.79 ± 45.96 c | 9.90 ± 0.06 b | 1.00 ± 0.00 b |
SO | 2029.67 ± 190.90 a | 2124.00 ± 197.37 a | 2248.28 ± 203.65 a | 4.53 ± 0.84 a | 0.68 ± 0.15 ab |
PO | 2452.67 ± 264.34 a | 2562.03 ± 273.40 ab | 2719.52 ± 286.41 ab | 5.30 ± 0.93 a | 0.69 ± 0.09 ab |
BT | 2440.33 ± 289.41 a | 2546.87 ± 294.83 ab | 2700.53 ± 300.78 ab | 5.93 ± 1.24 a | 0.80 ± 0.12 ab |
At the end of FOF period | |||||
FO | 1548.67 ± 91.73 abc | 1977.43 ± 94.57 | 2245.61 ± 92.17 | 3.52 ± 0.50 | 0.65 ± 0.12 |
SO | 1320.33 ± 32.64 abc | 2145.95 ± 41.19 | 2400.51 ± 57.07 | 3.68 ± 0.24 | 0.78 ± 0.03 |
PO | 1254.33 ± 26.19 ab | 2020.56 ± 81.32 | 2212.14 ± 128.38 | 3.50 ± 0.23 | 0.80 ± 0.04 |
BT | 1673.33 ± 188.18 bc | 2415.78 ± 261.90 | 2611.84 ± 312.01 | 4.29 ± 0.20 | 0.85 ± 0.02 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, Y.; Liao, Z.; Ma, X.; Liang, M.; Xu, H.; Mai, K.; Zhang, Y. Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy. Microorganisms 2023, 11, 208. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11010208
Kong Y, Liao Z, Ma X, Liang M, Xu H, Mai K, Zhang Y. Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy. Microorganisms. 2023; 11(1):208. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11010208
Chicago/Turabian StyleKong, Yaoyao, Zhangbin Liao, Xiuhua Ma, Mengqing Liang, Houguo Xu, Kangsen Mai, and Yanjiao Zhang. 2023. "Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy" Microorganisms 11, no. 1: 208. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11010208