Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pathogen Isolation and Culture Conditions
2.2. Pathogenicity Tests and Morphological Observations
2.3. Phylogenetic Analysis
2.3.1. Genomic DNA Extraction and PCR Amplification
2.3.2. Phylogenetic Analysis
2.4. Isolation of Bacteria from the Phyllosphere
2.5. Screening and Identification of Antagonistic Bacteria
2.6. In Vitro Antagonism against N. oryzae
2.7. Identification of the Active Metabolites from the Antagonistic Strain
3. Results
3.1. Plant Disease Symptoms and Pathogenicity Test
3.2. Morphological Characterization
3.3. Molecular Characterization and Phylogenetic Analysis
3.4. Screening of Antagonistic Bacteria
3.5. SPME-GC-Q-TOF Analysis of the D65 Fermentation Broth Components
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Su, J.; Jiang, J.; Zhang, F.; Liu, Y.; Ding, L.; Chen, S.; Chen, F. Current achievements and future prospects in the genetic breeding of chrysanthemum: A review. Hortic. Res.-Engl. 2019, 6, 109. [Google Scholar]
- Yuan, H.; Jiang, S.; Liu, Y.; Daniyal, M.; Jian, Y.; Peng, C.; Shen, J.; Liu, S.; Wang, W. The flower head of Chrysanthemum morifolium ramat. (Juhua): A paradigm of flowers serving as Chinese dietary herbal medicine. J. Ethnopharmacol. 2020, 261, 113043. [Google Scholar] [PubMed]
- Hao, D.; Song, Y.; Xiao, P.; Zhong, Y.; Wu, P.; Xu, L. The genus Chrysanthemum: Phylogeny, biodiversity, phytometabolites, and chemodiversity. Front. Plant Sci. 2022, 13, 973197. [Google Scholar]
- Teixeira Da Silva, J.A.; Shinoyama, H.; Aida, R.; Matsushita, Y.; Raj, S.K.; Chen, F. Chrysanthemum biotechnology: Quo vadis? Crit. Rev. Plant Sci. 2013, 32, 21–52. [Google Scholar]
- Jain, A.; Sarsaiya, S.; Wu, Q.; Lu, Y.; Shi, J. A review of plant leaf fungal diseases and its environment speciation. Bioengineered 2019, 10, 409–424. [Google Scholar] [PubMed]
- Dawson, T.E.; Goldsmith, G.R. The value of wet leaves. New Phytol. 2018, 219, 1156–1169. [Google Scholar]
- Koskella, B. The phyllosphere. Curr. Biol. 2020, 30, R1143–R1146. [Google Scholar] [PubMed]
- Zhan, C.; Matsumoto, H.; Liu, Y.; Wang, M. Pathways to engineering the phyllosphere microbiome for sustainable crop production. Nat. Food 2022, 3, 997–1004. [Google Scholar] [PubMed]
- Jane, C.; Trolinger, R.J.M.W. Diseases of chrysanthemum. In Handbook of Florists’ Crops Diseases; Springer: Berlin/Heidelberg, Germany, 2017. [Google Scholar]
- Pandiyan, K.; Kushwaha, P.; Kashyap, P.L.; Bagul, S.Y.; Karthikeyan, N.; Saxena, A.K. 12-phyllosphere microbiome: Modern prospectus and application. In Microbiomes and Plant Health; Academic Press: Cambridge, MA, USA, 2021; pp. 345–366. [Google Scholar]
- Bashir, I.; War, A.F.; Rafiq, I.; Reshi, Z.A.; Rashid, I.; Shouche, Y.S. Phyllosphere microbiome: Diversity and functions. Microbiol. Res. 2022, 254, 126888. [Google Scholar] [PubMed]
- Remus-Emsermann, M.N.P.; Schlechter, R.O. Phyllosphere microbiology: At the interface between microbial individuals and the plant host. New Phytol. 2018, 218, 1327–1333. [Google Scholar]
- Teixidó, N.; Usall, J.; Torres, R. Insight into a successful development of biocontrol agents: Production, formulation, packaging, and shelf life as key aspects. Horticulturae 2022, 8, 305. [Google Scholar] [CrossRef]
- Yang, S.C. Resistance Evaluation and Control to Alternaria Leaf Spot and Sclerotinia sclerotiorum in Cut Chrysanthemum Germplasm Resource. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2020. (In Chinese). [Google Scholar]
- Chen, Q.H.; Miao, Y.H.; Li, J.X.; Yang, Y.W.; Chen, W.L.; Guo, L.P.; Liu, D.H. Research Progress on Pathogenesis and Control Measures of Common Diseases in Chrysanthemum morifolium. Mod. Chin. Med. 2023, 25, 413–420. (In Chinese) [Google Scholar]
- Yan, K.R. Virus Identification and Analysis of Yield and Quality of Virus-Free Plantlets at Different Generations on Chrysanthemun morifolium. Master’s Thesis, Zhejiang University, Hangzhou, China, 2021. (In Chinese). [Google Scholar]
- Fang, Z.D.F. Research Method for Plant Pathology, 3rd ed.; Agriculture Press: Beijing, China, 1998. (In Chinese) [Google Scholar]
- Zhang, J.; Sha, H.; Chen, W.; Mao, B. Characterization and control of Dendrobium officinale bud blight disease. Pathogens 2023, 12, 621. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
- Glass, N.L.U.O.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Zhang, D.; Gao, F.L.; Jakovlic, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. Phylosuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. Mafft multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. Partitionfinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2016, 34, w260. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [PubMed]
- Zhan, C.; Wu, M.; Fang, H.; Liu, X.; Pan, J.; Fan, X.; Wang, M.; Matsumoto, H. Characterization of the chemical fungicides-respofnsive and bacterial pathogen-preventing Bacillus licheniformis in rice spikelet. Food Qual. Saf. 2023, 7, fyad005. [Google Scholar] [CrossRef]
- Lane, D.J. 16s/23s rRNA Sequencing. Nucleic Acid Techniques in Bacterial Systematics; John and Wiley and Sons: Hoboken, NJ, USA, 1991. [Google Scholar]
- Wang, J.; Qin, S.; Fan, R.; Peng, Q.; Hu, X.; Yang, L.; Liu, Z.; Baccelli, I.; Migheli, Q.; Berg, G.; et al. Plant growth promotion and biocontrol of leaf blight caused by Nigrospora sphaerica on passion fruit by endophytic Bacillus subtilis strain gucc4. J. Fungi 2023, 9, 132. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Pan, H.; Chen, M.Y.; Zhang, S.J.; Zhong, C.H. First report of Nigrospora oryzae causing brown/black spot disease of kiwifruit in China. Plant Dis. 2018, 102, 243. [Google Scholar] [CrossRef]
- Wu, J.B.; Zhang, C.L.; Mao, P.P.; Qian, Y.S.; Wang, H.Z. First report of leaf spot caused by Nigrospora oryzae on Dendrobium candidum in China. Plant Dis. 2014, 98, 996. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Gao, Z.; Wang, Y.; Zhang, W.; Yang, J.; Gong, D.; Ma, Y.; Li, Y.; Hu, M. First report of Nigrospora lacticolonia causing leaf spot of Bougainvillea spectabilis in China. Can. J. Plant Pathol. 2022, 44, 695–701. [Google Scholar] [CrossRef]
- Stukenbrock, E.; Gurr, S. Address the growing urgency of fungal disease in crops. Nature 2023, 617, 31–34. [Google Scholar] [CrossRef]
- Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; Mcroberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [PubMed]
- Cho, W.; Jo, Y.; Jo, K.; Kim, K. A current overview of two viroids that infect chrysanthemums: Chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. Viruses 2013, 5, 1099–1113. [Google Scholar] [CrossRef] [PubMed]
- Hill, M.F.; Giles, R.J.; Moran, J.R.; Hepworth, G. The incidence of chrysanthemum stunt viroid and chrysanthemum b carlavirus, tomato aspermy cucumovirus and tomato spotted wilt tospovirus in Australian chrysanthemum crops. Australas. Plant Pathol. 1996, 25, 174–178. [Google Scholar] [CrossRef]
- Alaei, H.; De Backer, M.; Nuytinck, J.; Maes, M.; Höfte, M.; Heungens, K. Phylogenetic relationships of Puccinia horiana and other rust pathogens of Chrysanthemum × morifolium based on rDNA its sequence analysis. Mycol. Res. 2009, 113, 668–683. [Google Scholar] [CrossRef] [PubMed]
- Uematsu, S.; Kageyama, K.; Moriwaki, J.; Sato, T. Colletotrichum carthami comb. Nov., An anthracnose pathogen of safflower, garland chrysanthemum and pot marigold, revived by molecular phylogeny with authentic herbarium specimens. J. Gen. Plant Pathol. 2012, 78, 316–330. [Google Scholar] [CrossRef]
- Yang, J.S.; Guo, H.W.; Niu, L.Y. Diseases and Pests of Chrysanthemum in Baoding Area. J. Anhui Agric. Sci. 2007, 35, 2311–2312. (In Chinese) [Google Scholar]
- Wang, M.; Liu, F.; Crous, P.W.; Cai, L. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia-Mol. Phylogeny Evol. Fungi 2017, 39, 118–142. [Google Scholar] [CrossRef]
- Ebada, S.S.; Eze, P.; Okoye, F.B.C.; Esimone, C.O.; Proksch, P. The fungal endophyte Nigrospora oryzae produces quercetin monoglycosides previously known only from plants. ChemistrySelect 2016, 1, 2767–2771. [Google Scholar] [CrossRef]
- Xu, T.; Song, Z.; Hou, Y.; Liu, S.; Li, X.; Yang, Q.; Wu, S. Secondary metabolites of the genus Nigrospora from terrestrial and marine habitats: Chemical diversity and biological activity. Fitoterapia 2022, 161, 105254. [Google Scholar] [CrossRef] [PubMed]
- Zheng, T.; Zhao, L.; Huang, M.G.; Deng, J.X.; Wang, Y.H. First report of leaf spot caused by Nigrospora hainanensis on Oxalis corymbosa in China. Plant Dis. 2022, 106, 1986. [Google Scholar] [CrossRef] [PubMed]
- Arunakumar, G.S.; Gnanesh, B.N.; Supriya, M.; Sivaprasad, V. First report of Nigrospora sphaerica causing shot hole disease on mulberry in India. Plant Dis. 2019, 103, 1783–1784. [Google Scholar] [CrossRef]
- Wang, D.K.; Li, Y.C.; Sun, G.J.; Ai, Y.F.; Wang, F.L.; Wang, X.Q. First report of leaf spot disease caused by Nigrospora oryzae on Nicotiana tabacum in China. Plant Dis. 2022, 106, 2526. [Google Scholar] [CrossRef]
- Eken, C.; Spanbayev, A.; Tulegenova, Z.; Yechshzhanov, T. First report of Nigrospora oryzae on wheat in Kazakhstan. Plant Dis. 2016, 100, 861. [Google Scholar] [CrossRef]
- Luo, F.; Li, W.; Zhu, T.; Han, S.; Qiao, T.; Li, S. First report of Nigrospora aurantiaca causing leaf spot disease of Castanea mollissima in China. Plant Dis. 2020, 104, 2730–2731. [Google Scholar] [CrossRef]
- Abass, M.H.; Hameed, M.A.; Ahmed, A.N. First report of Nigrospora sphaerica (sacc.) Mason as a potential pathogen on date palm (Phoenix dactylifera l.). Can. J. Plant Pathol. 2013, 35, 75–80. [Google Scholar] [CrossRef]
- Vijayalakshmi, A.; Soundharajan, R.; Srinivasan, H. Engineered green nanoparticles interact with Nigrospora oryzae isolated from infected leaves of Arachis hypogaea. J. Basic Microbiol. 2022, 62, 1393–1401. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Yu, F.; Fu, D.; Yang, W. First report of leaf blight on peanut caused by Nigrospora sphaerica in China. J. Plant Pathol. 2020, 102, 1269. [Google Scholar] [CrossRef]
- Zhang, L.Q.; Jiang, S.; Meng, J.J.; An, H.S.; Zhang, X.Y. First report of leaf spot caused by Nigrospora oryzae on blueberry in shanghai, China. Plant Dis. 2019, 103, 2473–2474. [Google Scholar] [CrossRef]
- Wright, E.R.; Folgado, M.; Rivera, M.C.; Crelier, A.; Vasquez, P.; Lopez, S.E. Nigrospora sphaerica causing leaf spot and twig and shoot blight on blueberry: A new host of the pathogen. Plant Dis. 2008, 92, 171. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Xi, Y.; Shen, C.; Wang, M.; Wang, H. Occurrence of Nigrospora sphaerica causing leaf blight on Chrysanthemum morifolium in China. Crop Prot. 2022, 157, 105982. [Google Scholar] [CrossRef]
- Li, C.Y.; Zhang, J.J.; Zhao, C.J.; Jiang, H.W.; Ren, X.T.; Su, W.R.; Guan, J.J.; Li, Y.Z. Effects of 3-methyl-1-butanol on Seed Germination and Seedling Growth of Maize and Wheat. Bull. Bot. Res. 2018, 38, 785–789. (In Chinese) [Google Scholar]
- Bagheri, S.; Amini, J.; Ashengroph, M.; Koushesh Saba, M. Antifungal effects of volatile compounds produced by Tetrapisispora sp. Strain 111a-nl1 as a new biocontrol agent on the strawberry grey mold disease. Cell. Mol. Biol. 2022, 68, 12–23. [Google Scholar] [CrossRef]
- Zhao, Y.J.; Liu, Y.; Wang, Y.; Xing, G.F.; Wang, Y. Use of 2-Nonanol Derivative in Preparing Medicine for Inhibiting Fusarium graminearum Growth, Inhibiting Fusarium graminearum Sub Spore Germination, Inhibiting Fusarium graminearum and Preventing Wheat Scab of Fusarium graminearum. Chinese Patent CN107258783, 2019. (In Chinese). [Google Scholar]
- Liu, Y.; Zhao, Y.J.; Wang, Y.; Xing, G.F.; Wang, Y. Use of 2-Nonanone and/or 2-Nonanone Analogs and/or 2-Nonanone Derivative for Inhibiting Fusarium graminearum Growth and Spore Germination and Preparing Medicine for Production and Preventing and Controlling Wheat Scab and Biopesticide. Chinese Patent CN107258785, 2019. (In Chinese). [Google Scholar]
- Rajasekharan, S.K.; Shemesh, M. The bacillary postbiotics, including 2-undecanone, suppress the virulence of pathogenic microorganisms. Pharmaceutics 2022, 14, 962. [Google Scholar] [PubMed]
- Guo, J.X.; Zhang, Y.M.; Zhu, H.L.; Ren, L.; Zhang, B.J. Antifungal Activity of Volatile Organic Compounds from Bacillus amyloliquefaciens XJ5 and Control Effect against Monilinia fructigena. Chin. J. Biol. Control. 2020, 36, 575–580. [Google Scholar]
Loci | Primer | Sequence |
---|---|---|
ITS | ITS1 ITS4 | CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC |
TUB2 | Bt2a Bt2b | GGTAACCAAATCGGTGCTGCTTTC ACCCTCAGTGTAGTGACCCTTGGC |
TEF1-α | EF1-728F EF2 | CATCGAGAAGTTCGAGAAGG GGA(G/A)GTACCAGT(G/C)ATCATGTT |
16s rRNA | 27F 1492R | AGAGTTGATCCTGGCTCAG GTTACCTTGTTACGACTT |
Isolate | Hit Taxon | Hit Strain Name | Mannitol Fermentation | Glucose Utilization | Amylolysis | Nitrate Reduction | V-P |
---|---|---|---|---|---|---|---|
A10 | Bacillus tequilensis (99.93%) | KCTC 13622 | + | + | + | + | + |
D2 | Bacillus siamensis (99.45%) | KCTC 13613 | + | + | + | + | + |
D5 | Bacillus amyloliquefaciens (99.93%) | NBRC 15535 | − | + | + | + | + |
D22 | Bacillus amyloliquefaciens (99.93%) | MPA 1034 | + | + | + | + | + |
D31 | Bacillus amyloliquefaciens (100%) | NBRC 15535 | + | + | + | + | + |
D43 | Burkholderia gladioli (99.44%) | ATCC 10248 | + | − | − | − | − |
D65 | Bacillus siamensis (99.59%) | KCTC 13613 | − | + | + | + | + |
F5 | Pseudomonas citri (99.43%) | OPS 13-3 | + | − | − | + | − |
F17 | Pseudomonas eucalypticola (99.93%) | CCTCC M2018494 | − | − | − | − | − |
F70 | Bacillus subtilis (99.79%) | NBRC 13719 | + | + | + | + | + |
F81 | Bacillus siamensis (99.86%) | KCTC 13613 | + | + | + | + | + |
F88 | Bacillus amyloliquefaciens (100%) | NBRC 15535 | − | + | + | + | + |
Component Area | Formula | Molecular Weight (g/mol) | Compound Name | CAS Number | Match Factor |
---|---|---|---|---|---|
41,649,590 | C13H28O | 200.36 | 2-Tridecanol | 1653-31-2 | 94.94 |
33,930,144 | C4H8O2 | 88.1 | Ethyl Acetate | 141-78-6 | 92.88 |
22,758,614 | C14H22 | 190.32 | Benzene, 1,3-bis(1,1-dimethylethyl)- | 1014-60-4 | 97.49 |
20,428,923 | C11H24O | 172.31 | 2-Undecanol | 1653-30-1 | 95.38 |
16,886,839 | C14H30O | 214.39 | 2-Tetradecanol | 4706-81-4 | 91.53 |
15,412,517 | C13H26O | 198.34 | 2-Tridecanone | 593-08-8 | 96.03 |
12,362,340 | C12H26O | 186.33 | 2-Dodecanol | 10203-28-8 | 93.30 |
12,122,120 | C14H28O | 212.37 | 2-Tetradecanone | 2345-27-9 | 93.44 |
8,805,195 | C12H24O | 184.32 | 2-Dodecanone | 6175-49-1 | 94.47 |
8,767,459 | C9H20O | 144.25 | 2-Nonanol | 628-99-9 | 90.61 |
6,409,912 | C7H14O | 114.19 | 2-Heptanone | 110-43-0 | 95.02 |
5,336,527 | C11H22O | 170.29 | 2-Undecanone | 112-12-9 | 94.43 |
4,158,934 | C9H18O | 142.24 | 2-Nonanone | 821-55-6 | 92.25 |
2,147,246 | C15H30O | 226.4 | 2-Pentadecanone | 2345-28-0 | 90.64 |
1,906,840 | C5H12O | 88.15 | 1-Butanol, 3-methyl- | 123-51-3 | 92.62 |
1,713,221 | C11H24 | 156.31 | Nonane, 2,6-dimethyl- | 17302-28-2 | 94.84 |
1,312,588 | C10H12O | 148.2 | Benzaldehyde, 2,4,6-trimethyl- | 487-68-3 | 90.80 |
1,272,686 | C11H18N2 | 178.27 | Pyrazine, 2,5-dimethyl-3-(3-methylbutyl)- | 18433-98-2 | 92.33 |
1,073,632 | C13H28 | 184.36 | Undecane, 2,8-dimethyl- | 17301-25-6 | 95.28 |
856,873 | C11H24 | 156.31 | Octane, 2,4,6-trimethyl- | 62016-37-9 | 90.33 |
496,511 | C11H12O3S | 224.28 | 3-(Benzoylthio)-2-methylpropanoic acid | 67714-34-5 | 92.59 |
242,368 | C23H44O3 | 368.59 | Carbonic acid, eicosyl vinyl ester | 1000382-54-3 | 90.51 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sha, H.; Liu, X.; Xiao, X.; Zhang, H.; Gu, X.; Chen, W.; Mao, B. Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria. Microorganisms 2023, 11, 2224. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11092224
Sha H, Liu X, Xiao X, Zhang H, Gu X, Chen W, Mao B. Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria. Microorganisms. 2023; 11(9):2224. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11092224
Chicago/Turabian StyleSha, Haodong, Xinyi Liu, Xiaoe Xiao, Han Zhang, Xueting Gu, Weiliang Chen, and Bizeng Mao. 2023. "Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria" Microorganisms 11, no. 9: 2224. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms11092224