TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animal
2.3. Cell Culture and Transfection
2.4. RNA Extraction and RT-qPCR
2.5. Immunohistochemistry
2.6. Cell Viability Test
2.7. Statistical Analysis
3. Results
3.1. Effects of Different Temperatures on mRNA Levels of UPR-, TJ Protein-Related Genes, and Cell Viability
3.2. Mild Heat Treatment Increases Trpv4 mRNA Levels in HC11 Cells
3.3. TRPV4 agonist Increases β-casein and TJ Protein-Encoding mRNA Levels
3.4. Mild Heat Shock at 39 °C Increases β-casein and TJ Protein-Encoding Gene Transcript Levels via XBP1
3.5. Change in Trpv4 Expression During Mammary Gland Development
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sternlicht, M.D. Key stages in mammary gland development—The cues that regulate ductal branching morphogenesis. Breast Cancer Res. 2006, 8, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagaoka, K.; Udagawa, T.; Richter, J.D. Cpeb-mediated zo-1 mrna localization is required for epithelial tight-junction assembly and cell polarity. Nat. Commun. 2012, 3, 675. [Google Scholar] [CrossRef] [PubMed]
- Furuse, M. Molecular basis of the core structure of tight junctions. Cold Spring Harb. Perspect. Biol. 2010, 2, a002907. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.A.; Neville, M.C. Tight junction regulation in the mammary gland. J. Mammary Gland Biol. Neoplasia 1998, 3, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Chapman, P.M. Defining hormesis: Comments on calabrese and baldwin. Hum. Exp. Toxicol. 2002, 21, 99–101. [Google Scholar] [CrossRef]
- Park, H.G.; Han, S.I.; Oh, S.Y.; Kang, H.S. Cellular responses to mild heat stress. Cell Mol. Life Sci. 2005, 62, 10–23. [Google Scholar] [CrossRef]
- Kobayashi, K.; Tsugami, Y.; Matsunaga, K.; Suzuki, T.; Nishimura, T. Moderate high temperature condition induces the lactation capacity of mammary epithelial cells through control of stat3 and stat5 signaling. J. Mammary Gland Biol. Neoplasia 2018, 23, 75–88. [Google Scholar] [CrossRef]
- Mizusawa, M.; Sharmin, M.M.; Yonekura, S. Mild heat stress induces transcription of the beta-casein gene via unfolded protein response-activated xbp1 signaling in undifferentiated mammary epithelial cells. Anim. Sci. J. 2019, 90, 1026–1032. [Google Scholar] [CrossRef]
- Tominaga, M.; Caterina, M.J. Thermosensation and pain. J. Neurobiol. 2004, 61, 3–12. [Google Scholar] [CrossRef]
- Venkatachalam, K.; Montell, C. Trp channels. Annu. Rev. Biochem. 2007, 76, 387–417. [Google Scholar] [CrossRef] [Green Version]
- Ouadid-Ahidouch, H.; Dhennin-Duthille, I.; Gautier, M.; Sevestre, H.; Ahidouch, A. Trp channels: Diagnostic markers and therapeutic targets for breast cancer? Trends Mol. Med. 2013, 19, 117–124. [Google Scholar] [CrossRef]
- Reiter, B.; Kraft, R.; Gunzel, D.; Zeissig, S.; Schulzke, J.D.; Fromm, M.; Harteneck, C. Trpv4-mediated regulation of epithelial permeability. FASEB J. 2006, 20, 1802–1812. [Google Scholar] [CrossRef]
- Guler, A.D.; Lee, H.; Iida, T.; Shimizu, I.; Tominaga, M.; Caterina, M. Heat-evoked activation of the ion channel, trpv4. J. Neurosci. 2002, 22, 6408–6414. [Google Scholar] [CrossRef]
- Xu, X.; Gupta, S.; Hu, W.; McGrath, B.C.; Cavener, D.R. Hyperthermia induces the er stress pathway. PLoS ONE 2011, 6, e23740. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Park, S.J.; Kim, T.S.; Park, H.J.; Park, J.; Kim, B.K.; Kim, G.R.; Kim, J.M.; Huang, S.M.; Chae, J.I.; et al. Testicular hyperthermia induces unfolded protein response signaling activation in spermatocyte. Biochem. Biophys. Res. Commun. 2013, 434, 861–866. [Google Scholar] [CrossRef]
- Patil, C.; Walter, P. Intracellular signaling from the endoplasmic reticulum to the nucleus: The unfolded protein response in yeast and mammals. Curr. Opin. Cell Biol. 2001, 13, 349–355. [Google Scholar] [CrossRef]
- Ron, D. Translational control in the endoplasmic reticulum stress response. J. Clin. Investig. 2002, 110, 1383–1388. [Google Scholar] [CrossRef]
- Calfon, M.; Zeng, H.; Urano, F.; Till, J.H.; Hubbard, S.R.; Harding, H.P.; Clark, S.G.; Ron, D. Ire1 couples endoplasmic reticulum load to secretory capacity by processing the xbp-1 mrna. Nature 2002, 415, 92–96. [Google Scholar] [CrossRef]
- Tsuchiya, M.; Koizumi, Y.; Hayashi, S.; Hanaoka, M.; Tokutake, Y.; Yonekura, S. The role of unfolded protein response in differentiation of mammary epithelial cells. Biochem. Biophys. Res. Commun. 2017, 484, 903–908. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, H.; Vriens, J.; Suh, S.H.; Benham, C.D.; Droogmans, G.; Nilius, B. Heat-evoked activation of trpv4 channels in a hek293 cell expression system and in native mouse aorta endothelial cells. J. Biol. Chem. 2002, 277, 47044–47051. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, M.K.; Lee, H.; Caterina, M.J. Warm temperatures activate trpv4 in mouse 308 keratinocytes. J. Biol. Chem. 2003, 278, 32037–32046. [Google Scholar] [CrossRef] [Green Version]
- Akazawa, Y.; Yuki, T.; Yoshida, H.; Sugiyama, Y.; Inoue, S. Activation of trpv4 strengthens the tight-junction barrier in human epidermal keratinocytes. Ski. Pharm. Physiol. 2013, 26, 15–21. [Google Scholar] [CrossRef]
- Martinez-Rendon, J.; Sanchez-Guzman, E.; Rueda, A.; Gonzalez, J.; Gulias-Canizo, R.; Aquino-Jarquin, G.; Castro-Munozledo, F.; Garcia-Villegas, R. Trpv4 regulates tight junctions and affects differentiation in a cell culture model of the corneal epithelium. J. Cell Physiol. 2017, 232, 1794–1807. [Google Scholar] [CrossRef]
- Darby, W.G.; Grace, M.S.; Baratchi, S.; McIntyre, P. Modulation of trpv4 by diverse mechanisms. Int. J. Biochem. Cell Biol. 2016, 78, 217–228. [Google Scholar] [CrossRef]
- Thorneloe, K.S.; Sulpizio, A.C.; Lin, Z.; Figueroa, D.J.; Clouse, A.K.; McCafferty, G.P.; Chendrimada, T.P.; Lashinger, E.S.; Gordon, E.; Evans, L.; et al. N-((1s)-1-{[4-((2s)-2-{[(2,4-dichlorophenyl)sulfonyl]amino}-3-hydroxypropanoyl)-1-piperazinyl]carbonyl}-3-methylbutyl)-1-benzothiophene-2-carboxamide (gsk1016790a), a novel and potent transient receptor potential vanilloid 4 channel agonist induces urinary bladder contraction and hyperactivity: Part i. J. Pharm. Exp. 2008, 326, 432–442. [Google Scholar]
- Alexander, R.; Kerby, A.; Aubdool, A.A.; Power, A.R.; Grover, S.; Gentry, C.; Grant, A.D. 4alpha-phorbol 12,13-didecanoate activates cultured mouse dorsal root ganglia neurons independently of trpv4. Br. J. Pharm. 2013, 168, 761–772. [Google Scholar] [CrossRef] [Green Version]
- White, J.P.; Cibelli, M.; Urban, L.; Nilius, B.; McGeown, J.G.; Nagy, I. Trpv4: Molecular conductor of a diverse orchestra. Physiol. Rev. 2016, 96, 911–973. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Elias, A.; Mrkonjic, S.; Jung, C.; Pardo-Pastor, C.; Vicente, R.; Valverde, M.A. The trpv4 channel. Handb. Exp. Pharm. 2014, 222, 293–319. [Google Scholar]
- Jung, C.; Fandos, C.; Lorenzo, I.M.; Plata, C.; Fernandes, J.; Gene, G.G.; Vazquez, E.; Valverde, M.A. The progesterone receptor regulates the expression of trpv4 channel. Pflügers Arch. Eur. J. Physiol. 2009, 459, 105–113. [Google Scholar] [CrossRef] [PubMed]
- Celli, A.; Mackenzie, D.S.; Crumrine, D.S.; Tu, C.L.; Hupe, M.; Bikle, D.D.; Elias, P.M.; Mauro, T.M. Endoplasmic reticulum ca2+ depletion activates xbp1 and controls terminal differentiation in keratinocytes and epidermis. Br. J. Dermatol. 2011, 164, 16–25. [Google Scholar] [CrossRef] [Green Version]
- Shen, J.; Tu, L.; Chen, D.; Tan, T.; Wang, Y.; Wang, S. Trpv4 channels stimulate ca(2+)-induced ca(2+) release in mouse neurons and trigger endoplasmic reticulum stress after intracerebral hemorrhage. Brain Res. Bull. 2019, 146, 143–152. [Google Scholar] [CrossRef]
- Ma, J.H.; Wang, J.J.; Li, J.; Pfeffer, B.A.; Zhong, Y.; Zhang, S.X. The role of ire-xbp1 pathway in regulation of retinal pigment epithelium tight junctions. Investig. Ophthalmol. Vis. Sci. 2016, 57, 5244–5252. [Google Scholar] [CrossRef] [Green Version]
- Urra, H.; Dufey, E.; Lisbona, F.; Rojas-Rivera, D.; Hetz, C. When er stress reaches a dead end. Biochim. Biophys. Acta 2013, 1833, 3507–3517. [Google Scholar] [CrossRef] [Green Version]
- Harding, H.P.; Novoa, I.; Zhang, Y.; Zeng, H.; Wek, R.; Schapira, M.; Ron, D. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell 2000, 6, 1099–1108. [Google Scholar] [CrossRef]
- Sakaguchi, Y.; Stephens, L.C.; Makino, M.; Kaneko, T.; Strebel, F.R.; Danhauser, L.L.; Jenkins, G.N.; Bull, J.M. Apoptosis in tumors and normal tissues induced by whole body hyperthermia in rats. Cancer Res. 1995, 55, 5459–5464. [Google Scholar]
- Berman, A.; Folman, Y.; Kaim, M.; Mamen, M.; Herz, Z.; Wolfenson, D.; Arieli, A.; Graber, Y. Upper critical temperatures and forced ventilation effects for high-yielding dairy cows in a subtropical climate. J. Dairy Sci. 1985, 68, 1488–1495. [Google Scholar] [CrossRef]
- Capuco, A.V.; Ellis, S.E.; Hale, S.A.; Long, E.; Erdman, R.A.; Zhao, X.; Paape, M.J. Lactation persistency: Insights from mammary cell proliferation studies. J. Anim. Sci. 2003, 81, 18–31. [Google Scholar] [CrossRef] [Green Version]
- Capuco, A.V.; Wood, D.L.; Baldwin, R.; McLeod, K.; Paape, M.J. Mammary cell number, proliferation, and apoptosis during a bovine lactation: Relation to milk production and effect of bst. J. Dairy Sci. 2001, 84, 2177–2187. [Google Scholar] [CrossRef]
- Knight, C.H.; Docherty, A.H.; Peaker, M. Milk yield in rats in relation to activity and size of the mammary secretory cell population. J. Dairy Res. 1984, 51, 29–35. [Google Scholar] [CrossRef]
- Yonekura, S.; Tsuchiya, M.; Tokutake, Y.; Mizusawa, M.; Nakano, M.; Miyaji, M.; Ishizaki, H.; Haga, S. The unfolded protein response is involved in both differentiation and apoptosis of bovine mammary epithelial cells. J. Dairy Sci. 2018, 101, 3568–3578. [Google Scholar] [CrossRef] [Green Version]
- Butcher, D.T.; Alliston, T.; Weaver, V.M. A tense situation: Forcing tumour progression. Nat. Rev. Cancer 2009, 9, 108–122. [Google Scholar] [CrossRef]
- Gehler, S.; Baldassarre, M.; Lad, Y.; Leight, J.L.; Wozniak, M.A.; Riching, K.M.; Eliceiri, K.W.; Weaver, V.M.; Calderwood, D.A.; Keely, P.J. Filamin a-beta1 integrin complex tunes epithelial cell response to matrix tension. Mol. Biol. Cell 2009, 20, 3224–3238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clapham, D.E. Trp channels as cellular sensors. Nature 2003, 426, 517–524. [Google Scholar] [CrossRef]
- Thodeti, C.K.; Matthews, B.; Ravi, A.; Mammoto, A.; Ghosh, K.; Bracha, A.L.; Ingber, D.E. Trpv4 channels mediate cyclic strain-induced endothelial cell reorientation through integrin-to-integrin signaling. Circ. Res. 2009, 104, 1123–1130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baumgartner, H.K.; Rudolph, M.C.; Ramanathan, P.; Burns, V.; Webb, P.; Bitler, B.G.; Stein, T.; Kobayashi, K.; Neville, M.C. Developmental expression of claudins in the mammary gland. J. Mammary Gland Biol. Neoplasia 2017, 22, 141–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primers (5′ to 3′) |
---|---|
Zo-1 | Forward GGGAGGGTCAAATGAAGACA Reverse GGCATTCCTGCTGGTTACAT |
Cldn3 | Forward AGCCAGTCTCCAAAGCCACA Reverse CTGGGAATCAACTGCCCTTC |
Ocln | Forward CGGACCCTGACCACTATGAAA Reverse CCTGCAGACCTGCATCAAAA |
Trpv4 | Forward ATGGCAGATCCTGGTGATGG Reverse GGAACTTCATACGCAGGTTTGG |
β-casein | Forward GATGCCCCTCCTTAACTCTGAA Reverse TTAGCAAGACTGGCAAGGCTG |
Xbp1s | Forward TGAGAACCAGGAGTTAAGAACACGC Reverse CCTGCACCTGCTGCGGAC |
Ire1α | Forward ACGAAGGCCTGACGAAACTT Reverse ATCTGAACTTCGGCATGGGG |
Atf4 | Forward GAGCTTCCTGAACAGCGAAGTG Reverse TGGCCACCTCCAGATAGTCATC |
Chop | Forward CCTAGCTTGGCTGACAGAGG Reverse CTGCTCCTTCTCCTTCATGC |
Atf6α | Forward CTTCCTCCAGTTGCTCCATC Reverse CAACTCCTCAGGAACGTGCT |
Grp78 | Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG |
Gapdh | Forward TTGTGATGGGTGTGAACCACGAG Reverse CATGAGCCCTTCCACAATGCCAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.A.; Mizusawa, M.; Sharmin, M.M.; Hayashi, S.; Yonekura, S. TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells. Animals 2020, 10, 1174. https://0-doi-org.brum.beds.ac.uk/10.3390/ani10071174
Islam MA, Mizusawa M, Sharmin MM, Hayashi S, Yonekura S. TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells. Animals. 2020; 10(7):1174. https://0-doi-org.brum.beds.ac.uk/10.3390/ani10071174
Chicago/Turabian StyleIslam, Md Aminul, Moeko Mizusawa, Mst Mamuna Sharmin, Satoko Hayashi, and Shinichi Yonekura. 2020. "TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells" Animals 10, no. 7: 1174. https://0-doi-org.brum.beds.ac.uk/10.3390/ani10071174