Next Article in Journal
Effect of Soybean Oil Supplementation on Milk Production, Digestibility, and Metabolism in Dairy Goats under Thermoneutral and Heat Stress Conditions
Next Article in Special Issue
Estimation of Additive and Dominance Genetic Effects on Body Weight, Carcass and Ham Quality Traits in Heavy Pigs
Previous Article in Journal
Antimicrobial Use in Companion Animals: Assessing Veterinarians’ Prescription Patterns through the First National Survey in Chile
Previous Article in Special Issue
Sicilian Black Pig: An Overview
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 11
Issue 2
10.3390/ani11020349
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection

by
Xiaoyang Yang
1,2,
Fei Xing
1,2,
Li Wang
1,
Weimin Zhao
1,
Yanfeng Fu
1,
Feng Tu
1,
Bixia Li
1,
Xiaomin Fang
3,* and
Shouwen Ren
1,*
1
Institute of Animal Science, Jiangsu Academy of Agricultural Sciences/Jiangsu Germplasm Resources Protection and Utilization Platform, Nanjing 210014, China
2
College of Animal Science & Technology, Nanjing Agricultural University, Nanjing 210095, China
3
Institute of Food Safety and Nutrition, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
*
Authors to whom correspondence should be addressed.
Animals 2021, 11(2), 349; https://0-doi-org.brum.beds.ac.uk/10.3390/ani11020349
Submission received: 18 January 2021 / Revised: 21 January 2021 / Accepted: 28 January 2021 / Published: 30 January 2021
(This article belongs to the Special Issue Pig Genetics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

In the currently intense production process, infection of swine with Mycoplasma pneumonia is common in pig farms around the world, and reduction in the feeding efficiency and the growth rate of sick pigs causes considerable economic losses to the pig-rearing industry. Our study aimed to determine the molecular mechanism by which Mycoplasma hyopneumoniae induces inflammation in pigs. Our study showed that Mycoplasma hyopneumoniae can regulate the expression of CYP3A29 by upregulating PXR during the inflammatory response induced in porcine alveolar macrophages. These findings may provide useful information for breeding pigs that are resistant to disease.

Abstract

Mycoplasma hyopneumoniae (M. hyopneumoniae, Mhp) is the causative agent of mycoplasma pneumonia of swine (MPS). M. hyopneumoniae infection causes inflammation in pigs and leads to considerable economic losses in the pig industry. Pregnane X receptor (PXR) is a pluripotent gene regulatory protein that plays an important role in regulating cytochrome P-450 (CYP) in pigs in the context of inflammatory responses, drug metabolism, homeostasis, etc. We previously reported that cytochrome P450 3A29 (CYP3A29) expression was significantly upregulated in pigs infected with M. hyopneumoniae compared with healthy control pigs. This experiment mainly focused on identifying the role of PXR in the regulation of CYP3A29 and inflammatory factors after M. hyopneumoniae infection by establishing pig alveolar macrophage (PAM) cells in which PXR was overexpressed or silenced. Our results showed that the overexpression of PXR could significantly improve the protein and the mRNA expression levels of CYP3A29 with and without M. hyopneumoniae infection in PAM cells. After the expression of PXR was inhibited, protein and mRNA expression levels of CYP3A29 were significantly reduced with and without M. hyopneumoniae infection in PAM cells. Moreover, PXR can regulate the mRNA expression levels of IL-6 and IL-8 during M. hyopneumoniae infection of PAM cells. In conclusion, these results suggest that PXR positively regulates CYP3A29 expression during the inflammatory response caused by M. hyopneumoniae infection.

1. Introduction

Mycoplasma pneumonia of swine, commonly known as swine asthma, is a chronic respiratory infection in pigs that is caused by M. hyopneumoniae and spreads due to close contact with infected individuals [1]. Sick pigs exhibit slow growth and low feed conversion rates and require high use of antibiotics. M. hyopneumoniae is an important pathogen that causes great economic losses in the pig industry [2,3]. In recent years, research has focused primarily on the epidemiology and the transmission of this disease and has partially elucidated the interaction between the pathogen and the respiratory tract, and many vaccines have been developed [4]. However, research on the virulence mechanisms and the pathogen–host interactions of M. hyopneumoniae is still relatively limited [4]. In particular, the mechanisms by which the host inflammatory response is regulated and immunosuppression is induced have not been fully elucidated. Studying the molecular mechanism by which M. hyopneumoniae causes inflammation in pigs is of great significance for the breeding of M. hyopneumoniae-resistant pigs.
The porcine CYP3A29 gene, located on chromosome 3, P16–17, 11 [5], encodes an important metabolic enzyme in the cytochrome P450 superfamily. The mechanism by which CYP3A29 is regulated in pigs is similar to the mechanism by which CYP3A4 is regulated in humans [6]. Regarding the relationship between porcine CYP3A29 and the inflammatory response, studies have shown that the isoenzyme CYP3A4 participates in the body’s inflammatory response [7,8]. Our previous research used Meishan pigs and Changbai pigs infected with M. hyopneumoniae as experimental models, and the results of the expression spectrum microarray screening led to the selection of CYP3A29 as a candidate gene associated with the response to this infection [9]. It was also found that PXR expression increased during M. hyopneumoniae infection. Pregnane X receptor (PXR), a member of the nuclear receptor (NR) family 1 subfamily, also known as NR1I2, is an important regulatory factor in the body and plays an important role in regulating drug metabolism [10,11]. Through ligand binding [12,13], PXR plays an important role in the inflammatory response. PXR is important for IFN-mediated upregulation of CYP3A29 expression in pig hepatocytes [14,15]. Therefore, we wanted to determine whether PXR regulates the expression of CYP3A29 during M. hyopneumoniae infection in pigs.
The purpose of this study was to elucidate the regulatory effect of PXR on CYP3A29 expression during M. hyopneumoniae infection. To this end, we prepared porcine alveolar macrophage cells, which play an important role in the pulmonary inflammatory response caused by M. hyopneumoniae [16]. Overexpression and silencing of PXR in PAM cells before and after M. hyopneumoniae infection, which were confirmed by real-time quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, indicated that PXR can upregulate the expression of CYP3A29 during the inflammatory response caused by M. hyopneumoniae infection.

2. Materials and Methods

2.1. Test Materials and Reagents

The porcine alveolar macrophage cell line 3D4/21 (ATCC CRL-2843) [17] and M. hyopneumoniae strain JS were kind gifts from the Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, China; antibiotics (streptomycin and penicillin), fetal bovine serum, trypsin, glutamine, fetal rat serum (FBS), and roswell park memorial institute (RPMI)-1640 medium + 25 mM N-piperazine-N’-[2-ethanesufonic acid] (HEPES) were purchased from Gibco (Grand Island, NY, USA). CYP3A29 and β-Actin monoclonal antibodies were purchased from Proteintech Group, Inc. (Chicago, IL, USA). Monoclonal antibodies against PXR were purchased from Sigma-Aldrich (St. Louis, MO, USA). All the other chemicals were of analytical grade.

2.2. Cell Culture

PAM 3D4/21 cell lines were cultured in RPMI-1640 medium containing 10% fetal bovine serum, 100 U/mL penicillin, 100 U/mL streptomycin, 25 mM HEPES, and 1% glutamine at 37 °C with 5% CO2.

2.3. Construction of the Overexpression Vector and Design of Interference Fragments

PXR coding sequence (CDS) were amplified from PAM 3D4/21 cell cDNA and were then ligated into the pMD 18-T vector (Takara, Otsu, Shiga, Japan) using EcoR I and Sal I double-enzyme digestion. The target fragment was inserted into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) to generate pcDNA3.1-PXR using the same double-enzyme digestion. The sequence of the PXR siRNA (PXR-SUS-992) was synthetized by GenePharma. The sequence was GCAUUAUCAACUUUGCCAATTUUGGCAAAGUUGAUAAUGCTT.

2.4. Transfection

Cells transfected with the pcDNA3.1-PXR plasmid were used as the experimental group, and cells transfected with the empty pcDNA3.1 vector were used as the negative control group. The cells were transfected with LipofectamineTM 3000 (Invitrogen, Carlsbad, CA, USA) using 2.5 g plasmid per well for 36 h when the cell density reached 60%. RPMI- 1640 medium containing 10% fetal bovine serum was used in the transfection process. In the interference experiment, the same method was used to transfect the porcine PXR interfering fragment siRNA.

2.5. M. hyopneumoniae Infection of PAM 3D4/21 Cells

Infection was carried out in a 6-well plate at a density of 2 × 105 cells/well. Two milliliters of 106 CCU/mL M. hyopneumoniae strain J was added to each well of the infected group, and 2 mL of RPMI 1640 medium containing 10% fetal bovine serum was added to each well of the control group. The M. hyopneumoniae cultures were centrifuged at 12,000× g for 20 min, washed with sterile phosphate buffered saline (PBS) twice, and resuspended with antibiotic-free RPMI 1640 medium, and samples were collected 24 h after infection [18]. Infection was confirmed by PCR amplification of the P36 gene, which encodes a membrane protein of M. hyopneumoniae, as previously described [19].

2.6. Real-Time Fluorescence Quantitative PCR

Total RNA was extracted from PAM 3D4/21 cells using the HP Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the instructions. The total RNA concentration was measured by a spectrophotometer. The PrimeScriptTM RT reagent Kit (Takara, Otsu, Shiga, Japan) was used for reverse transcription. qPCR was conducted on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex TaqTM (Tli RNaseH Plus) (Takara, Otsu, Shiga, Japan). The total amplification reaction system contained 20 μL, and the amplification was carried out at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. HPRT1 was used as the internal reference. Primer sequences are shown in Table 1.

2.7. Western Blot

The total protein was extracted by radio immunoprecipitation assay (RIPA) buffer, and the sample concentration was determined by a bicinchoninic acid (BCA) protein assay (Pierce, Thermo Scientific, Waltham, MA, USA). The supernatant was absorbed, mixed with 5× SDS, and denatured at 99 °C for 10 min. SDS-PAGE was performed by adding 30 μg of protein per well to a 10% gel and then transferring the protein to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% bovine serum albumin (BSA) in 0.1% Tween 20 for 2 h. Then, a rabbit anti-PXR antibody (1:500 dilution) and a mouse anti-pig CYP3A29 antibody (1:1000 dilution) were prepared by diluting the antibodies in 5% BSA; then, the diluted antibodies were incubated with the membranes in the refrigerator at 4 °C overnight. Then, the membranes were washed 3 to 4 times with tris buffered saline tween (TBST), and diluted goat anti-rabbit and goat anti-mouse (1:1000 dilution) antibodies were prepared as secondary antibodies. The membranes were incubated at room temperature for 2 h and washed with TBST. The bands were visualized and quantified with the Clarity Western ECL Substrate (Bio-Rad, Hercules, CA, USA) and quantified by a DNR Bio Imaging System (DNR Industries, Anaheim, CA, USA).

2.8. Enzyme-Linked Immunosorbent Assay ELISA

Porcine IL-6 ELISA Kit (Absin, Shanghai, China) and Porcine IL-8 ELISA Kit (Jingmei, Yancheng, Jangsu, China) were used to detect the protein expression of IL-6 and IL-8 in the cell culture supernatant of the PAM 3D4/21 cells, respectively.

2.9. Statistical Analysis

This experiment used the 2−△△Ct method to analyze the data, and HPRT1 was used as the reference gene. GraphPad Prism was used to generate the graphs and conduct the analyses, and a t-test was performed. p < 0.05 is indicated by *; p < 0.01 is indicated by **; p < 0.001 is indicated by ***; and NS indicates no significant difference. Image J was used to detect the gray values of the western blot bands so that the data could be quantitatively analyzed.

3. Results

3.1. M. hyopneumoniae Infection Promoted the Expression of IL-6 and IL-8 in PAM 3D4/21 Cells

To evaluate the effect of M. hyopneumoniae infection on PAM 3D4/21 cells, the expression of P36 in PAM 3D4/21 cells was detected (Figure 1A) after stimulation with 100 multiplicity of infection (MOI) M. hyopneumoniae for 24 h [20]. Infection was confirmed by PCR amplification of the P36 gene [19]. P36 is an immunodominant protein encoded by the genome of M. hyopneumoniae, and p36 proteins have been shown to be specific for M. hyopneumoniae [21]. A single 427-bp band of P36 was detected by agarose gel electrophoresis, indicating that M. hyopneumoniae had successfully infected the PAM 3D4/21 cells. Therefore, infection with 100 MOI M. hyopneumoniae for 24 h was used in the subsequent experiments.
We then examined the effect of M. hyopneumoniae infection on the expression of IL-6 and IL-8. The results showed that the mRNA expression of IL-6 (Figure 1B) and IL-8 (Figure 1C) significantly increased after M. hyopneumoniae infection. This result indicates an inflammatory response in M. hyopneumoniae-infected PAM 3D4/21 cells.

3.2. M. hyopneumoniae Infection Increased the Expression of CYP3A29 and PXR in PAM 3D4/21 Cells

To investigate whether the expression of CYP3A29 and PXR was altered in response to M. hyopneumoniae infection, we detected mRNA and protein expression levels of PXR and CYP3A29. The results showed that the mRNA levels of both PXR (Figure 2A) and CYP3A29 (Figure 2B) significantly increased after M. hyopneumoniae infection for 24 h. The protein expression of PXR and CYP3A29 was also upregulated (Figure 2C,D).

3.3. PXR Regulates the Expression of CYP3A29 during M. hyopneumoniae Infection of PAM 3D4/21 Cells

3.3.1. Identification and Validation of the pcDNA3.1-PXR Recombinant Plasmid and Efficiency of PXR Overexpression and Interference

The PXR recombinant plasmids were identified by restriction analysis and sequencing. Analysis of two fragments released from the recombinant plasmids by digestion with homologous restriction enzymes (EcoR I and Sal I) revealed that the PXR gene was correctly inserted. The clone was further confirmed by sequencing.
The efficiency of PXR overexpression and silencing was analyzed by assessing the expression of PXR mRNA and protein. The PXR mRNA and protein levels in PAM 3D4/21 cells were significantly increased after transfection with the pcDNA3.1-PXR recombinant plasmid for 36 h (Figure 3A,B). However, the PXR mRNA and protein levels in PAM 3D4/21 cells were significantly decreased after transfection with PXR-SUS-992 for 36 h (Figure 3C,D).

3.3.2. PXR can Promote CYP3A29 Expression during M. hyopneumoniae Infection

To further explore whether PXR regulates the expression of CYP3A29 during M. hyopneumoniae infection, mRNA and protein expression of PXR and CYP3A29 were analyzed by qPCR and western blot. The results showed that the overexpression of PXR in normal PAM 3D4/21 cells significantly increased mRNA (Figure 4A) and protein (Figure 4B) levels of CYP3A29. PXR was overexpressed in PAM 3D4/21 cells infected with M. hyopneumoniae, and mRNA (Figure 4C) and protein (Figure 4D) levels of CYP3A29 showed the same trend. When compared Figure 4A,B with Figure 4C,D, it was found that the promotion effect of overexpression of PXR on CYP3A29 with M. hyopneumoniae was lower than that without M. hyopneumoniae infection. However, silencing of PXR in normal PAM 3D4/21 cells significantly decreased mRNA (Figure 5A) and protein (Figure 5B) levels of CYP3A29. After transfection of PXR-sus-992 into PAM 3D4/21 cells infected with M. hyopneumoniae, mRNA (Figure 5C) and protein (Figure 5D) levels of CYP3A29 were also significantly reduced. Comparing Figure 5A,B with Figure 5C,D, it was found that the inhibiting effect of silencing of PXR on CYP3A29 with M. hyopneumoniae was higher than that without M. hyopneumoniae infection. It shows that CYP3A29 further increased after M. hyopneumoniae infection.

3.4. PXR can Promote the Expression of IL-6 and IL-8 during M. hyopneumoniae Infection

Our previous research showed that M. hyopneumoniae infection increased the expression of PXR, IL-6, and IL-8. To prove whether PXR could affect the expression of IL-6 and IL-8 during M. hyopneumoniae infection, we detected the expression of IL-6 and IL-8 after the overexpression or silencing of PXR. The results showed that the overexpression of PXR without M. hyopneumoniae infection significantly increased the mRNA levels of IL-6 and IL-8 (Figure 6A). The silencing of PXR without M. hyopneumoniae infection decreased the mRNA levels of both IL-6 and IL-8 (Figure 6B). Moreover, the overexpression of PXR with M. hyopneumoniae infection significantly increased the mRNA levels of IL-6 and IL-8 (Figure 6C). The silencing of PXR with M. hyopneumoniae infection decreased the mRNA levels of IL-6 and IL-8 (Figure 6D).
Subsequently, we used ELISA to detect the protein expression of IL-6 and IL-8 in the cell culture supernatant of the PAM 3D4/21 cells. The results showed that the overexpression of PXR without M. hyopneumoniae infection increased the protein expression of IL-8, but the protein expression of IL-6 did not change significantly (Figure 7A). The silencing of PXR without M. hyopneumoniae infection decreased the protein expression of IL-6 and IL-8 (Figure 7B). Moreover, the overexpression of PXR with M. hyopneumoniae infection increased the protein expression of IL-8, but the protein expression of IL-6 did not change significantly (Figure 7C). The silencing of PXR with M. hyopneumoniae infection decreased the protein expression of IL-6 and IL-8 (Figure 7D).

4. Discussion

Although mycoplasma pneumonia of swine (MPS) is a serious threat to pig production, the mechanism by which the inflammatory response to M. hyopneumoniae is regulated is rarely studied. It was reported that M. hyopneumoniae infection could cause inflammation in live pigs [22] and induce the secretion of IL-6 and IL-8 from PAM 3D4/21 cells [23], which is consistent with our research. In our study, CYP3A29 and PXR were upregulated after M. hyopneumoniae infection in PAM 3D4/21 cells. CYP3A29, an important cytochrome P450 (CYP) enzyme, is one of the key candidate genes involved in the regulation of inflammation induced by M. hyopneumoniae infection [9]. However, it was not clear how M. hyopneumoniae regulates CYP3A29-induced inflammation. It is well known that the activation of nuclear receptors can increase the expression and the activity of CYPs [24]. PXR is the major transcriptional regulator of cytochrome P450 [13], and it mediates responses to various xenobiotics and endogenous chemicals [25]. Studies have found that PXR can positively regulate the interferon-mediated expression of CYP3A29 in pig hepatocytes [14,15], and cecropin B inhibits the expression of CYP3A29 by regulating RXR-α and PXR in pig liver cells [26]. It is speculated that PXR may regulate the expression of CYP3A29 during mycoplasma infection. In our study, the overexpression and the silencing of PXR increased and decreased the expression of CYP3A29 in normal PAM 3D4/21 cells, respectively. In addition, M. hyopneumoniae-infected normal PAM 3D4/21 cells significantly increased gene and protein expression levels of CYP3A29, while the silencing of PXR decreased the expression of CYP3A29, and the overexpression of PXR increased the expression of CYP3A29. Our study is consistent with previous studies, and based on the pathogen infection pattern, our study validated that PXR could upregulate the expression of CYP3A29 during M. hyopneumoniae infection in PAM cells.
In our study, we also found that PXR can regulate the mRNA expression of IL-6 and IL-8. The silencing of PXR in PAM 3D4/21 cells can reduce the mRNA expression of IL-6 and IL-8. When PAM 3D4/21 cells were infected with M. hyopneumoniae, the mRNA expression levels of IL-6 and IL-8 increased, while the mRNA expression levels of IL-6 and IL-8 decreased after PXR silencing. In addition, the mRNA expression levels of IL-6 and IL-8 increased after the overexpression of PXR. Previous studies using atrazine to treat quail hearts found that CYP3A4 expression induced by the PXR/CAR pathway and NF-κB pathway upregulates IL-6 and IL-8 expression [27]. IL-6 can upregulate the expression of CYP2C33 through CAR/RXRα heterodimers in primary porcine hepatocytes [28]. IL-6 is an important proinflammatory cytokine that has been shown to affect CYP450 expression in humans [29]. Because there are many members of the CYP450 family, their biological functions may be different. The expression of CYP3A29 varies among different tissues and ages and is influenced by various factors, such as drugs and inflammatory stimuli [30,31,32]. The role of PXR in pigs may be more complex, and PXR may react differently to ligands in human and other animal models than it does in pigs [33,34]. For instance, our previous study suggested that CYP1A1 can inhibit the inflammatory response caused by M. hyopneumoniae infection through the PPAR-γ signaling pathway in PAM cells [23]. Therefore, our results suggest that, during the inflammatory response to M. hyopneumoniae infection in pigs, PXR may regulate the expression of the proinflammatory cytokines IL-6 and IL-8 by regulating the expression of CYP3A29.
In the cell culture supernatant of the PAM 3D4/21 cells, the protein expression of IL-8 showed the same trend as the mRNA expression. These results indicate that PXR does have a regulatory effect on IL-8 during M. hyopneumoniae infection. The protein expression of IL-6 did not change significantly in the overexpression of PXR with and without M. hyopneumoniae infection. The protein expression of IL-6 was down-regulated after PXR silencing with and without M. hyopneumoniae infection. These results suggested that PXR overexpression had a higher regulation effect on IL-6 at mRNA level than at protein level in PAM cells. Moreover, during the inflammatory response caused by M. hyopneumoniae infection, the expression of inflammatory factors may also have other regulatory effects on molecular pathways. Studies have reported that many pathways are involved in regulating the expression of inflammatory cytokines mediated by mycoplasmal lipopeptide Pam2CGDPKHPKSF (FSL-1) in pig monocyte-derived macrophages (MDMs); these pathways include the TNF signaling pathway, the cytokine–cytokine receptor interaction pathway, the Toll-like receptor signaling pathway, the janus kinase-signal transducer and activator of transcription (JAK-STAT) signaling pathway, the chemokine signaling pathway, the nucleotide oligomerization domain (NOD)-like receptor signaling pathway, and the NF-κB signaling pathway [35]. Furthermore, previous reports have shown that activated PXR inhibits the activity of NF-κB and the expression of the NF-κB target gene IL-6 [36]. The nuclear factor NF-κB family is a key regulator of inflammatory, innate immune, and adaptive immune responses [37,38]. Therefore, the expression of the proinflammatory cytokines IL-6 and IL-8 may be regulated by multiple pathways. The relationship between cytochrome P450 enzymes and inflammation should be further studied and will be helpful for the treatment of inflammation. Future studies should investigate the relationship between the NF-κB pathway and PXR during the inflammatory response to M. hyopneumoniae infection. Further elucidation of the molecular mechanism by which mycoplasma causes inflammation in the body is necessary.

5. Conclusions

In conclusion, our study found that PXR regulates the expression of CYP3A29 during the course of M. hyopneumoniae infection and inflammatory response through inflammatory factors IL-6 and IL-8. This study provides a theoretical molecular basis for the treatment of MPS and for the breeding of pigs resistant to this disease.

Author Contributions

Conceptualization, X.F. and X.Y.; Data curation, X.Y., F.X., W.Z. and L.W.; Formal analysis, X.Y., F.X. and X.F.; Funding acquisition, X.Y., X.F., L.W. and W.Z.; Investigation, X.Y., F.X., W.Z. and X.F.; Methodology, X.Y., F.X., Y.F. and F.T.; Supervision, S.R. and B.L.; writing—original draft, X.Y.; writing—review and editing, X.Y. and X.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31872338), the National Modern Porcine Industrial-Technology System (CARS-35), Jiangsu Agricultural Major New Breed Creation Project (PZCZ201733), and Jiangsu Modern porcine Industrial Technology System- Funing Promotion and Demonstration Base (JATS[2020]224)

Institutional Review Board Statement

Our experiments were carried out in cell lines. The Institutional Animal Ethics Committee approved this study in accordance with the national guidelines.

Informed Consent Statement

This study not involving humans.

Data Availability Statement

Data supporting the results of this study shall, upon appropriate request, be available from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pieters, M.G.; Maes, D. Diseases of Swine. In Mycoplasmosis, 11th ed.; Zimmerman, J., Karriker, L., Eds.; Wiley: Hoboken, NJ, USA, 2019; Volume 56, pp. 863–883. [Google Scholar]
  2. Silva, G.S.; Yeske, P.; Morrison, R.B.; Linhares, D.C.L. Benefit-cost analysis to estimate the payback time and the economic value of two Mycoplasma hyopneumoniae elimination methods in breeding herds. Prev. Vet. Med. 2019, 168, 95–102. [Google Scholar] [CrossRef] [PubMed]
  3. Holst, S.; Yeske, P.; Pieters, M. Elimination of Mycoplasma hyopneumoniae from breed-to-wean farms: A review of current protocols with emphasis on herd closure and medication. J. Swine Health Prod. 2015, 23, 321–330. [Google Scholar]
  4. Maes, D.; Sibila, M.; Kuhnert, P.; Vergara-Alert, J.; Haesebrouck, F.; Pieters, M. Update onMycoplasma hyopneumoniaeinfections in pigs: Knowledge gaps for improved disease control. Transbound. Emerg. Dis. 2017, 65, 110–124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Nissen, P.H.; Winterø, A.K.; Fredholm, M. Mapping of porcine genes belonging to two different cytochrome P450 subfamilies. Anim. Genet. 1998, 29, 7–11. [Google Scholar] [CrossRef] [PubMed]
  6. He, Y.; Zhou, X.; Li, X.; Jin, X.; Wang, X.; Pan, X.; Bi, D. Relationship between CYP3A29 and pregnane X receptor in landrace pigs: Pig CYP3A29 has a similar mechanism of regulation to human CYP3A4. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2018, 214, 9–16. [Google Scholar] [CrossRef]
  7. Kim, S.; Östör, A.J.K.; Nisar, M.K. Interleukin-6 and cytochrome-P450, reason for concern? Rheumatol. Int. 2012, 32, 2601–2604. [Google Scholar] [CrossRef] [PubMed]
  8. Jover, R.; Bort, R.; Gómez-Lechón, M.J.; Castell, J.V. Down-regulation of human CYP3A4 by the inflammatory signal interleukin 6: Molecular mechanism and transcription factors involved. FASEB J. 2002, 16, 1–29. [Google Scholar] [CrossRef] [PubMed]
  9. Fang, X.; Zhao, W.; Fu, Y.; Tu, F.; Li, B.; Wang, X.; Zhao, F.; Ren, S. Difference in susceptibility to mycoplasma pneumonia among various pig breeds and its molecular genetic basis. Agric. Sci. China 2015, 48, 2839–2847. [Google Scholar] [CrossRef]
  10. Tsai, N.-C.; Ray, A. Stochastic optimal control under randomly varying distributed delays. Int. J. Control. 1997, 68, 1179–1202. [Google Scholar] [CrossRef]
  11. Kast, H.R.; Goodwin, B.; Tarr, P.T.; Jones, S.A.; Anisfeld, A.M.; Stoltz, C.M.; Tontonoz, P.; Kliewer, S.; Willson, T.M.; Edwards, P.A. Regulation of Multidrug Resistance-associated Protein 2 (ABCC2) by the Nuclear Receptors Pregnane X Receptor, Farnesoid X-activated Receptor, and Constitutive Androstane Receptor. J. Biol. Chem. 2002, 277, 2908–2915. [Google Scholar] [CrossRef] [Green Version]
  12. Li, L.; Stanton, J.D.; Tolson, A.H.; Luo, Y.; Wang, H. Bioactive Terpenoids and Flavonoids from Ginkgo Biloba Extract Induce the Expression of Hepatic Drug-Metabolizing Enzymes Through Pregnane X Receptor, Constitutive Androstane Receptor, and Aryl hydrocarbon Receptor-Mediated Pathways. Pharm. Res. 2008, 26, 872–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Rathod, V.; Jain, S.; Nandekar, P.P.; Sangamwar, A.T. Human pregnane X receptor: A novel target for anticancer drug development. Drug Discov. Today 2014, 19, 63–70. [Google Scholar] [CrossRef] [PubMed]
  14. Li, X.; Jin, X.; Zhou, X.; Wang, X.; Shi, D.; Xiao, Y.; Bi, D. Pregnane X receptor is required for IFN-α-mediated CYP3A29 expression in pigs. Biochem. Biophys. Res. Commun. 2014, 445, 469–474. [Google Scholar] [CrossRef] [PubMed]
  15. Li, X.; Hu, X.; Jin, X.; Zhou, X.; Wang, X.; Shi, D.; Bi, D. IFN-γregulates cytochrome 3A29 through pregnane X receptor in pigs. Xenobiotica 2014, 45, 373–379. [Google Scholar] [CrossRef] [PubMed]
  16. Damte, D.; Lee, S.-J.; Hwang, M.-H.; Gebru, E.; Choi, M.-J.; Lee, J.-S.; Cheng, H.; Park, S.-C. Inflammatory responses toMycoplasma hyopneumoniaein murine alveolar macrophage cell lines. N. Z. Vet. J. 2011, 59, 185–190. [Google Scholar] [CrossRef]
  17. Bai, F.; Ni, B.; Liu, M.; Feng, Z.; Xiong, Q.; Xiao, S.; Shao, G. Mycoplasma hyopneumoniae-derived lipid-associated membrane proteins induce apoptosis in porcine alveolar macrophage via increasing nitric oxide production, oxidative stress, and caspase-3 activation. Vet. Immunol. Immunopathol. 2013, 155, 155–161. [Google Scholar] [CrossRef]
  18. Lu, Z.; Xie, D.; Chen, Y.; Tian, E.; Muhammad, I.; Chen, X.; Miao, Y.; Hu, W.; Wu, Z.; Ni, H.; et al. TLR2 mediates autophagy through ERK signaling pathway in Mycoplasma gallisepticum -infected RAW264.7 cells. Mol. Immunol. 2017, 87, 161–170. [Google Scholar] [CrossRef]
  19. Wu, S.; Lu, Y.-C.; McMurtrey, J.E.; Weesies, G.; Devine, T.E.; Foster, G.R. Soil Conservation Benefits of Large Biomass Soybean (LBS) for Increasing Crop Residue Cover. J. Sustain. Agric. 2004, 24, 107–128. [Google Scholar] [CrossRef]
  20. Zhang, Z.; Wei, Y.; Liu, B.; Wu, Y.; Wang, H.; Xie, X.; Feng, Z.; Shao, G.; Xiong, Q. Hsp90/Sec22b promotes unconventional secretion of mature-IL-1β through an autophagosomal carrier in porcine alveolar macrophages during Mycoplasma hyopneumoniae infection. Mol. Immunol. 2018, 101, 130–139. [Google Scholar] [CrossRef]
  21. Caron, J.; Ouardani, M.; Dea, S. Diagnosis and Differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis Infections in Pigs by PCR Amplification of the p36 and p46 Genes. J. Clin. Microbiol. 2000, 38, 1390–1396. [Google Scholar] [CrossRef] [Green Version]
  22. Almeida, H.M.; Mechler-Dreibi, M.L.; Sonálio, K.; Ferraz, M.E.S.; Storino, G.Y.; Barbosa, F.O.; Maes, D.; Montassier, H.J.; De Oliveira, L.G.; Rezende, F.B. Cytokine expression and Mycoplasma hyopneumoniae burden in the development of lung lesions in experimentally inoculated pigs. Vet. Microbiol. 2020, 244, 108647. [Google Scholar] [CrossRef] [PubMed]
  23. Fang, X.; Zhao, W.; Xu, J.; Tu, F.; Wang, X.; Li, B.; Fu, Y.; Ren, S. CYP1A1 mediates the suppression of major inflammatory cytokines in pulmonary alveolar macrophage (PAM) cell lines caused by Mycoplasma hyponeumoniae. Dev. Comp. Immunol. 2016, 65, 132–138. [Google Scholar] [CrossRef] [PubMed]
  24. Markov, G.V.; Laudet, V. Origin and evolution of the ligand-binding ability of nuclear receptors. Mol. Cell. Endocrinol. 2011, 334, 21–30. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Y.-M.; Ong, S.S.; Chai, S.C.; Chen, T. Role of CAR and PXR in xenobiotic sensing and metabolism. Expert Opin. Drug Metab. Toxicol. 2012, 8, 803–817. [Google Scholar] [CrossRef] [Green Version]
  26. Zhou, X.; Li, X.; Wang, X.; Jin, X.; Shi, D.; Wang, J.; Bi, D. Cecropin B Represses CYP3A29 Expression through Activation of the TLR2/4-NF-κB/PXR Signaling Pathway. Sci. Rep. 2016, 6, 27876. [Google Scholar] [CrossRef]
  27. Li, X.-N.; Zuo, Y.-Z.; Qin, L.; Liu, W.; Li, Y.-H.; Li, J.-L. Atrazine-xenobiotic nuclear receptor interactions induce cardiac inflammation and endoplasmic reticulum stress in quail (Coturnix coturnix coturnix). Chemosphere 2018, 206, 549–559. [Google Scholar] [CrossRef]
  28. Xie, L.; He, Y.; Zhou, X.; Li, X.; Jin, X.; Wang, X.; Shi, D. Porcine interleukin-6 enhances the expression of CYP2C33 through a constitutive androstane receptor/retinoid X receptor-mediated pathway. Xenobiotica 2018, 49, 257–264. [Google Scholar] [CrossRef]
  29. Dickmann, L.J.; Patel, S.K.; Wienkers, L.C.; Slatter, J.G. Effects of interleukin 1? (IL-1?) and IL-1?/interleukin 6 (IL-6) combinations on drug metabolizing enzymes in human hepatocyte culture. Curr. Drug Metab. 2012, 13, 930–937. [Google Scholar] [CrossRef]
  30. Kojima, M.; Degawa, M. Sex differences in constitutive mRNA levels of CYP2B22, CYP2C33, CYP2C49, CYP3A22, CYP3A29 and CYP3A46 in the pig liver: Comparison between Meishan and Landrace pigs. Drug Metab. Pharmacokinet. 2016, 31, 185–192. [Google Scholar] [CrossRef]
  31. Wu, J.; Chen, R.; Zhang, C.; Li, K.; Xu, W.; Wang, L.; Chen, Q.; Mu, P.; Jiang, J.; Wen, J.; et al. Bioactivation and Regioselectivity of Pig Cytochrome P450 3A29 towards Aflatoxin B1. Toxins 2016, 8, 267. [Google Scholar] [CrossRef] [Green Version]
  32. Zamaratskaia, G.; Thøgersen, R.; Čandek-Potokar, M.; Rasmussen, M.K. Co-treatment with indole-3-carbinol and resveratrol modify porcine CYP1A and CYP3A activities and expression. Xenobiotica 2017, 48, 232–240. [Google Scholar] [CrossRef] [PubMed]
  33. Küblbeck, J.; Zancanella, V.; Prantner, V.; Molnár, F.; Squires, E.J.; Dacasto, M.; Honkakoski, P.; Giantin, M. Characterization of ligand-dependent activation of bovine and pig constitutive androstane (CAR) and pregnane X receptors (PXR) with interspecies comparisons. Xenobiotica 2016, 46, 200–210. [Google Scholar] [CrossRef] [PubMed]
  34. Gray, M.; Pollock, C.B.; Schook, L.B.; Squires, E.J. Characterization of porcine pregnane X receptor, farnesoid X receptor and their splice variants. Exp. Biol. Med. 2010, 235, 718–736. [Google Scholar] [CrossRef] [PubMed]
  35. Zhou, L.; Wang, L.; Zhao, W.; Ren, S.; Tu, F.; Fu, Y.; Li, B.; Wang, X.; Fang, X.-M. Transcriptome sequencing analysis of porcine MDM response to FSL-1 stimulation. Microb. Pathog. 2020, 138, 103830. [Google Scholar] [CrossRef]
  36. Zhou, C.; Tabb, M.M.; Nelson, E.L.; Grün, F.; Verma, S.; Sadatrafiei, A.; Lin, M.; Mallick, S.; Forman, B.M.; Thummel, K.E.; et al. Mutual repression between steroid and xenobiotic receptor and NF- B signaling pathways links xenobiotic metabolism and inflammation. J. Clin. Investig. 2006, 116, 2280–2289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Monaco, C.; Andreakos, E.; Kiriakidis, S.; Mauri, C.; Bicknell, C.; Foxwell, B.; Cheshire, N.; Paleolog, E.; Feldmann, M. Canonical pathway of nuclear factor B activation selectively regulates proinflammatory and prothrombotic responses in human atherosclerosis. Proc. Natl. Acad. Sci. USA 2004, 101, 5634–5639. [Google Scholar] [CrossRef] [Green Version]
  38. Smith, E.M.; Gregg, M.; Hashemi, F.; Schott, L.; Hughes, T.K. Corticotropin Releasing Factor (CRF) Activation of NF-κB-Directed Transcription in Leukocytes. Cell. Mol. Neurobiol. 2006, 26, 1019–1034. [Google Scholar] [CrossRef]
Animals 11 00349 g001 550
Figure 1. PCR identification of pig alveolar macrophage (PAM) 3D4/21 cells infected with M. hyopneumoniae and the mRNA expression of IL-6 and IL-8. (A) PCR identification of PAM 3D4/21 cells infected with M. hyopneumoniae. (B) IL-6 and (C) IL-8 mRNA expression after M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001 compared to the uninfected group.
Figure 1. PCR identification of pig alveolar macrophage (PAM) 3D4/21 cells infected with M. hyopneumoniae and the mRNA expression of IL-6 and IL-8. (A) PCR identification of PAM 3D4/21 cells infected with M. hyopneumoniae. (B) IL-6 and (C) IL-8 mRNA expression after M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001 compared to the uninfected group.
Animals 11 00349 g001
Animals 11 00349 g002 550
Figure 2. Changes in PXR and CYP3A29 protein and mRNA expression levels after M. hyopneumoniae infection. The mRNA expression levels of (A) PXR and (B) CYP3A29 after M. hyopneumoniae infection of PAM 3D4/21 cells for 24 h. (C) The protein expression of PXR and CYP3A29 after M. hyopneumoniae infection. (D) Analysis of the relative protein expression based on the gray values of the bands in panel C. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001 compared to the uninfected group.
Figure 2. Changes in PXR and CYP3A29 protein and mRNA expression levels after M. hyopneumoniae infection. The mRNA expression levels of (A) PXR and (B) CYP3A29 after M. hyopneumoniae infection of PAM 3D4/21 cells for 24 h. (C) The protein expression of PXR and CYP3A29 after M. hyopneumoniae infection. (D) Analysis of the relative protein expression based on the gray values of the bands in panel C. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001 compared to the uninfected group.
Animals 11 00349 g002
Animals 11 00349 g003 550
Figure 3. Detection of PXR overexpression and interference efficiency. (A) Relative mRNA levels of PXR after pcDNA3.1-PXR transfection into PAM 3D4/21 cells for 36 h. (B) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells. The protein expression of PXR was measured by western blot. (C) Relative mRNA level of PXR after PXR-sus-992 transfection into PAM 3D4/21 cells for 36 h. (D) Negative control or PXR-sus-992 was transfected into PAM 3D4/21 cells. The protein expression of PXR was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001.
Figure 3. Detection of PXR overexpression and interference efficiency. (A) Relative mRNA levels of PXR after pcDNA3.1-PXR transfection into PAM 3D4/21 cells for 36 h. (B) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells. The protein expression of PXR was measured by western blot. (C) Relative mRNA level of PXR after PXR-sus-992 transfection into PAM 3D4/21 cells for 36 h. (D) Negative control or PXR-sus-992 was transfected into PAM 3D4/21 cells. The protein expression of PXR was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. *** p < 0.001.
Animals 11 00349 g003
Animals 11 00349 g004 550
Figure 4. Effect of PXR overexpression on CYP3A29 expression in PAM 3D4/21 cells with or without M. hyopneumoniae infection. (A) The mRNA expression level of CYP3A29 after PXR overexpression. (B) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells. The protein expression of CYP3A29 was measured by western blot. (C) The mRNA expression level of CYP3A29 after PXR overexpression in PAM 3D4/21 cells infected with M. hyopneumoniae. (D) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells infected with M. hyopneumoniae. The protein expression of CYP3A29 was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. ** p < 0.01; *** p < 0.001.
Figure 4. Effect of PXR overexpression on CYP3A29 expression in PAM 3D4/21 cells with or without M. hyopneumoniae infection. (A) The mRNA expression level of CYP3A29 after PXR overexpression. (B) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells. The protein expression of CYP3A29 was measured by western blot. (C) The mRNA expression level of CYP3A29 after PXR overexpression in PAM 3D4/21 cells infected with M. hyopneumoniae. (D) pcDNA3.1 or pcDNA3.1-PXR was transfected into PAM 3D4/21 cells infected with M. hyopneumoniae. The protein expression of CYP3A29 was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. ** p < 0.01; *** p < 0.001.
Animals 11 00349 g004
Animals 11 00349 g005 550
Figure 5. Effect of PXR silencing on CYP3A29 in PAM 3D4/21 cells with or without M. hyopneumoniae infection. (A) The mRNA expression level of CYP3A29 after PXR silencing. (B) Negative control or PXR-sus-992 were transfected into PAM 3D4/21 cells. The protein expression of CYP3A29 was measured by western blot. (C) The mRNA expression level of CYP3A29 after silencing of PXR in PAM 3D4/21 cells infected with M. hyopneumoniae. (D) Negative control or PXR-sus-992 was transfected into PAM 3D4/21 cells infected with M. hyopneumoniae. The protein expression of CYP3A29 was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 5. Effect of PXR silencing on CYP3A29 in PAM 3D4/21 cells with or without M. hyopneumoniae infection. (A) The mRNA expression level of CYP3A29 after PXR silencing. (B) Negative control or PXR-sus-992 were transfected into PAM 3D4/21 cells. The protein expression of CYP3A29 was measured by western blot. (C) The mRNA expression level of CYP3A29 after silencing of PXR in PAM 3D4/21 cells infected with M. hyopneumoniae. (D) Negative control or PXR-sus-992 was transfected into PAM 3D4/21 cells infected with M. hyopneumoniae. The protein expression of CYP3A29 was measured by western blot. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01; *** p < 0.001.
Animals 11 00349 g005
Animals 11 00349 g006 550
Figure 6. Effects of PXR overexpression and silencing on IL-6 and IL-8 expression in M. hyopneumoniae-infected PAM 3D4/21 cells. (A) The mRNA expression levels of IL-6 and IL-8 after PXR overexpression. (B) The mRNA expression levels of IL-6 and IL-8 after PXR silencing. (C) The mRNA expression levels of IL-6 and IL-8 after PXR overexpression with M. hyopneumoniae infection. (D) The mRNA expression levels of IL-6 and IL-8 after PXR silencing with M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 6. Effects of PXR overexpression and silencing on IL-6 and IL-8 expression in M. hyopneumoniae-infected PAM 3D4/21 cells. (A) The mRNA expression levels of IL-6 and IL-8 after PXR overexpression. (B) The mRNA expression levels of IL-6 and IL-8 after PXR silencing. (C) The mRNA expression levels of IL-6 and IL-8 after PXR overexpression with M. hyopneumoniae infection. (D) The mRNA expression levels of IL-6 and IL-8 after PXR silencing with M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01; *** p < 0.001.
Animals 11 00349 g006
Animals 11 00349 g007 550
Figure 7. ELISA result of IL-6 and IL-8 protein in the cell culture supernatant of the PAM 3D4/21 cells. (A) The protein expression of IL-6 and IL-8 after PXR overexpression. (B) The protein expression of IL-6 and IL-8 after PXR silencing. (C) The protein expression of IL-6 and IL-8 after PXR overexpression with M. hyopneumoniae infection. (D) The protein expression of IL-6 and IL-8 after PXR silencing with M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01.
Figure 7. ELISA result of IL-6 and IL-8 protein in the cell culture supernatant of the PAM 3D4/21 cells. (A) The protein expression of IL-6 and IL-8 after PXR overexpression. (B) The protein expression of IL-6 and IL-8 after PXR silencing. (C) The protein expression of IL-6 and IL-8 after PXR overexpression with M. hyopneumoniae infection. (D) The protein expression of IL-6 and IL-8 after PXR silencing with M. hyopneumoniae infection. The data are presented as the mean ± SD. The experiment was repeated three independent times. * p < 0.05; ** p < 0.01.
Animals 11 00349 g007
Table
Table 1. Primers used for real-time quantitative polymerase chain reaction (RT-qPCR) amplification.
Table 1. Primers used for real-time quantitative polymerase chain reaction (RT-qPCR) amplification.
Primer NamePrimer Sequence (5′→3′)Length/bpAnnealing Temperature/°C
IL-6CGAGGCCGTGCAGATTAGTA24560
ACGGCATCAATCTCAGGTGC
IL-8GCAGAGCTCACAAGCTCCTA17160
CTGGCATCGAAGTTCTGCAC
CYP3A29AAAGTCGCCTCACAGATCAACA17360
GGAGAGAGCACTGCTAGTGGTCT
HPRT1CCCAGCGTCGTGATTAGTGA19160
TTGAGCACACAGAGGGCTAC
PXRAGATCTTTTCCCTGCTGCCC23460
CTGAGGGGTCTTCCAAGCTG
P36TTACAGCGGGAAGACC42760
CGGCGAGAAACTGGATA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yang, X.; Xing, F.; Wang, L.; Zhao, W.; Fu, Y.; Tu, F.; Li, B.; Fang, X.; Ren, S. Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection. Animals 2021, 11, 349. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11020349

AMA Style

Yang X, Xing F, Wang L, Zhao W, Fu Y, Tu F, Li B, Fang X, Ren S. Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection. Animals. 2021; 11(2):349. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11020349

Chicago/Turabian Style

Yang, Xiaoyang, Fei Xing, Li Wang, Weimin Zhao, Yanfeng Fu, Feng Tu, Bixia Li, Xiaomin Fang, and Shouwen Ren. 2021. "Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection" Animals 11, no. 2: 349. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11020349

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop