Expression of Enzymes Associated with Prostaglandin Synthesis in Equine Conceptuses
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Conceptus Collection
2.2. Extraction of RNA
2.3. Reverse Transcription Qualitative PCR (RT-PCR)
2.4. Sequencing of RT-PCR Products
2.5. Reverse Transcription Quantitative PCR (qRT-PCR)
2.6. Immunohistochemistry
2.7. Primary Trophoblast Cell Culture
2.8. Statistical Analysis
3. Results
3.1. Qualitative RT-PCR for Enzymes Involved in PG Synthesis in Equine Conceptuses
3.2. Quantitative RT-PCR (qRT-PCR) Analysis for Enzymes Involved in PG Synthesis in Equine Conceptuses
3.3. Quantitative RT-PCR Analysis of Enzymes Involved in Prostaglandin Synthesis in Primary Equine Trophoblast Cell Cultures With and Without Oxytocin
3.4. Immunohistochemistry
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aurich, C.; Budik, S. Early pregnancy in the horse revisited—Does exception prove the rule? J. Anim. Sci. Biotechnol. 2015, 6, 50. [Google Scholar] [CrossRef] [Green Version]
- Stout, T.A.; Allen, W.R. Role of prostaglandins in intrauterine migration of the equine conceptus. Reproduction 2001, 121, 771–775. [Google Scholar] [CrossRef] [PubMed]
- Weber, J.A.; Woods, G.L.; Freeman, D.A.; Vanderwall, D.K. Prostaglandin E2 secretion by day-6 to day-9 equine embryos. Prostaglandins 1992, 43, 55–59. [Google Scholar] [CrossRef]
- Gastal, M.O.; Gastal, E.L.; Torres, C.A.; Ginther, O.J. Effect of PGE2 on uterine contractility and tone in mares. Theriogenology 1998, 50, 989–999. [Google Scholar] [CrossRef]
- Watson, E.D.; Sertich, P.L. Prostaglandin production by horse embryos and the effect of co-culture of embryos with endo-metrium from pregnant mares. J. Reprod. Fertil. 1989, 87, 331–336. [Google Scholar] [CrossRef] [PubMed]
- Park, J.Y.; Pillinger, M.H.; Abramson, S.B. Prostaglandin E2 synthesis and secretion: The role of PGE2 synthases. Clin. Immunol. 2006, 119, 229–240. [Google Scholar] [CrossRef]
- Ricciotti, E.; Fitzgerald, G.A. Prostaglandins and inflammation. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 986–1000. [Google Scholar] [CrossRef] [PubMed]
- Shitashige, M.; Morita, I.; Murota, S. Different substrate utilization between prostaglandin endoperoxide H synthase-1 and -2 in NIH3T3 fibroblasts. Biochim. Biophys. Acta 1998, 1389, 57–66. [Google Scholar] [CrossRef]
- Morita, I. Distinct functions of COX-1 and COX-2. Prostaglandins Other Lipid Mediat. 2002, 68, 165–175. [Google Scholar] [CrossRef]
- Spencer, A.G.; Woods, J.W.; Arakawa, T.; Singer, I.I.; Smith, W.L. Subcellular Localization of Prostaglandin Endoperoxide H Synthases-1 and -2 by Immunoelectron Microscopy. J. Biol. Chem. 1998, 273, 9886–9893. [Google Scholar] [CrossRef] [Green Version]
- Lim, H.; Paria, B.C.; Das, S.K.; Dinchuk, J.E.; Langenbach, R.; Trzaskos, J.M.; Dey, S.K. Multiple female reproductive failures in cyclooxygenase 2–Deficient mice. Cell 1997, 91, 197–208. [Google Scholar] [CrossRef] [Green Version]
- Thoren, S.; Jacobsson, P. Coordinate up- and down- regulation of glutathione-dependent prostaglandin E synthase and cyclooxygenase-2 in A549 cells: Inhibition by NS-398 and leukotriene C4. Eur. J. Biochem. 2000, 267, 6428–6434. [Google Scholar] [CrossRef]
- Kozai, K.; Tokuyama, S.; Szóstek, A.; Toishi, Y.; Tsunoda, N.; Taya, K.; Sakatani, M.; Takahashi, M.; Nambo, Y.; Skarzynski, D.J.; et al. Evidence for a PGF2α auto-amplification system in the endometrium in mares. Reproduction 2016, 151, 517–526. [Google Scholar] [CrossRef] [Green Version]
- Gokuldasa, P.P.; Singhb, S.K.; Tamulia, M.K.; Naskara, S.; Vashia, Y.; Thomasa, R.; Barmana, K.; Pegua, S.R.; Chethanb, S.G.; Agarwal, S.K. 2018 Dietary supplementation ofn-3polyunsaturated fatty acid altersendometrial expression of genes involved in prostaglan-dinbiosynthetic pathway in breeding sows (Sus scrofa). Theriogenology 2018, 110, 201–208. [Google Scholar] [CrossRef]
- Budik, S.; Palm, F.; Walter, I.; Helmreich, M.; Aurich, C. Increasing expression of oxytocin and vasopressin receptors in the equine conceptus between Days 10 and 16 of pregnancy. Reprod. Fertil. Dev. 2012, 24, 641–648. [Google Scholar] [CrossRef]
- Womble, D.D. GCG: The Wisconsin Package of Sequence Analysis Programs. Bioinform. Methods Protoc. 2003, 132, 3–22. [Google Scholar] [CrossRef]
- Herrera-Luna, C.V.; Scarlet, D.; Walter, I.; Aurich, C. Effect of stallion age on the expression of LH and FSH receptors and aromatase P450 in equine male reproductive tissues. Reprod. Fertil. Dev. 2016, 28, 2016–2026. [Google Scholar] [CrossRef]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Blikslager, A.T.; Yin, C.; Cochran, A.M.; Wooten, J.G.; Pettigrew, A.; Belknap, J.K. Cyclooxygenase Expression in the Early Stages of Equine Laminitis: A Cytologic Study. J. Vet. Intern. Med. 2006, 20, 1191–1196. [Google Scholar] [CrossRef]
- Galvão, A.; Skarzynski, D.; Ferreira-Dias, G. Nodal promotes functional luteolysis via down-regulation of progesterone and prostaglandins E2 and promotion of PGF2α synthetic pathways in Mare Corpus Luteum. Endocrinology 2016, 157, 858–871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, T.-H.; Lambert, P.; Minhas, R.S.; McEvoy, C.; Deadman, K.; Wright, P.; Prankerd, P.J.; Mogatle, S.; McIntosh, M.P. Temperature stability of oxytocin ampoules labelled for storage at 2 °C–8 °C and below 25 °C: An observational assessment under controlled accelerated and temperature cycling conditions. BMJ Open 2019, 9, e029083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hara, S. Prostaglandin terminal synthases as novel therapeutic targets. Proc. Jpn. Acad. Ser. B 2017, 93, 703–723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murakami, M.; Naraba, H.; Tanioka, T.; Semmyo, N.; Nakatani, Y.; Kojima, F.; Ikeda, T.; Fueki, M.; Ueno, A.; Oh-Ishi, S.; et al. Regulation of prostaglandin E2 biosynthesis by inducible membrane-associated prostaglandin E2 synthase that acts in concert with cyclooxygenase-2. J. Biol. Chem. 2000, 275, 32783–32792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naraba, H.; Yokoyama, C.; Tago, N.; Murakami, M.; Kudo, I.; Fueki, M.; Oh-Ishi, S.; Tanabe, T. Transcriptional regulation of the membrane-associated prostaglandin E2 synthase gene. Essential role of the transcription factor Egr-1. J. Biol. Chem 2002, 277, 28601–28608. [Google Scholar] [CrossRef] [Green Version]
- Klohonatz, K.M.; Coleman, S.J.; Islas-Trejo, A.D.; Medrano, J.F.; Hess, A.M.; Kalbfleisch, T.; Thomas, M.G.; Bouma, G.J.; Bruemmer, J.E. Coding RNA sequencing of equine endometrium during maternal recognition of pregnancy. Genes 2019, 10, 749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Budik, S.; Schrammel, N.; Aurich, C. Evaluation of genes involved in the JAK/EGFR/ERK/EGR-1 pathway for their mRNA expression in pregnant and non-pregnant equine endometrium during the time of maternal recognition of pregnancy ISER XI Hamilton, New Zealand. J. Equine Vet. Sci. 2014, 1, 186. [Google Scholar] [CrossRef]
- Waclawik, A.; Ziecik, A.J. Differential expression of prostaglandin (PG) synthesis enzymes in conceptus during pe-ri-implantation period and endometrial expression of carbonyl reductase/PG 9-ketoreductase in the pig. J. Endocrinol. 2007, 194, 499–510. [Google Scholar] [CrossRef] [Green Version]
- Ziecik, A.J.; Wacławik, A.; Bogacki, M. Conceptus signals for establishment and maintenance of pregnancy in pigs—Lipid signaling system. Exp. Clin. Endocrinol. Diabetes 2008, 116, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Boerboom, D.; Brown, K.A.; Vaillancourt, D.; Poitras, P.; Goff, A.K.; Watanabe, K.; Doré, M.; Sirois, J. Expression of key prostaglandin synthases in equine endometrium during late diestrus and early pregnancy. Biol. Reprod. 2004, 70, 391–399. [Google Scholar] [CrossRef] [Green Version]
- Stout, T.A.; Allen, W.R. The role of oxytocin in luteolysis in the cycling mare. Reprod. Domest. Anim. 1999, 34, 351–354. [Google Scholar] [CrossRef]
- Tanioka, T.; Nakatani, Y.; Semmyo, N.; Murakami, M.; Kudo, I. Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin e2biosynthesis. J. Biol. Chem. 2000, 275, 32775–32782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szóstek, A.Z.; Adamowski, M.; Galvão, A.M.; Ferreira-Dias, G.M.; Skarzynski, D.J. Ovarian steroid-dependent tumor necrosis factor-α production and its action on the equine endometrium in vitro. Cytokine 2014, 67, 85–91. [Google Scholar] [CrossRef] [PubMed]
Accession number | Gene Symbol | Gene Name | Oligo | Sequence (5′–3′) | Amplicon Length |
---|---|---|---|---|---|
AF092539 | PLA2 | Equus caballus Phospholipase A2 | Forward Reverse | TGGGAGAGAAGAAAGAGG GTGAGAAGTAAAAGGGGG | 463 bp |
AB039865 | COX-1 | Equus caballus Cyclooxygenase 1 | Forward Reverse | ACCCCAGAACCAGATGGC TACTCCTCAATCACGATCTTG | 204 bp |
AB041771 | COX-2 | Equus caballus Cyclooxygenase 2 | Forward Reverse | CTGAGCACCTGCGGTTTG CAGCCATTTCCTTCTCTCC | 627 bp |
XM_001492303 | cPGES | Equus caballus Cytosolic Prostaglandin E Synthase | Forward Reverse | CGAAAAGGAGAATCTGGC CGTCATCACTGTCTTGTGAATC | 229 bp |
AY057096 | mPGES-1 | Equus caballus Membrane bound (microsomal) Prostaglandin E Synthase-1 | Forward Reverse | GCTGCTGGTCATCAAGATGT CCCAGGAAGAAGACGAGAAA | 263 bp |
AY304536 | PGFS | Equus caballus Prostaglandin F Synthase | Forward Reverse | CATCCGAAGCAAAATTGAAG AGACGTTGAGTCCCCAAAG | 480 bp |
AF035774 | β-ACT | Equus caballus Beta Actin | Forward Reverse | ATGGAATCCTGTGGCATC GCGCAATGATCTTGATCTTC | 190 bp |
Accession Number | Gene Symbol | Gene Name | Oligo | Sequence (5′–3′) | Amplicon Length | PCR Efficiency (%) | Reference |
---|---|---|---|---|---|---|---|
NM_001081838.1 | ACTB | Equus caballus beta actin | Forward Reverse Probe Probe | CCGGGACCTGACGGACTA CCTTGATGTCACGCACGATT FAM-TACAGCTTCACCACCACGGCCG-BHQ1 | 95 bp | 0.96 | Herrera-Luna et al., 2016 [17] |
XM_023631879.1, XR_002804825.1, NM_001081908.1 | AKR1C1 | Equus caballus aldo-keto reductase family 1, member C1 | Forward Reverse Probe | CCTAAACCGAAATCTGCGATATG CTAGTGGAGATCAGGACAAAGG FAM-ATGTTTGCTGGCCACCCTGAGTAT-BHQ1 | 109 bp | 0.95 | - |
XM_001916273.4, XM_001493545.5 | CBR1 | Equus caballus carbonyl reductase 1 | Forward Reverse Probe | GAAGTGACAATGAAAACAAACTTT CTAGACACATTCACCACTCTGC FAM-GCACGGAGCTACTGCCTCTCATAAA-BHQ1 | 98 bp | 0.90 | - |
NM_001163976.1 | COX-1 (PTGS1) | Equus caballus prostaglandin-endoperoxide synthase 1 | Forward Reverse Probe | GCGCTGGTTCTGGGAATTT TAAGGTTGGAACGCACTGTGAGT FAM-CAACGCCACCTTCATCCGTGACATG-BHQ1 | 83 bp | 0.92 | - |
NM_001081775.2 | COX-2 (PTGS2) | Equus caballus prostaglandin-endoperoxide synthase 2 | Forward Reverse Probe | GAGGTGTATCCGCCCACAGT AGCAAACCGCAGGTGCTC FAM-TCAGGTGGAAATGATCTACCCGCCTCA-BHQ1 | 81 bp | 0.93 | - |
XM_001492303.4 | cPGES (PTGES3) | Equus caballus prostaglandin E synthase 3 (cytosolic) | Forward Reverse Probe | TTTGCACTGTCAGTATGGCAAGT AATCCCCACTGTCATGAACATAAA FAM-TTCTTTCTTTGATTCAGCTTGTACTGCGGC-BHQ1 | 127 bp | 0.95 | - |
AY057096.1, NM_001081935 | mPGES-1 (PTGES) | Equus caballus prostaglandin E synthase (microsomal) | Forward Reverse Probe | AGTTTCACCGGGACGACCA AGTAGACGAGGCCCAGGAACA FAM-CGTGGAGCGTTGCCTGAGAGCC-BHQ1 | 99 bp | 0.91 | - |
XM_001497094.3 | RPL4 | Equus caballus ribosomal protein L4 | Forward Reverse Probe | CTGTGTTCAAGGCTCCCATTC GCACTGGTTTGATGACCTGCTA FAM-AACAGACAGCCTTATGCCGTCAGCG-BHQ1 | 115 bp | 0.97 | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Budik, S.; Walter, I.; Leitner, M.-C.; Ertl, R.; Aurich, C. Expression of Enzymes Associated with Prostaglandin Synthesis in Equine Conceptuses. Animals 2021, 11, 1180. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11041180
Budik S, Walter I, Leitner M-C, Ertl R, Aurich C. Expression of Enzymes Associated with Prostaglandin Synthesis in Equine Conceptuses. Animals. 2021; 11(4):1180. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11041180
Chicago/Turabian StyleBudik, Sven, Ingrid Walter, Marie-Christine Leitner, Reinhard Ertl, and Christine Aurich. 2021. "Expression of Enzymes Associated with Prostaglandin Synthesis in Equine Conceptuses" Animals 11, no. 4: 1180. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11041180