Fucoxanthin Exerts Anti-Tumor Activity on Canine Mammary Tumor Cells via Tumor Cell Apoptosis Induction and Angiogenesis Inhibition
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Cultures and Reagents
2.2. Cell Viability Assay
2.3. Annexin V Assay
2.4. Western Blotting
2.5. Rat Aortic Ring Assay
2.6. In Vitro Tube Formation Assay
2.7. In Vitro Migration Assay
2.8. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.9. Immunocytochemistry
2.10. Statistical Analyses
3. Results
3.1. Fucoxanthin Reduces Cell Viability in CMT-U27 Cells
3.2. Fucoxanthin Causes Tumor Cell Death by Inducing Apoptosis
3.3. Fucoxanthin Suppresses Endothelial Cell Sprouting and Tube Formation
3.4. Fucoxanthin Inhibits the Cell Migration in CMT-U27 Cells and HUVECs
3.5. Fucoxanthin Regulates Ang2 Expression in the Absence of the Vascular Endothelial Growth Factor A (VEGF-A)/Vascular Endothelial Growth Factor Receptor 2 (VEGFR-2) Signaling Pathway
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Sorenmo, K. Canine mammary gland tumors. Vet. Clin. Small Anim. Pract. 2003, 33, 573–596. [Google Scholar] [CrossRef]
- Moe, L. Population-based incidence of mammary tumours in some dog breeds. J. Reprod. Fertil. Suppl. 2001, 57, 439–443. [Google Scholar]
- Canadas-Sousa, A.; Santos, M.; Leal, B.; Medeiros, R.; Dias-Pereira, P. Estrogen receptors genotypes and canine mammary neoplasia. BMC Vet. Res. 2019, 15, 1–10. [Google Scholar] [CrossRef]
- Dall, G.V.; Hawthorne, S.; Seyed-Razavi, Y.; Vieusseux, J.; Wu, W.; Gustafsson, J.-A.; Byrne, D.; Murphy, L.; Risbridger, G.P.; Britt, K.L. Estrogen receptor subtypes dictate the proliferative nature of the mammary gland. J. Endocrinol. 2018, 237, 323–336. [Google Scholar] [CrossRef] [PubMed]
- Rossi, F.; Sabattini, S.; Vascellari, M.; Marconato, L. The impact of toceranib, piroxicam and thalidomide with or without hypofractionated radiation therapy on clinical outcome in dogs with inflammatory mammary carcinoma. Vet. Comp. Oncol. 2018, 16, 497–504. [Google Scholar] [CrossRef]
- Bakirel, T.; Ustun Alkan, F.; Ustuner, O.; Çinar, S.; Anlas, C.; Bilge Sari, A. Response of cultured normal canine mammary epithelial cells to deracoxib—doxorubicin combination. Acta Vet. Hung. 2017, 65, 366–381. [Google Scholar] [CrossRef] [Green Version]
- Karayannopoulou, M.; Lafioniatis, S. Recent advances on canine mammary cancer chemotherapy: A review of studies from 2000 to date. Breast Cancer Res. 2016, 29, 43. [Google Scholar]
- D’Orazio, N.; Gemello, E.; Gammone, M.A.; De Girolamo, M.; Ficoneri, C.; Riccioni, G. Fucoxantin: A Treasure from the Sea. Mar. Drugs 2012, 10, 604–616. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Tang, Y.; Zhang, Y.; Zhang, S.; Qu, J.; Wang, X.; Kong, R.; Han, C.; Liu, Z. Fucoxanthin: A Promising Medicinal and Nutritional Ingredient. Evid. Based Complement Altern. Med. 2015, 2015, 723515. [Google Scholar] [CrossRef] [PubMed]
- Lopes-Costa, E.; Abreu, M.; Gargiulo, D.; Rocha, E.; Ramos, A.A. Anticancer effects of seaweed compounds fucoxanthin and phloroglucinol, alone and in combination with 5-fluorouracil in colon cells. J. Toxicol. Environ. Health Part A 2017, 80, 776–787. [Google Scholar] [CrossRef] [PubMed]
- Foo, S.C.; Yusoff, F.M.; Imam, M.U.; Foo, J.B.; Ismail, N.; Azmi, N.H.; Tor, Y.S.; Khong, N.M.; Ismail, M. Increased fucoxanthin in Chaetoceros calcitrans extract exacerbates apoptosis in liver cancer cells via multiple targeted cellular pathways. Biotechnol. Rep. 2019, 21, e00296. [Google Scholar] [CrossRef]
- Karpiński, T.M.; Adamczak, A. Fucoxanthin—An antibacterial carotenoid. Antioxidants 2019, 8, 239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garg, S.; Afzal, S.; Elwakeel, A.; Sharma, D.; Radhakrishnan, N.; Dhanjal, J.K.; Sundar, D.; Kaul, S.C.; Wadhwa, R. Marine carotenoid fucoxanthin possesses anti-metastasis activity: Molecular evidence. Mar. Drugs 2019, 17, 338. [Google Scholar] [CrossRef] [Green Version]
- Kotake-Nara, E.; Asai, A.; Nagao, A. Neoxanthin and fucoxanthin induce apoptosis in PC-3 human prostate cancer cells. Cancer Lett. 2005, 220, 75–84. [Google Scholar] [CrossRef]
- Kotake-Nara, E.; Terasaki, M.; Nagao, A. Characterization of apoptosis induced by fucoxanthin in human promyelocytic leukemia cells. Biosci. Biotechnol. Biochem. 2005, 69, 224–227. [Google Scholar] [CrossRef] [PubMed]
- Ren, F.; Wu, K.; Yang, Y.; Yang, Y.; Wang, Y.; Li, J. Dandelion Polysaccharide Exerts Anti-Angiogenesis Effect on Hepatocellular Carcinoma by Regulating VEGF/HIF-1α Expression. Front. Pharmacol. 2020, 11, 460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Metibemu, D.S.; Akinloye, O.A.; Akamo, A.J.; Okoye, J.O.; Ojo, D.A.; Morifi, E.; Omotuyi, I.O. VEGFR-2 kinase domain inhibition as a scaffold for anti-angiogenesis: Validation of the anti-angiogenic effects of carotenoids from Spondias mombin in DMBA model of breast carcinoma in Wistar rats. Toxicol. Rep. 2021, 8, 489–498. [Google Scholar] [CrossRef]
- Zare, M.; Norouzi Roshan, Z.; Assadpour, E.; Jafari, S.M. Improving the cancer prevention/treatment role of carotenoids through various nano-delivery systems. Crit. Rev. Food Sci. Nutr. 2021, 61, 522–534. [Google Scholar] [CrossRef]
- Risau, W. Mechanisms of angiogenesis. Nature 1997, 386, 671–674. [Google Scholar] [CrossRef] [PubMed]
- Quintero-Fabián, S.; Arreola, R.; Becerril-Villanueva, E.; Torres-Romero, J.C.; Arana-Argáez, V.; Lara-Riegos, J.; Ramírez-Camacho, M.A.; Alvarez-Sánchez, M.E. Role of matrix metalloproteinases in angiogenesis and cancer. Front. Oncol. 2019, 9, 1370. [Google Scholar] [CrossRef] [Green Version]
- Fromm, S.; Cunningham, C.; Dunne, M.; Veale, D.; Fearon, U.; Wade, S. Enhanced angiogenic function in response to fibroblasts from psoriatic arthritis synovium compared to rheumatoid arthritis. Arthritis Res. Ther. 2019, 21, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Yin, H.; Chen, C.-Y.; Liu, Y.-W.; Tan, Y.-J.; Deng, Z.-L.; Yang, F.; Huang, F.-Y.; Wen, C.; Rao, S.-S.; Luo, M.-J. Synechococcus elongatus PCC7942 secretes extracellular vesicles to accelerate cutaneous wound healing by promoting angiogenesis. Theranostics 2019, 9, 2678. [Google Scholar] [CrossRef]
- Veith, A.P.; Henderson, K.; Spencer, A.; Sligar, A.D.; Baker, A.B. Therapeutic strategies for enhancing angiogenesis in wound healing. Adv. Drug Deliv. Rev. 2019, 146, 97–125. [Google Scholar] [CrossRef] [PubMed]
- Folkman, J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1995, 1, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Saraswati, S.; Agrawal, S. Brucine, an indole alkaloid from Strychnos nux-vomica attenuates VEGF-induced angiogenesis via inhibiting VEGFR2 signaling pathway in vitro and in vivo. Cancer Lett. 2013, 332, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Giannotta, M.; Trani, M.; Dejana, E. VE-cadherin and endothelial adherens junctions: Active guardians of vascular integrity. Dev. Cell 2013, 26, 441–454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ustün Alkan, F.; Ustüner, O.; Bakırel, T.; Cınar, S.; Erten, G.; Deniz, G. The effects of piroxicam and deracoxib on canine mammary tumour cell line. Sci. World J. 2012, 2012, 976740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Masferrer, J.L.; Leahy, K.M.; Koki, A.T.; Zweifel, B.S.; Settle, S.L.; Woerner, B.M.; Edwards, D.A.; Flickinger, A.G.; Moore, R.J.; Seibert, K. Antiangiogenic and antitumor activities of cyclooxygenase-2 inhibitors. Cancer Res. 2000, 60, 1306–1311. [Google Scholar]
- Laird, A.D.; Vajkoczy, P.; Shawver, L.K.; Thurnher, A.; Liang, C.; Mohammadi, M.; Schlessinger, J.; Ullrich, A.; Hubbard, S.R.; Blake, R.A. SU6668 is a potent antiangiogenic and antitumor agent that induces regression of established tumors. Cancer Res. 2000, 60, 4152–4160. [Google Scholar] [PubMed]
- Bråkenhielm, E.; Veitonmäki, N.; Cao, R.; Kihara, S.; Matsuzawa, Y.; Zhivotovsky, B.; Funahashi, T.; Cao, Y. Adiponectin-induced antiangiogenesis and antitumor activity involve caspase-mediated endothelial cell apoptosis. Proc. Natl. Acad. Sci. USA 2004, 101, 2476–2481. [Google Scholar] [CrossRef] [Green Version]
- Walker, N.; Harmon, B.; Gobe, G.; Kerr, J. Patterns of cell death. Methods Achiev. Exp. Pathol. 1988, 13, 18–54. [Google Scholar]
- Edinger, A.L.; Thompson, C.B. Death by design: Apoptosis, necrosis and autophagy. Curr. Opin. Cell Biol. 2004, 16, 663–669. [Google Scholar] [CrossRef]
- Jiang, X.; Wang, J.; Deng, X.; Xiong, F.; Zhang, S.; Gong, Z.; Li, X.; Cao, K.; Deng, H.; He, Y. The role of microenvironment in tumor angiogenesis. J. Exp. Clin. Cancer Res. 2020, 39, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Wittekind, C.; Neid, M. Cancer invasion and metastasis. Oncology 2005, 69, 14–16. [Google Scholar] [CrossRef]
- Jones, D.H.; Nakashima, T.; Sanchez, O.H.; Kozieradzki, I.; Komarova, S.V.; Sarosi, I.; Morony, S.; Rubin, E.; Sarao, R.; Hojilla, C.V. Regulation of cancer cell migration and bone metastasis by RANKL. Nature 2006, 440, 692–696. [Google Scholar] [CrossRef] [Green Version]
- Carmeliet, P. VEGF as a key mediator of angiogenesis in cancer. Oncology 2005, 69 (Suppl. 3), 4–10. [Google Scholar] [CrossRef] [PubMed]
- Dobrucki, L.W.; Tsutsumi, Y.; Kalinowski, L.; Dean, J.; Gavin, M.; Sen, S.; Mendizabal, M.; Sinusas, A.J.; Aikawa, R. Analysis of angiogenesis induced by local IGF-1 expression after myocardial infarction using microSPECT-CT imaging. J. Mol. Cell Cardiol. 2010, 48, 1071–1079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ongusaha, P.P.; Kwak, J.C.; Zwible, A.J.; Macip, S.; Higashiyama, S.; Taniguchi, N.; Fang, L.; Lee, S.W. HB-EGF is a potent inducer of tumor growth and angiogenesis. Cancer Res. 2004, 64, 5283–5290. [Google Scholar] [CrossRef] [Green Version]
- Fagiani, E.; Christofori, G. Angiopoietins in angiogenesis. Cancer Lett. 2013, 328, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Lobov, I.B.; Brooks, P.C.; Lang, R.A. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc. Natl. Acad. Sci. USA 2002, 99, 11205–11210. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence | Size (bp) |
---|---|---|
Ang2 | 5′-GGATCTGGGGAGAGAGGAAC-3′ 5′-CTCTGCACCGAGTCATCGTA-3′ | 535 |
VEGF-A | 5′- TGCAGATTATGCGGATCAAACC -3′ 5′- TGCATTCACATTTGTTGTGCTGTAG -3′ | 81 |
VEGFR-2 | 5′-CCAGCAAAAGCAGGGAGTCTGT-3′ 5′-TGTCTGTGTCATCGGAGTGATATCC-3′ | 87 |
GAPDH | 5′-ACCACAGTCCATGCCATCAC-3′ 5′-TCCACCACCCTGTTGCTGTA-3′ | 452 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.; Choi, J.; Park, J.-K.; Won, G.; Seol, J.-W. Fucoxanthin Exerts Anti-Tumor Activity on Canine Mammary Tumor Cells via Tumor Cell Apoptosis Induction and Angiogenesis Inhibition. Animals 2021, 11, 1512. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11061512
Jang H, Choi J, Park J-K, Won G, Seol J-W. Fucoxanthin Exerts Anti-Tumor Activity on Canine Mammary Tumor Cells via Tumor Cell Apoptosis Induction and Angiogenesis Inhibition. Animals. 2021; 11(6):1512. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11061512
Chicago/Turabian StyleJang, Hyuk, Jawun Choi, Jeong-Ki Park, Gayeon Won, and Jae-Won Seol. 2021. "Fucoxanthin Exerts Anti-Tumor Activity on Canine Mammary Tumor Cells via Tumor Cell Apoptosis Induction and Angiogenesis Inhibition" Animals 11, no. 6: 1512. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11061512