Next Article in Journal
Circular PPP1R13B RNA Promotes Chicken Skeletal Muscle Satellite Cell Proliferation and Differentiation via Targeting miR-9-5p
Next Article in Special Issue
Efficacy of a Synergistic Blend of Organic Acids and ß-1,4 Mannobiose on Cecal Salmonella Counts and Growth Performance in Salmonella Challenged Broiler Chickens: A Meta-Analysis
Previous Article in Journal
Dwarf and Tall Elephantgrass Genotypes under Irrigation as Forage Sources for Ruminants: Herbage Accumulation and Nutritive Value
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms

by
Dimitrios Papadopoulos
1,
Evanthia Petridou
1,*,
Konstantinos Papageorgiou
1,
Ioannis A. Giantsis
2,
Georgios Delis
3,
Vangelis Economou
4,
Ilias Frydas
1,
Georgios Papadopoulos
5,
Maria Hatzistylianou
6 and
Spyridon K. Kritas
1
1
Laboratory of Microbiology and Infectious Diseases, School of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2
Faculty of Agricultural Sciences, University of Western Macedonia, 53100 Florina, Greece
3
Laboratory of Pharmacology, School of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
4
Laboratory of Hygiene of Food of Animal Origin-Veterinary Public Health, School of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
5
Laboratory of Animal Science, School of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
6
Clinic of Pediatrics-Immunology and Infectious Diseases, Faculty of Health Sciences, School of Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
*
Author to whom correspondence should be addressed.
Submission received: 25 July 2021 / Revised: 9 August 2021 / Accepted: 10 August 2021 / Published: 13 August 2021

Abstract

:

Simple Summary

Campylobacter spp. has been the leading cause of human diarrhea in EU since 2005. Although poultry and poultry meat are considered as the primary source of transmission of campylobacteriosis to humans, pigs can be a significant reservoir of the pathogen, as well. Moreover, the increase of antibiotic resistance in the specific pathogen, especially against fluroquinolones and macrolides is considered a significant threat for public health. The purpose of the current study was to evaluate and molecularly characterize the antimicrobial resistance of Campylobacter infection in pig farms in Greece at both phenotypic and molecular level.

Abstract

The purpose of this research was to characterize the antibiotic resistance patterns of Campylobacter spp. isolated from commercial farrow to finish farms in Greece, and analyze the relevant molecular resistance mechanisms among the resistant Campylobacter isolates. Susceptibility testing to five different classes of antibiotics was performed in 100 C. coli and 100 C. jejuni, previously isolated and identified. All isolates were found susceptible to meropenem. Very high rates of resistance were recorded for tetracyclines (84.5%), medium rates of resistance were recorded regarding quinolones (23%), and low and very low rates of resistance were identified for macrolides such as erythromycin and aminoglycosides (12% and 4%, respectively). Only 12.5% of the Campylobacter isolates displayed MDR. Regarding the molecular mechanisms of resistance, all ciprofloxacin resistant isolates hosted the mutant type Thr-86-Ile region of the quinolone resistance-determining region (QRDR) of the gyrA gene. In all erythromycin resistant isolates, the transitional mutations A2075G and A2074C in the 23S rRNA gene were only amplified. Molecular screening of tetracycline resistance genes indicated that the vast majority of Campylobacter isolates (92.3%) were positive for the tet(O) gene. In summary, these findings and especially the very high and medium rates of resistance for tetracyclines and fluroquinolones, respectively recommend that a continuous monitoring of Campylobacter isolates susceptibility in combination with the proper use of antimicrobials in livestock production is of great importance for public health.

1. Introduction

Campylobacter spp. are common pathogenic bacteria of both veterinary and human public health importance. They constitute the most common human gastrointestinal pathogens reported in EU since 2005 [1]. In 2018 in EU, the number of laboratory confirmed cases of human campylobacteriosis was 246,571, corresponding to a notification rate of 64.1 per 100,000 population. Within the same year, 524 campylobacteriosis outbreaks in total have been recorded in the 28 EU Member States, 522 of which were food borne whereas the remaining two were waterborne [1]. In USA, it is estimated that 2.1–2.4 million cases of human campylobacteriosis occur every year [2]. The most common sources of Campylobacter transmission are raw milk and chicken meat.
Transmission occurs via the fecal-oral route after ingestion of contaminated food and water. The disease symptoms vary from a self-limiting watery diarrhea to a severe inflammatory diarrhea with abdominal pain and fever. Not infrequently, Campylobacter infections can be burdened with complications that can lead to chronic health problems. The main recognized sequelae after Campylobacter infection that can be triggered include Guillain-Barré syndrome (GBS) [3,4], reactive arthritis (REA) [5], and irritable bowel syndrome (IBS) [6].
Management of human campylobacteriosis is based on fluid therapy, which is generally considered the therapeutic corner stone. Antimicrobial treatment is only required for patients presenting more severe disease clinical signs, as well as for those who are immunocompromised. The most common antimicrobial agents implicated in the treatment of Campylobacter infections are macrolides, such as erythromycin, and fluoroquinolones, such as ciprofloxacin [7]. Tetracyclines have been suggested as an alternative choice for the treatment of clinical campylobacteriosis, but are rarely used in clinical practice [7].
During the past two decades, an increasing number of Campylobacter strains have developed resistance to fluoroquinolones and other antimicrobials such as macrolides. Moreover, the World Health Organization (WHO) identified Campylobacter as one of the high priority antimicrobial resistant pathogens, regarding its resistance to fluoroquinolones [7]. The resistance to both macrolides and fluoroquinolones is of major public health concern as it narrows therapeutic options for Campylobacter infections. Keeping this in mind, the EU continuously monitors the Campylobacter spp. prevalence and their resistance rates, in humans, animals, and food products. Therefore, it is considered as a public health priority.
Members of the Campylobacter genus exhibit optimal growth when cultured at 42 °C. They are generally isolated from the intestines of cattle, sheep, swine, and the poultry caecum. Due to a higher body temperature, poultry as well as other avian species are among the most common edible animals hosting Campylobacter spp., representing the main source of infection for humans [8].
Globally, Campylobacter jejuni is more prevalent in poultry, whereas Campylobacter coli is more common in pigs [9]. C. jejuni may co-exist with C. coli in pigs, but is typically detected in 10–100-fold lower levels than C. coli [10,11]. Pigs are considered as a natural reservoir of Campylobacter, exhibiting a prevalence of 50% and 100% with excretion levels ranging from 102 to 107 cfu/gr of feces [12,13]. In a consensus study conducted in Canada, amongst 1200 faecal samples examined, originating from 80 pig farms, 1.194 were positive for Campylobacter species. The prevalence of C. coli, C. lari, and C. jejuni were 99.2%, 0.6%, and 0.2%, respectively [14].
Sows have been identified as the major source for piglet contamination. Piglets are usually infected within the first days after their birth and genotypic analysis has provided evidence that sows and piglets share similar profiles [15]. In an experimental study conducted by Young et al., newborn piglets exhibited an average incidence 57.8% of Campylobacter within the first 24 h after birth [16]. In another study by Alter et al. [13] in 15 pig farms, none of the 1-day old newborn piglets were positive for Campylobacter but the average prevalence in piglets increased within the first days of life to 32.8%. In the third week of age, the prevalence of Campylobacter positive piglets reached 41%, increasing to 56.6% at 4 weeks of age and reaching 66.8% at 24 weeks after birth [13].
In pigs, the association of diarrhea with Campylobacter infection was firstly reported in 1948 by Doyle [17,18], who was able to reproduce a clinical syndrome, the so-called “pig dysentery”, in healthy pigs through experimental inoculation. Dysentery was also observed when C. coli was inoculated in gnotobiotic piglets by the oral route. Sala et al. [19] observed diarrhea, bacteremia, and bacterial distribution in many other organs such as lungs, kidneys, and liver of pigs after experimental inoculation with Campylobacter.
At the farm level, infections with Campylobacter are associated mainly with lactating piglets and include fever and mild to moderate diarrhea. Dehydration and loss of appetite may also occur. In sows, nursery, and fattening piglets, clinical signs are rarely observed.
The purpose of the current study was to evaluate and molecularly characterize the antimicrobial resistance of Campylobacter isolates from pig farms in Greece.

2. Materials and Methods

2.1. Samples and Processing

A total of 200 Campylobacter isolates, originating from 16 commercial pig farms from six different Greek regions were examined. The median size of the farms was 550 breeding sows (230–1600). Among these isolates, 100 have been previously identified as C. jejuni and 100 as C. coli. Speciation of Campylobacter isolates has been made according to a multiplex PCR protocol [20]. All samples were cryopreserved at −70 °C, in Brucella broth (OXOID, UK) supplemented with 5% lysed horse blood (OXOID, UK) and 15% glycerol.
The cryopreserved Campylobacter samples were defrosted, revived, and inoculated on to modified charcoal cefoperazone deoxycholate agar (mCCDA-OXOID, UK) with the selective supplement SR0155 (OXOID, UK). The inoculated plates were incubated under microaerobic conditions (85% N2, 10% CO2, and 5% O2) at 41.5 °C for 48 h.

2.2. DNA Isolation

Bacterial DNA for PCR was extracted using the conventional boiling method. Briefly, C. jejuni and C. coli colonies were suspended in 250 μL of ΤΕ (Tris-HCl [10 mM]: EDTA [1 mM]) buffer and were homogenized by vortexing. Suspensions were boiled at 100 °C for 10 min and were immediately placed in an iced bath for another 10 min. After centrifugation at 13,500× g for 10 min, the supernatant [100 μL] were collected and transferred to new tubes, and stored at −20 °C for molecular analysis to detect antibiotic-resistance genotypes by PCR.
The quantification of extracted DNA was performed spectrophotometrically and the quality of the extracted DNA was estimated from the ratio of absorbance at 260/280 nm. A value range of 1.8–2.2 was considered to indicate DNA isolation of high purity.
Antimicrobial susceptibility testing (AST).
The agar dilution method was applied for the antimicrobial susceptibility testing. All Campylobacter isolates were examined for their susceptibility to five antimicrobials of five different antimicrobial classes. The antimicrobials tested included gentamicin (GEN), erythromycin (ERY), ciprofloxacin (CIP), tetracycline (TET), and meropenem (MER) (Sigma-Aldrich). The Muller Hinton agar supplemented with 5% mechanically defibrinated horse blood and 20 mg/L β-NAD was used for Campylobacter isolates susceptibility testing.
The European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoint tables version 11.0 for C. jejuni and C. coli were used for the interpretation of the results [21]. Regarding gentamicin and meropenem, tables of the same version for Enterobacteriaceae were used. Antibiotics exhibiting phenotypic resistance to more than three different classes were regarded as Multidrug Resistant [22]. The C. jejuni ATCC 33560 and C. coli ATCC 33559 were used for the AST, Quality Control.

2.3. Genotypic Characterization of Fluoroquinolone Resistance

All C. jejuni and C. coli isolates that were found resistant to ciprofloxacin, were examined for the presence of Thr-86 to Ile mutations (C-to-T transition) in the quinolone resistance-determining region (QRDR) of the gyrA gene [23,24]. Determination of the gyrA gene presence was performed by applying the mismatch amplification mutation assay PCR and using the FastGene Taq DNA PCR Kit (Nippon Genetics, Düren, Germany) following the manufacturer’s recommendations, with primers (Table 1) and conditions as in Zirnstein et al. [22,23].

2.4. Genotypic Characterization of Macrolide Resistance

The resistance in macrolides was explored by the examination of point mutations at positions 2075 and 2074 in the domain V of the 23S rRNA gene [25], and of the presence of the ribosomal RNA methylase gene, ermB, that was amplified as described by Qin et al. (2014) [26] using the PCR amplification kit.

2.5. Genotypic Characterization of Tetracycline Resistance

For the evaluation of resistance to tetracyclines, three genes, i.e., tet(O), tet(A), and tet(B) were analyzed among the Campylobacter isolates. PCR amplification of these genes was performed using the FastGene Taq DNA PCR Kit following the manufacturer’s recommendations, with primers (Table 1) and reaction conditions as described by Abdi-Hachesoo et al. [27].
Table 1. Primer sequences used for species identification and detection of resistance genes and mutations.
Table 1. Primer sequences used for species identification and detection of resistance genes and mutations.
Target GeneSequence (5′-3′)Amplicon Size (bp)Reference
tet(O)F:AACTTAGGCATTCTGGCTCAC515[27]
R:TCCCACTGTTCCATATCGTCA
tet(A)F: GTGAAACCCAACATACCCC888
R: GAAGGCAAGCAGGATGTAG
tet(B)F: CCTTATCATGCCAGTCTTGC774
R: ACTGCCGTTTTTTCGCC
cmeBF:GACGTAATGAAGGAGAGCCA1166[28]
R:CTGATCCACTCCAGCTATG
gyrA
Thr-86-Ile mutations
(C. jejuni)
F: TATGAGCGTTATTATCGGTC265[24]
R: TAAGGCATCGTAAACAGCCA
gyrA
Thr-86-Ile mutations
(C. coli)
F:TATGAGCGTTATTATCGGTC192[24]
R:TAAGGCATCGTAAACAGCCA
23S rRNA at position
2074
F:TTAGCTAATGTTGCCCGTACCG485[25]
R: AGTAAAGGTCCACGGGGTCTCG
23S rRNA at position
2075
F:TTAGCTAATGTTGCCCGTACCG486[25]
R:TAGTAAAGGTCCACGGGGTCGC
ermBF:TGAAAAAGTACTCAACCAAAT692[26]
R:TCCTCCCGTTAAATAATAGAT

2.6. Genotypic Characterization of Efflux Pumps

Finally, the cmeB gene was analysed molecularly in all Campylobacter spp. strains for the presence of the multidrug efflux pumps, using primers and the PCR amplification procedure suggested by Pumbwe et al. [28].
In all analyses, PCR products were visualized by electrophoresis using an agarose gel stained with ethidium bromide.

2.7. Statistical Analysis

Comparisons between rates were performed after the preparation of contingency tables (chi-squared tests), as provided in the IBM® SPSS® version 25 statistical software (IBM Corp., Armonk, NY, USA). The level of significance was set at 5% (α = 0.05).

3. Results

3.1. Antimicrobial Susceptibility Testing (AST)

From the totally 200 examined Campylobacter isolates, 23 (11.5%), nine (9%) C. coli, and 14 (14%) C. jejuni isolates were found susceptible to all five antibiotic classes tested, while 25 isolates (12.5%), 15 C. coli, and 10 C. jejuni were classified as multidrug resistant by showing resistance to three different classes of antibiotics.
All clinical isolates were susceptible to meropenem. Very high rates of resistance were recorded for tetracycline, i.e., 169 Campylobacter isolates (84.5%), were resistant. More specifically, 88 (88%) and 81 (81%) of C. coli and C. jejuni, respectively, presented resistance in this class of antibiotics. Medium rates of resistance were recorded regarding fluroquinolones as 46 isolates (23%), 22 (22%) and 24 (24%) of C. coli and C. jejuni, respectively were resistant in ciprofloxacin. Finally, low and very low rates of resistance were identified for macrolides and aminoglycosides. For erythromycin, 24 isolates (12%), 13 (13%) and 11 (11%), C. coli and C. jejuni, respectively, were exhibiting resistance, while only eight isolates (4%), five C. coli and three C. jejuni were found resistant to gentamicin. It is noteworthy that all erythromycin resistant Campylobacter isolates, presented high level resistance against the selected antibiotic with MIC ≥ 32 mg/L. Statistical analysis did not reveal significant differences (p > 0.05) concerning the rates of resistance to any of the investigated antibiotics between C. coli and C. jejuni isolates. However, a clear pattern was discerned within both bacterial species, with resistance to ciprofloxacin being significantly (p < 0.001) less frequent than the resistance to tetracycline, and significantly more frequent that the resistance to erythromycin, gentamicin, and, self-evidently, meropenem.
Among all Campylobacter isolates, three MDR phenotypes were determined. The resistance CipEryTet phenotype was the most common, as it was present in 17 Campylobacter spp. isolates (8.5%). The phenotype CipGenTet followed, as it was identified in seven isolates (3.5%). In one isolate (0.5%), we observed resistance in erythromycin, gentamicin, and tetracycline. Moreover, three Campylobacter spp. isolates (1.5%), were resistant to both erythromycin and ciprofloxacin, drugs of choice for the treatment of invasive human campylobacteriosis. All nine resistance phenotypes recorded in the current study are shown in Table 2 and resistance rates of Campylobacter isolates in Table 3.

3.2. Antibiotic Resistance Genes (Molecular Mechanisms of Resistance)

Molecular screening of tetracycline resistance genes indicated that 92.3% of Campylobacter isolates (156/166) were positive for tet(O). Particularly, the tet(O) genetic locus was detected in 94.3% of C. coli isolates (83/88) and 90.1% of C. jejuni isolates (73/81). The tet(A) locus was only found in 6.5% of Campylobacter spp. isolates (11/169). More specifically, eight C. jejuni and only three C. coli isolates were harboring the tet(A) gene. It should also be noted that we found two C. coli isolates positive for both tet(O) and tet(A) genes. None of the Campylobacter isolates was found positive for the tet(B) resistance gene.
Concerning the ciprofloxacin resistant isolates (n = 46), they all hosted the mutant type Thr-86-Ile region of the quinolone resistance-determining region (QRDR) of the gyrA gene.
In all erythromycin resistant isolates (n = 24), the transitional mutations A2075G and A2074C in the 23S rRNA gene were only amplified. The ermB gene was not identified in any isolate.
In a significant number of the isolates tested for the presence of efflux pumps as a resistance mechanism, the cmeB gene was amplified. More specifically, 23.1% of the C. coli (n = 21) and 4.6% of C. jejuni (n = 4) that were characterized as resistant in at least one of the antibiotic classes, were found to harbor the cmeB gene.
No significant differences were revealed between C. coli and C. jejuni in all but one of the above percentages. More specifically, the presence of the cmeB gene was more frequently (p < 0.05) amplified in the resistant C. coli compared with the C. jejuni isolates.
The frequencies of common mutations and genes conferring resistance to fluoroquinolones, tetracyclines, macrolides, and influx pumps are presented in Table 4.

4. Discussion

The AMR rates recorded in our study and more specifically the low and very low rates of erythromycin and gentamicin resistance, are in line with the results reported in the EFSA-ECDC summary report on antimicrobial resistance for 2017. The median EU resistance rates for tetracycline were 51.5%, and for erythromycin and gentamicin, 15.6% and 7.7%, respectively, in 979 C. coli isolates from fattening pigs. In regards to fluoroquinolones such as ciprofloxacin, we have determined a significant lower rate of resistance compared to 52.3% of the EFSA report [29]. Moreover, for erythromycin resistance, the low rates of resistance that we have recorded are in great difference with the data from China [30], where Tang et al. found that all 23 (100%) C. coli isolates from pigs and overall 75.3% of Campylobacter isolates from poultry and pigs were resistant to erythromycin. These differences can be attributed to the fact that macrolides, including erythromycin, are the only antibiotics authorized by the Chinese government for use as feed additives [31].
For tetracycline, the median EU resistance rate for 2017 was 51.5%. Spain has recorded in the EFSA-ECDC summary report on antimicrobial resistance for 2017, a 65.3% of resistance to tetracycline from Campylobacter isolates in fattening pigs. On the contrary, we recorded extremely high AMR rates for the specific antibiotic, exceeding 84% of the total isolates. Higher than the median EU rate but not as high as in our study rates, tetracycline resistance from pigs investigated in China were 64% of the Campylobacter isolates resistant to tetracycline [30]. In accordance with our findings, Padungtod et al. (2006) [32] reported 88% tetracylcin resistance in Campylobacter isolates from pigs in Northern Thailand.
The EU median for MDR C. coli according to the EFSA report [29] was 21.2%. We recorded that MDR Campylobacter spp. isolates were relatively lower (12.5%), in particular 15% for C. coli and 10% for C. jejuni. The most common MDR phenotypes identified in the current study (CipEryTet and CipGmTet) are those recognized by the EFSA report.
According to the third joint inter-agency report on integrated analysis of antimicrobial agent consumption and occurrence of antimicrobial resistance in bacteria from humans and food-producing animals in the EU/EEA, titled “Antimicrobial consumption and resistance in bacteria from humans and animals” (ECDC, EFSA, EMA, 2021), consumption of tetracyclines in food-producing animals in Greece for the year 2018 (48.9 mg/PCU) far exceeded the mean value of the 31 countries included (31.7 mg/PCU), ranking sixth overall [33]. The extensive use of tetracyclines in livestock production may be related with the high rates of resistance.
On the contrary, consumption of macrolides (4.1 mg/PCU) significantly lagged behind the European mean value (8.0 mg/PCU), whereas consumption of both fluoroquinolones and aminoglycosides (2.2 and 6.5 mg/PCU, respectively) was very close to the overall means (2.5 and 6.4 mg/PCU, respectively) [33]. It is noted that meropenem is not authorized for use in food-producing animals, at least within the European Union, and since it belongs to Category A (Avoid), according to the EMA/CVMP/CHMP classification (2019), its use is exceptionally allowed in companion animals only. Antibiotic consumption data that indicate limited to moderate use of macrolides, aminoglycosides, and fluroquinolones in livestock production could explain the moderate and low resistance rates in the specific classes of antibiotics. Moreover, the susceptibility of all Campylobacter isolates to meropenem is related with the fact that it is not authorized for use in livestock production.
The principle molecular mechanism for ciprofloxacin resistance of Campylobacter is the alteration of codon 86 from threonine to isoleucine in the gyrA genomic region [34]. All the ciprofloxacin phenotypically resistant Campylobacter isolates in our study shared the same mechanism. Our findings are similar to Woźniak-Biel et al. (2016) [35] and El-Adawy et al. (2012) [36], who revealed the same mutation in all ciprofloxacin-resistant Campylobacter strains from broilers and turkeys, respectively. Moreover, Tang et al. [30] characterized the T86I amino acid substitution as the sole mutation recorded in quinolones resistant Campylobacter isolates from poultry and pigs.
Concerning the macrolides molecular mechanism of action for resistance, we did not detect the presence of the ermB gene in any of the isolates tested. Erythromycin resistance in all Campylobacter isolates was determined by detecting point mutations at position 2075 and 2074 in the V 23S rRNA gene. The high resistance levels observed in our study (MIC ≥ 32 mg/L) are in agreement with the correlation of the specific resistance mechanism with high resistance levels [37]. On the other hand, our results are in divergence with those revealed by Tang et al. [30], where 52.7% of Campylobacter isolates, mainly from poultry, were found positive for the ermB gene. Furthermore, more than half of the ermB-positive isolates also demonstrated the A2075G 23S rRNA mutation. Only three Campylobacter isolates from pigs were found to carry the ermB gene.
In 92.3% of all Campylobacter isolates (n = 156), the specific tet(O) gene was amplified providing evidence that resistance against tetracycline was mediated mainly through the gene, whereas in only 6.5% (n = 11) of all isolates, the tet(A) gene was identified. These results are in accordance with several previous studies [27,30,38,39] referring to the tet(O) gene as the principal mechanism of tetracycline resistance in Campylobacter isolates from different sources (animal, human, food).
The cmeB efflux pump is not only related with fluoroquinolone resistance, but with resistance to multiple antibiotics (macrolides, chloramphenicol, tetracycline), dyes (acridine orange), and disinfectants, as well [28,40,41]. The cmeB gene was amplified in 14.1% (n = 25) of all Campylobacter isolates. These findings are similar to those reported previously from Campylobacter isolated from turkeys [34]. Significant differences were recorded between the two Campylobacter species concerning the presence of the cmeB gene. The specific gene was amplified in 21 C. coli (23.1%) isolates and only in four C. jejuni isolates (4.7%).

5. Conclusions

This study was designed to assess the phenotypic and molecular patterns of resistance of C. coli and C. jejuni isolates from commercial farrow-finisher pig farms in Greece.
Fluoroquinolones and macrolides have been classified as category I and category II antimicrobials, respectively and are characterized as “first line” antibiotics for campylobacteriosis treatment. The high rates of resistance in tetracyclines and the moderate rates of fluoroquinolones resistance highlight the necessity for a continuous and systematic monitoring and surveillance of Campylobacter isolates from pig farms, regarding their phenotypic and molecular resistance patterns. Monitoring Campylobacter isolates susceptibility and the proper use of antimicrobials in livestock production are considered of great importance in order to tackle antimicrobial resistance and the spread of antimicrobial resistance pathogens and resistance genes.

Author Contributions

Conceptualization, D.P., E.P. and S.K.K.; methodology, D.P., K.P., I.A.G. and G.P.; investigation, D.P., G.D., V.E. and I.F.; writing—original draft preparation, D.P., E.P. and I.A.G.; writing—review and editing M.H. and S.K.K.; supervision, E.P., M.H. and S.K.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

All animal manipulations were carried out according to the EU Directive on the protection of animals’ usage for scientific purposes (2010/63/EU) that was approved by the General Assembly of the Veterinary Faculty of Aristotle University of Thessaloniki decision 44/17–9-2014.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, e05926. [CrossRef] [Green Version]
  2. Altekruse, S.F.; Stern, N.J.; Fields, P.I.; Swerdlow, D.L. Campylobacter jejuni—An Emerging Foodborne Pathogen. Emerg. Infect. Dis. 1999, 5, 28–35. [Google Scholar] [CrossRef]
  3. Nachamkin, I.; Mishu Allos, B.; Ho, T. Campylobacter species and Guillain-Barré Syndrome. Clin. Microbiol. Rev. 1998, 11((3)), 555–567. [Google Scholar] [CrossRef] [Green Version]
  4. Mishu, B.; Blaser, M.J. Role of infection due to Campylobacter jejuni in the initiation of Guillain-Barre syndrome. Clin. Infect. Dis. 1993, 17, 104–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Pope, J.E.; Krizova, A.; Garg, A.X.; Thiessen-Philbrook, H.; Ouimet, J.M. Campylobacter Reactive Arthritis: A Systematic Review. Semin. Arthritis Rheum. 2007, 37, 48–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Spiller, R.C.; Jenkins, D.; Thornley, J.P.; Hebden, J.M.; Wright, T.; Skinner, M.; Neal, K.R. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 2000, 47, 804–811. [Google Scholar] [CrossRef] [PubMed]
  7. WHO. Estimates of the Global Burden of Foodborne Diseases: Foodborne Disease Burden Epidemiology Reference Group 2007–2015; WHO: Geneva, Switzerland, 2018. [Google Scholar]
  8. Silva, J.; Leite, D.; Fernandes, M.; Mena, C.; Gibbs, P.A.; Teixeira, P. Campylobacter spp. as a Foodborne Pathogen: A Review. Front. Microbiol. 2011, 2, 200. [Google Scholar] [CrossRef] [Green Version]
  9. Harvey, R.B.; Young, C.R.; Ziprin, R.L.; Hume, M.E.; Genovese, K.J.; Anderson, R.C.; Droleskey, R.E.; Stanker, L.H.; Nisbet, D.J. Prevalence of Campylobacter species isolated from the intestinal tract of pigs raised in an integrated swine production system. J. Am. Vet. Med. Assoc. 1999, 215, 1601–1604. [Google Scholar]
  10. Madden, R.; Moran, L.; Scates, P. Optimising recovery of Campylobacter spp. from the lower porcine gastrointestinal tract. J. Microbiol. Methods 2000, 42, 115–119. [Google Scholar] [CrossRef]
  11. Jensen, A.N.; Andersen, M.T.; Dalsgaard, A.; Baggesen, D.L.; Nielsen, E.M. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples. J. Appl. Microbiol. 2005, 99, 292–300. [Google Scholar] [CrossRef] [Green Version]
  12. Boes, J.; Nersting, L.; Nielsen, E.M.; Kranker, S.; Enøe, C.; Wachmann, H.C.; Baggesen, D.L. Prevalence and Diversity of Campylobacter jejuni in Pig Herds on Farms with and without Cattle or Poultry. J. Food Prot. 2005, 68, 722–727. [Google Scholar] [CrossRef]
  13. Alter, T.; Gaull, F.; Kasimir, S.; Gürtler, M.; Mielke, H.; Linnebur, M.; Fehlhaber, K. Prevalences and transmission routes of Campylobacter spp. strains within multiple pig farms. Vet. Microbiol. 2005, 108, 251–261. [Google Scholar] [CrossRef]
  14. Varela, N.P.; Friendship, R.M.; Dewey, C.E. Prevalence of Campylobacter spp. isolated from grower-finisher pigs in Ontario. Can. Vet. J. 2007, 48, 515–517. [Google Scholar]
  15. Soultos, N.; Madden, R.H. A genotyping colonization of piglets by Campylobacter coli, in the first 10 weeks of life. J. Appl. Microbiol. 2007, 102, 916–920. [Google Scholar] [CrossRef] [PubMed]
  16. Young, K.T.; Davis, L.M.; DiRita, V.J. Campylobacter jejuni: Molecular biology and pathogenesis. Nat. Rev. Genet. 2007, 5, 665–679. [Google Scholar] [CrossRef] [PubMed]
  17. Doyle, L.P.A. Vibrio associated with pig dysentery. Amer. J. Vet. Res. 1944, 514, 3–5. [Google Scholar]
  18. Doyle, L.P.A. The etiology of pig dysentery. Amer. J. Vet. Res. 1948, 9, 50–53. [Google Scholar]
  19. Sala, V.; Piccinini, R.; Socci, A. Localization and characteristics of pig thermophilic Campylobacter in carriers of experimentally conditioned animals. Clin. Vet. 1986, 109, 236–242. [Google Scholar]
  20. Protocol for PCR Amplification of C. Jejuni and C. Coli; Recommended by the EURL-AR, 2nd Version; National Food Institute DTU: Kongens Lyngby, Denmark, 2013.
  21. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 11.0; European Committee on Antimicrobial Susceptibility Testing: Vaxjo, Sweden, 2021. [Google Scholar]
  22. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  23. Zirnstein, G.; Li, Y.; Swaminathan, B.; Angulo, F. Ciprofloxacin resistance in Campylobacter jejuni isolates: Detection of gyrA resistance mutations by mismatch amplification mutation assay PCR and DNA sequence analysis. J. Clin. Microbiol. 1999, 37, 3276–3280. [Google Scholar] [CrossRef] [Green Version]
  24. Zirnstein, G.; Helsel, L.; Li, Y.; Swaminathan, B.; Besser, J. Characterization of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli by DNA sequence analysis and MAMA PCR. FEMS Microbiol. Lett. 2000, 190, 1–7. [Google Scholar] [CrossRef] [Green Version]
  25. Alonso, R.; Mateo, E.; Churruca, E.; Martenez, I.; Girbau, C.; Fernandez-Astorga, A. MAMA-PCR assay for the detection of point mutations associated with high-level erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains. J. Microbiol. Methods 2005, 63, 99–103. [Google Scholar] [CrossRef] [PubMed]
  26. Qin, S.; Wang, Y.; Zhang, Q.; Zhang, M.; Deng, F.; Shen, Z.; Wu, C.; Wang, S.; Zhang, J.; Shen, J. Report of ribosomal RNA methylase gene erm(B) in multidrug-resistant Campylobacter coli. J. Antimicrob. Chemother. 2013, 69, 964–968. [Google Scholar] [CrossRef] [Green Version]
  27. Abdi-Hachesoo, B.; Khoshbakht, R.; Sharifiyazdi, H.; Tabatabaei, M.; Hosseinzadeh, S.; Asasi, K. Tetracycline Resistance Genes in Campylobacter jejuni and C. coli Isolated From Poultry Carcasses. Jundishapur J. Microbiol. 2014, 7, e12129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Pumbwe, L.; Piddock, L.J. Identification and molecular characterisation of CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS Microbiol. Lett. 2002, 206, 185–189. [Google Scholar] [CrossRef] [Green Version]
  29. Collective Eurosurveillance Editorial Team. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. EFSA J. 2019, 17, e05598. [Google Scholar] [CrossRef]
  30. Tang, M.; Zhou, Q.; Zhang, X.; Zhou, S.; Zhang, J.; Tang, X.; Lu, J.; Gao, Y. Antibiotic Resistance Profiles and Molecular Mechanisms of Campylobacter From Chicken and Pig in China. Front. Microbiol. 2020, 11, 592496. [Google Scholar] [CrossRef] [PubMed]
  31. Organisation for Economic Co-operation and Development. Antibiotic Use and Antibiotic Resistance in Food Producing Animals in China; Organisation for Economic Co-operation and Development: Paris, France, 2018. [Google Scholar]
  32. Padungtod, P.; Kaneene, J.B.; Hanson, R.; Morita, Y.; Boonmar, S. Antimicrobial resistance in Campylobacter isolated from food animals and humans in northern Thailand. FEMS Immunol. Med. Microbiol. 2006, 47, 217–225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. European Centre for Disease Prevention and Control (ECDC); European Food Safety Authority (EFSA); European Medicines Agency (EMA). Joint Scientific Opinion on a list of outcome indicators as regards surveillance of antimicrobial resistance and antimicrobial consumption in humans and food-producing animals. EFSA J. 2017, 15(10), 5017. [Google Scholar]
  34. Said, M.M.; El-Mohamady, H.; El-Beih, F.M.; Rockabrand, D.M.; Ismail, T.F.; Monteville, M.R.; Ahmed, S.F.; Klena, J.D.; Salama, M.S. Detection of gyrA Mutation Among Clinical Isolates of Campylobacter jejuni Isolated in Egypt by MAMA-PCR. J. Infect. Dev. Ctries. 2010, 4, 546–554. [Google Scholar] [CrossRef] [Green Version]
  35. Woźniak-Biel, A.; Bugla-Płoskońska, G.; Kielsznia, A.; Korzekwa, K.; Tobiasz, A.; Korzeniowska-Kowal, A.; Wieliczko, A. High Prevalence of Resistance to Fluoroquinolones and TetracyclineCampylobacterSpp. Isolated from Poultry in Poland. Microb. Drug Resist. 2018, 24, 314–322. [Google Scholar] [CrossRef] [PubMed]
  36. El-Adawy, H.; Hotzel, H.; Düpre, S.; Tomaso, H.; Neubauer, H.; Hafez, H.M. Determination of antimicrobial sensitivities of Campylobacter jejuni isolated from commercial turkey farms in Germany. Avian Dis. 2012, 56, 685–692. [Google Scholar] [CrossRef]
  37. Maćkiw, E.; Korsak, D.; Rzewuska, K.; Tomczuk, K.; Rożynek, E. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from food in Poland. Food Control 2012, 23, 297–301. [Google Scholar] [CrossRef]
  38. Pratt, A.; Korolik, V. Tetracycline resistance of Australian Campylobacter jejuni and Campylobacter coli isolates. J. Antimicrob. Chemother. 2005, 55, 452–460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Du, Y.; Wang, C.; Ye, Y.; Liu, Y.; Wang, A.; Li, Y.; Zhou, X.; Pan, H.; Zhang, J.; Xu, X. Molecular Identification of Multidrug-Resistant Campylobacter Species From Diarrheal Patients and Poultry Meat in Shanghai, China. Front. Microbiol. 2018, 9, 1642. [Google Scholar] [CrossRef]
  40. Lin, J.; Michel, L.O.; Zhang, Q. CmeABC Functions as a Multidrug Efflux System in Campylobacter jejuni. Antimicrob. Agents Chemother. 2002, 46, 2124–2131. [Google Scholar] [CrossRef] [Green Version]
  41. Papadopoulos, D.; Petridou, E.; Filioussis, G.; Papadopoulos, T.; Papageorgiou, K.; Chatzistilianou, M.; Kritas, S. Prevalence and antibiotic resistance of Campylobacter coli and Campylobacter jejuni in Greek swine farms. Am. J. Microbiol. Immunol. 2020, 5. [Google Scholar] [CrossRef] [Green Version]
Table 2. Antimicrobial resistance phenotypes.
Table 2. Antimicrobial resistance phenotypes.
Resistance PhenotypesC. Coli
(n)
C. Jejuni
(n)
Campylobacter
Spp., (n)
%
CipEryTet107178.5
CipGenTet4313.5
EryGenTet1010.5
CipEry1231.5
CipTet59147
EryTet1231.5
Cip2352.5
Tet676012763.5
Susceptible to all antibiotics9142311.5
Total100100200100
Table 3. Antimicrobial resistance of Campylobacter coli, Campylobacter jejuni, and Campylobacter spp.
Table 3. Antimicrobial resistance of Campylobacter coli, Campylobacter jejuni, and Campylobacter spp.
Antibioticn, %C. Coli * C. Jejuni * Campylobacter Spp.
Ciprofloxacinn222446
%22 b24 b23
Erythromycinn131124
%131112
Tetracyclinen8881169
%88 a81 a84.5
Gentamicinn538
%534
Meropenemn000
%000
*: No differences in the resistance rates to each antibiotic were observed between C. coli and C. jejuni isolates. a: Significantly higher resistance rate, compared with all other investigated antimicrobials. b: Significantly higher resistance rate, compared with erythromycin, gentamicin, and meropenem; significantly lower resistance rate, compared with tetracycline.
Table 4. Frequency of common mutations and genes conferring resistance to fluoroquinolones, tetracycline, macrolides, and efflux pumps in C. jejuni and C. coli.
Table 4. Frequency of common mutations and genes conferring resistance to fluoroquinolones, tetracycline, macrolides, and efflux pumps in C. jejuni and C. coli.
Antibioticsn, %FluoroquinolonesMacrolidesTetracyclinesEfflux Pumps
Genes/mutations Thr-86-IleA2075G &
A2074C
ermBtet(O)tet(A)tet(O)& tet(A)cmeB
C. colin22130833221
%100100094.33.42.323.1 *
C. jejunin2411073804
%100100090.19.904.7 *
Campylobacter spp.n4624015611225
%100100092.36.51.214.1%
* Significant difference in the detection frequency between C. coli and C. jejuni isolates.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Papadopoulos, D.; Petridou, E.; Papageorgiou, K.; Giantsis, I.A.; Delis, G.; Economou, V.; Frydas, I.; Papadopoulos, G.; Hatzistylianou, M.; Kritas, S.K. Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms. Animals 2021, 11, 2394. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11082394

AMA Style

Papadopoulos D, Petridou E, Papageorgiou K, Giantsis IA, Delis G, Economou V, Frydas I, Papadopoulos G, Hatzistylianou M, Kritas SK. Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms. Animals. 2021; 11(8):2394. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11082394

Chicago/Turabian Style

Papadopoulos, Dimitrios, Evanthia Petridou, Konstantinos Papageorgiou, Ioannis A. Giantsis, Georgios Delis, Vangelis Economou, Ilias Frydas, Georgios Papadopoulos, Maria Hatzistylianou, and Spyridon K. Kritas. 2021. "Phenotypic and Molecular Patterns of Resistance among Campylobacter coli and Campylobacter jejuni Isolates, from Pig Farms" Animals 11, no. 8: 2394. https://0-doi-org.brum.beds.ac.uk/10.3390/ani11082394

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop