Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sampling Design and Sample Collection
2.3. Bacteria and Antibiotic Susceptibility Test
2.4. Detection of Antibiotic Resistance and Virulence Factors Genes
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Riley, L.W. Distinguishing Pathovars from Nonpathovars: Escherichia coli. Microbiol. Spectr. 2020, 8. [Google Scholar] [CrossRef]
- Pitout, J.D. Extraintestinal Pathogenic Escherichia coli: A Combination of Virulence with Antibiotic Resistance. Front. Microbiol. 2012, 3, 9. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Madec, J.Y.; Lupo, A.; Schink, A.K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial Resistance in Escherichia coli. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zając, M.; Sztromwasser, P.; Bortolaia, V.; Leekitcharoenphon, P.; Cavaco, L.M.; Ziȩtek-Barszcz, A.; Hendriksen, R.S.; Wasyl, D. Occurrence and Characterization of mcr-1-Positive Escherichia coli Isolated from Food-Producing Animals in Poland, 2011–2016. Front. Microbiol. 2019, 10, 1753. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization. WHO List of Critically Important Antimicrobials for Human Medicine (WHO CIA List). Available online: https://www.who.int/publications/i/item/9789241515528 (accessed on 30 September 2021).
- Livermore, D.M.; Warner, M.; Hall, L.M.C.; Enne, V.I.; Projan, S.J.; Dunman, P.M.; Wooster, S.L.; Harrison, G. Antibiotic resistance in bacteria from magpies (Pica pica) and rabbits (Oryctolagus cuniculus) from west Wales. Environ. Microbiol. 2001, 3, 658–661. [Google Scholar] [CrossRef] [PubMed]
- Mughini-Gras, L.; Dorado-García, A.; van Duijkeren, E.; van den Bunt, G.; Dierikx, C.M.; Bonten, M.J.M.; Bootsma, M.C.J.; Schmitt, H.; Hald, T.; Evers, E.G.; et al. Attributable sources of community-acquired carriage of Escherichia coli containing β-lactam antibiotic resistance genes: A population-based modelling study. Lancet Planet. Health 2019, 3, e357–e369. [Google Scholar] [CrossRef] [Green Version]
- Palmeira, J.D.; Cunha, M.V.; Carvalho, J.; Ferreira, H.; Fonseca, C.; Torres, R.T. Emergence and Spread of Cephalosporinases in Wildlife: A Review. Animals 2021, 11, 1765. [Google Scholar] [CrossRef] [PubMed]
- Furlan, J.P.R.; Savazzi, E.A.; Stehling, E.G. Widespread high-risk clones of multidrug-resistant extended-spectrum β-lactamase- producing Escherichia coli B2-ST131 and F-ST648 in public aquatic environments. Int. J. Antimicrob. Agents 2020, 56, 106040. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Jiang, Z.G.; Xia, L.N.; Shen, J.Z.; Dai, L.; Wang, Y.; Huang, S.Y.; Wu, G.M. Characterization of antimicrobial resistance and molecular determinants of β-lactamase in Escherichia coli isolated from chickens in China during 1970–2007. Vet. Microbiol. 2010, 144, 505–510. [Google Scholar] [CrossRef]
- Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carattoli, A.; Villa, L.; Feudi, C.; Curcio, L.; Orsini, S.; Luppi, A.; Pezzotti, G.; Magistrali, C.F. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. EuroSurveillance 2017, 22, 30589. [Google Scholar] [CrossRef] [Green Version]
- Bachiri, T.; Lalaoui, R.; Bakour, S.; Allouache, M.; Belkebla, N.; Rolain, J.M.; Touati, A. First Report of the Plasmid-Mediated Colistin Resistance Gene mcr-1 in Escherichia coli ST405 Isolated from Wildlife in Bejaia, Algeria. Microb. Drug. Resist. 2018, 24, 890–895. [Google Scholar] [CrossRef]
- Lu, X.; Xiao, X.; Liu, Y.; Huang, S.; Li, R.; Wang, Z. Widespread Prevalence of Plasmid-Mediated Colistin Resistance Genemcr-1 in Escherichia coli from Père David’s Deer in China. mSphere 2020, 5, e01221-20. [Google Scholar] [CrossRef]
- Tolosi, R.; Apostolakos, I.; Laconi, A.; Carraro, L.; Grilli, G.; Cagnardi, P.; Piccirillo, A. Rapid detection and quantification of plasmid-mediated colistin resistance genes (mcr-1 to mcr-5) by real-time PCR in bacterial and environmental samples. J. Appl. Microbiol. 2020, 129, 1523–1529. [Google Scholar] [CrossRef]
- Cilia, G.; Turchi, B.; Fratini, F.; Ebani, V.V.; Turini, L.; Cerri, D.; Bertelloni, F. Phenotypic and genotypic resistance to colistin in E. coli isolated from wild boar (Sus scrofa) hunted in Italy. Eur. J. Wildl. Res. 2021, 67, 57. [Google Scholar] [CrossRef]
- Torres, R.T.; Cunha, M.V.; Araujo, D.; Ferreira, H.; Fonseca, C.; Palmeira, J.D. Emergence of colistin resistance genes (mcr-1) in Escherichia coli among widely distributed wild ungulates. Environ. Pollut. 2021, 291, 118136. [Google Scholar] [CrossRef]
- Rega, M.; Carmosino, I.; Bonilauri, P.; Frascolla, V.; Vismarra, A.; Bacci, C. Prevalence of EsβL, AmpC and Colistin-Resistant E. coli in Meat: A Comparison between Pork and Wild Boar. Microorganisms 2021, 9, 214. [Google Scholar] [CrossRef]
- Olaitan, A.O.; Thongmalayvong, B.; Akkhavong, K.; Somphavong, S.; Paboriboune, P.; Khounsy, S.; Morand, S.; Rolain, J.M. Clonal transmission of a colistin-resistant Escherichia coli from a domesticated pig to a human in Laos. J. Antimicrob. Chemother. 2015, 70, 3402–3404. [Google Scholar] [CrossRef] [Green Version]
- European Medicines Agency. Updated Advice on the Use of Colistin Products in Animals within the European Union: Development of Resistance and Possible Impact on Human and Animal Health. EMA/CVMP/CHMP/231573.1-56. Available online: https://www.ema.europa.eu/en/documents/scientific-guideline/updated-advice-use-colistin-products-animals-within-european-union-development-resistance-possible_en-0.pdf (accessed on 30 September 2021).
- Walsh, T.R.; Wu, Y. China bans colistin as a feed additive for animals. Lancet Infect. Dis. 2016, 16, 1102–1103. [Google Scholar] [CrossRef]
- European Medicines Agency, European Surveillance of Veterinary Antimicrobial Consumption, 2021. ‘Sales of veterinary antimicrobial Agents in 31 European Countries in 2019 and 2020’. (EMA/58183/2021). Available online: https://www.ema.europa.eu/en/documents/report/sales-veterinary-antimicrobial-agents-31-european-countries-2019-2020-trends-2010-2020-eleventh_en.pdf (accessed on 30 September 2021).
- Zhang, S.; Abbas, M.; Rehman, M.U.; Wang, M.; Jia, R.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Gao, Q.; et al. Updates on the global dissemination of colistin-resistant Escherichia coli: An emerging threat to public health. Sci. Total Environ. 2021, 799, 149280. [Google Scholar] [CrossRef]
- Ramey, A.M.; Ahlstrom, C.A. Antibiotic resistant bacteria in wildlife: Perspectives on trends, acquisition and dissemination, data gaps, and future directions. J. Wildl. Dis. 2020, 56, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Torres, R.T.; Carvalho, J.; Cunha, M.V.; Serrano, E.; Palmeira, J.D.; Fonseca, C. Temporal and geographical research trends of antimicrobial resistance in wildlife—A bibliometric analysis. One Health 2020, 11, 100198. [Google Scholar] [CrossRef]
- EUCAST 2021 The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 11.0. 2021. Available online: https://www.eucast.org/clinical_breakpoints/ (accessed on 30 September 2021).
- EUCAST. Antimicrobial Wild Type Distributions of Microorganisms. Available online: https://mic.eucast.org/Eucast2/ (accessed on 30 September 2021).
- Turchi, B.; Dec, M.; Bertelloni, F.; Winiarczyk, S.; Gnat, S.; Bresciani, F.; Viviani, F.; Cerri, D.; Fratini, F. Antibiotic Susceptibility and Virulence Factors in Escherichia coli from Sympatric Wildlife of the Apuan Alps Regional Park (Tuscany, Italy). Microb. Drug Resist. 2019, 25, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. EuroSurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef]
- Jousset, A.B.; Bernabeu, S.; Bonnin, R.A.; Creton, E.; Cotellon, G.; Sauvadet, A.; Naas, T.; Dortet, L. Development and validation of a multiplex polymerase chain reaction assay for detection of the five families of plasmid-encoded colistin resistance. Int. J. Antimicrob. Agents 2019, 53, 302–309. [Google Scholar] [CrossRef]
- Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel Plasmid-Mediated Colistin Resistance Gene mcr-3 in Escherichia coli. mBio 2017, 8, e00543-17. [Google Scholar] [CrossRef] [Green Version]
- Kikuvi, G.M.; Ombui, J.N.; Mitema, E.S. Serotypes and antimicrobial resistance profiles of Salmonella isolates from pigs at slaughter in Kenya. J. Infect. Dev. Ctries 2010, 4, 243–248. [Google Scholar] [CrossRef] [Green Version]
- Hatrongjit, R.; Kerdsin, A.; Akeda, Y.; Hamada, S. Detection of plasmid-mediated colistin-resistant and carbapenem-resistant genes by multiplex PCR. MethodsX 2018, 5, 532–536. [Google Scholar] [CrossRef]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. Beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [Green Version]
- Arlet, G.; Rouveau, M.; Philippon, A. Substitution of alanine for aspartate at position 179 in the SHV-6 extended-spectrum beta-lactamase. FEMS Microbiol. Lett. 1997, 152, 163–167. [Google Scholar] [CrossRef]
- Kim, J.; Kwon, Y.; Pai, H.; Kim, J.W.; Cho, D.T. Survey of Klebsiella pneumoniae strains producing extended- spectrum beta-lactamases: Prevalence of SHV-12 and SHV-2a in Korea. J. Clin. Microbiol. 1998, 36, 1446–1449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Müller, D.; Greune, L.; Heusipp, G.; Karch, H.; Fruth, A.; Tschäpe, H.; Schmidt, M.A. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 2007, 73, 3380–3390. [Google Scholar] [CrossRef] [Green Version]
- Paton, A.W.; Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [CrossRef] [Green Version]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef]
- Carretto, E.; Brovarone, F.; Nardini, P.; Russello, G.; Barbarini, D.; Pongolini, S.; Gagliotti, C.; Carattoli, A.; Sarti, M. Detection of mcr-4 positive Salmonella enterica serovar Typhimurium in clinical isolates of human origin, Italy, October to November 2016. Euro Surveill. 2018, 23, 17–00821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marchetti, V.M.; Bitar, I.; Sarti, M.; Fogato, E.; Scaltriti, E.; Bracchi, C.; Hrabak, J.; Pongolini, S.; Migliavacca, R. Genomic Characterization of VIM and MCR Co-Producers: The First Two Clinical Cases, in Italy. Diagnostics 2021, 11, 79. [Google Scholar] [CrossRef]
- Darwich, L.; Vidal, A.; Seminati, C.; Albamonte, A.; Casado, A.; López, F.; Molina-López, R.A.; Migura-Garcia, L. High prevalence and diversity of extended-spectrum β- lactamase and emergence of OXA-48 producing Enterobacterales in wildlife in Catalonia. PLoS ONE 2019, 14, e0210686. [Google Scholar] [CrossRef] [Green Version]
- Darwich, L.; Seminati, C.; López-Olvera, J.R.; Vidal, A.; Aguirre, L.; Cerdá, M.; Garcias, B.; Valldeperes, M.; Castillo-Contreras, R.; Migura-Garcia, L.; et al. Detection of Beta-Lactam-Resistant Escherichia coli and Toxigenic Clostridioides difficile Strains in Wild Boars Foraging in an Anthropization Gradient. Animals 2021, 11, 1585. [Google Scholar] [CrossRef]
- Formenti, N.; Calò, S.; Parisio, G.; Guarneri, F.; Birbes, L.; Pitozzi, A.; Scali, F.; Tonni, M.; Guadagno, F.; Giovannini, S.; et al. ESBL/AmpC-Producing Escherichia coli in Wild Boar: Epidemiology and Risk Factors. Animals 2021, 11, 1855. [Google Scholar] [CrossRef]
- Literak, I.; Dolejska, M.; Radimersky, T.; Klimes, J.; Friedman, M.; Aarestrup, F.M.; Hasman, H.; Cizek, A. Antimicrobial- resistant faecal Escherichia coli in wild mammals in central Europe: Multiresistant Escherichia coli producing extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 2010, 108, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
- Poeta, P.; Radhouani, H.; Pinto, L.; Martinho, A.; Rego, V.; Rodrigues, R.; Goncalves, A.; Rodrigues, J.; Estepa, V.; Torres, C.; et al. Wild boars as reservoirs of extended-spectrum beta-lactamase (ESBL) producing Escherichia coli of different phylogenetic groups. J. Basic Microbiol. 2009, 49, 584–588. [Google Scholar] [CrossRef] [PubMed]
- Bachiri, T.; Bakour, S.; Lalaoui, R.; Belkebla, N.; Allouache, M.; Rolain, J.M.; Touati, A. Occurrence of Carbapenemase-Producing Enterobacteriaceae Isolates in the Wildlife: First Report of OXA-48 in Wild Boars in Algeria. Microb. Drug Resist. 2018, 24, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Vasco, K.; Nohomovich, B.; Singh, P.; Venegas-Vargas, C.; Mosci, R.E.; Rust, S.; Bartlett, P.; Norby, B.; Grooms, D.; Zhang, L.; et al. Characterizing the Cattle Gut Microbiome in Farms with a High and Low Prevalence of Shiga Toxin Producing Escherichia coli. Microorganisms 2021, 9, 1737. [Google Scholar] [CrossRef] [PubMed]
- Pruimboom-Brees, I.M.; Morgan, T.W.; Ackermann, M.R.; Nystrom, E.D.; Samuel, J.E.; Cornick, N.A.; Moon, H.W. Cattle Lack Vascular Receptors for Escherichia coli O157:H7 Shiga Toxins. Proc. Natl. Acad. Sci. USA 2000, 97, 10325–10329. [Google Scholar] [CrossRef] [Green Version]
- Lauzi, S.; Luzzago, C.; Chiani, P.; Michelacci, V.; Knijn, A.; Pedrotti, L.; Corlatti, L.; Buccheri Pederzoli, C.; Scavia, G.; Morabito, S.; et al. Free-ranging red deer (Cervus elaphus) as carriers of potentially zoonotic Shiga toxin-producing Escherichia coli. Transbound Emerg. Dis. 2021. [Google Scholar] [CrossRef] [PubMed]
- Caprioli, A.; Morabito, S.; Brugère, H.; Oswald, E. Enterohaemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet. Res. 2005, 36, 289–311. [Google Scholar] [CrossRef] [Green Version]
- Lagerstrom, K.M.; Hadly, E.A. The under-investigated wild side of Escherichia coli: Genetic diversity, pathogenicity and antimicrobial resistance in wild animals. Proc. Biol. Sci. 2021, 288, 20210399. [Google Scholar] [CrossRef] [PubMed]
- White, A.; Hughes, J.M. Critical Importance of a One Health Approach to Antimicrobial Resistance. Ecohealth 2019, 16, 404–409. [Google Scholar] [CrossRef] [Green Version]
Groups | Animals | Number of Fecal Pools |
---|---|---|
A | Goat (n = 120) | 3 |
Apennine chamois (n = 100) | 2 | |
Sheep (n = 300) | 3 | |
Red deer (n = 50) | 4 | |
B | Cattle (n = 70) | 5 |
Goat (n = 210) | 8 | |
Red deer (n = 20) | 3 | |
Apennine chamois (n = 100) | 5 |
Primer | Sequence 5′-3′ | Size (bp) | Annealing | Ref. |
---|---|---|---|---|
Mcr-1 Fw | AGTCCGTTTGTTCTTGTGGC | 320 | 56 °C | [29] |
Mcr-1 Rev | AGATCCTTGGTCTCGGCTTG | |||
Mcr-2 Fw | CAAGTGTGTTGGTCGCAGTT | 715 | ||
Mcr-2 Rev | TCTAGCCCGACAAGCATACC | |||
Mcr-5 Fw | ATGCGGTTGTCTGCATTTATC | 207 | 56 °C | [30] |
Mcr-5 Rev | TCATTGTGGTTGTCCTTTTCTG | |||
Mcr-4 Fw | ATTGGGATAGTCGCCTTTTT | 487 | 50 °C | [12] |
Mcr-4 Rev | TTACAGCCAGAATCATTATCA | |||
Mcr-3 Fw | AAATAAAAATTGTTCCGCTTATG | 542 | 50 °C | [31] |
Mcr-3 Rev | AATGGAGATCCCCGTTTTT | |||
blaTEM F | CCGTGTCGCCCTTATTCCC | 780 | 51 °C | [32] |
blaTEM R | GCCTGACTCCCCGTCGTGT | |||
IMP-F | GGAATAGAGTGGCTTAAYTCTC | 232 | 56 °C | [33] |
IMP-R | GGTTTAAYAAAACAACCACC | |||
OXA-48 F | GCGTGGTTAAGGATGAACAC | 438 | ||
OXA-48 R | CATCAAGTTCAACCCAACCG | |||
NDM-F | GGTTTGGCGATCTGGTTTTC | 621 | ||
NDM-R | CGGAATGGCTCATCACGATC | |||
KPC-F | CGTCTAGTTCTGCTGTCTTG | 790 | ||
KPC-R | CTTGTCATCCTTGTTAGGCG | |||
blaCTX-M F | ATGTGCAGYACCAGTAARGTKATGGC | 593 | 60 °C | [34] |
blaCTX-M R | TGGGTRAARTARGTSACCAGAAYCAGCGG | |||
blaCMY-2 F | GCACTTAGCCACCTATACGGCAG | 758 | ||
blaCMY-2 F | GCTTTTCAAGAATGCGCCAGG | |||
blaSHV F | TTATCTCCCTGTTAGCCACC | 797 | 60 °C | [35] |
blaSHV R | GATTTGCTGATTTCGCTCGG | |||
blaCMY-1 F | ATGCAACAACGACAATCC | 1085 | 58 °C | [36] |
blaCMY-1 R | TTGGCCAGCATGACGATG | |||
escV F | ATTCTGGCTCTCTTCTTCTTTATGGCTG | 544 | 62 °C | [37] |
escV R | CGTCCCCTTTTACAAACTTCATCGC | |||
astA F | TGCCATCAACACAGTATATCCG | 102 | ||
astA R | ACGGCTTTGTAGTCCTTCCAT | |||
eaeA F | GACCCGGCACAAGCATAAGC | 384 | 65 °C | [38] |
eaeA R | CCACCTGCAGCAACAAGAGG | |||
stx1 F | ATAAATCGCCATTCGTTGACTAC | 180 | ||
stx1 R | AGAACGCCCACTGAGATCATC | |||
stx2 F | GGCACTGTCTGAAACTGCTCC | 255 | ||
stx2 R | TCGCCAGTTATCTGACATTCTG | |||
hlyA F | GCATCATCAAGCGTACGTTCC | 534 | ||
hlyA R | AATGAGCCAAGCTGGTTAAGCT |
Group * | Source | MIC (μg/mL) ** | Genes | |||||
---|---|---|---|---|---|---|---|---|
CTX | CAZ | ETP | MRP | CS | Resistance | Virulence | ||
A Wild (n = 8) | Red deer | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaTEM, blaCMY-2 | astA |
Red deer | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaTEM, blaCMY-2 | ||
Red deer | 0.25 | 0.12 | 0.12 | 0.25 | 3 | blaCMY-2, mcr-4 | hlyA | |
Red deer | 0.25 | 0.12 | 0.12 | 0.25 | 3 | blaCMY-2, mcr-4 | astA, stx2, hlyA | |
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaSHV | ||
Chamois | 0.5 | 64 | 0.12 | 4 | 3 | blaTEM, blaCMY-1, mcr-4, blaOXA-48 | stx1, hlyA | |
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | hlyA | ||
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 3 | astA, stx1, stx2, hlyA | ||
A Domestic (n = 6) | Sheep | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaCMY-2 | astA |
Sheep | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaCMY-1, blaCMY-2 | astA | |
Sheep | 0.25 | 0.12 | 0.12 | 0.25 | 3 | blaTEM, blaCMY-2, mcr-4 | astA | |
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | blaCMY-2 | astA, stx1, stx2 | |
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 2 | astA | ||
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 3 | mcr-4 | astA, hlyA, stx1 | |
B Wild (n = 11) | Red deer | 0.25 | 0.12 | 0.12 | 0.25 | 2 | astA | |
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | astA, stx1, hlyA | ||
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | astA, stx1, hlyA | ||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | astA, stx2, hlyA | ||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 2 | escV, eaeA, hlyA | ||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | |||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | astA, stx1, stx2, hlyA | ||
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 2 | astA, stx1, stx2, hlyA | ||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 2 | astA, hlyA | ||
Chamois | 0.25 | 0.25 | 0.12 | 0.25 | 2 | astA, stx1, stx2, hlyA | ||
Chamois | 0.25 | 0.12 | 0.12 | 0.25 | 2 | astA | ||
B Domestic (n = 13) | Goat | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | astA | |
Goat | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | astA | ||
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaCMY-1, blaCMY-2 | astA, hlyA | |
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | astA | ||
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | blaCMY-1, blaCMY-2 | astA, stx2, hlyA | |
Goat | 0.25 | 0.12 | 0.12 | 0.25 | 1.5 | astA, stx1, hlyA | ||
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 256 | blaTEM, mcr-4 | astA | |
Cattle | 0.25 | 0.25 | 0.12 | 0.25 | 1.5 | blaTEM | astA | |
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 2 | blaTEM, blaCMY-1, blaCMY-2, mcr-4 | astA | |
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 0.75 | blaTEM, blaCMY-1, blaCMY-2 | astA, stx1, stx2, hlyA | |
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 3 | blaCMY-1, blaCMY-2, mcr-4 | astA, stx1, stx2, hlyA | |
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 3 | blaCMY-1, blaCMY-2 | stx2, hlyA | |
Cattle | 0.25 | 0.12 | 0.12 | 0.25 | 3 | mcr-4 | astA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smoglica, C.; Vergara, A.; Angelucci, S.; Festino, A.R.; Antonucci, A.; Moschetti, L.; Farooq, M.; Marsilio, F.; Di Francesco, C.E. Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy. Animals 2022, 12, 129. https://0-doi-org.brum.beds.ac.uk/10.3390/ani12020129
Smoglica C, Vergara A, Angelucci S, Festino AR, Antonucci A, Moschetti L, Farooq M, Marsilio F, Di Francesco CE. Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy. Animals. 2022; 12(2):129. https://0-doi-org.brum.beds.ac.uk/10.3390/ani12020129
Chicago/Turabian StyleSmoglica, Camilla, Alberto Vergara, Simone Angelucci, Anna Rita Festino, Antonio Antonucci, Lorenzo Moschetti, Muhammad Farooq, Fulvio Marsilio, and Cristina Esmeralda Di Francesco. 2022. "Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy" Animals 12, no. 2: 129. https://0-doi-org.brum.beds.ac.uk/10.3390/ani12020129