Bacterial Periodontitis in Horses: An Epidemiological Study in Southern Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.1.1. DNA Extraction from Oral Swabs
2.1.2. Multiplex Real-Time PCR
2.1.3. Data Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Penzhorn, B.L. Dental abnormalities in free-ranging Cape mountain zebras (Equus zebra zebra). J. Wildl. Dis. 1984, 20, 161–166. [Google Scholar] [CrossRef] [PubMed]
- Lindhe, J.; Hamp, S.; Loe, H. Experimental periodontitis in the beagle dog. J. Periodontal Res. 1973, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Albuquerque, C.; Morinha, F.; Requicha, J.; Martins, T.; Dias, I.; Guedes-Pinto, H.; Bastos, E.; Viegas, C. Canine periodontitis: The dog as an important model for periodontal studies. Vet. J. 2012, 191, 299–305. [Google Scholar] [CrossRef] [PubMed]
- Buonavoglia, A.; Latronico, F.; Pirani, C.; Greco, M.F.; Corrente, M.; Prati, C. Symptomatic and asymptomatic apical periodontitis associated with red complex bacteria: Clinical and microbiological evaluation. Odontology 2013, 101, 84–88. [Google Scholar] [CrossRef]
- Di Bello, A.; Buonavoglia, A.; Franchini, D.; Valastro, C.; Ventrella, G.; Greco, M.F.; Corrente, M. Periodontal disease associated with red complex bacteria in dogs. J. Small Anim. Pract. 2014, 55, 160–163. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, J.B.; Dixon, P.M.; Bastos, E.; San Roman, F.; Viegas, C. A clinical survey on the prevalence and types of cheek teeth disorders present in 400 Zamorano-Leones and 400 Mirandes donkeys (Equus asinus). Vet. Rec. 2013, 173, 581. [Google Scholar] [CrossRef]
- Du Toit, N.; Burden, F.A.; Baedt, L.G.; Shaw, D.J.; Dixon, P.M. Dimensions of diastemata and associated periodontal food pockets in donkey cheek teeth. J. Vet. Dent. 2009, 26, 10–14. [Google Scholar] [CrossRef]
- Ruiz de Arcaute, M.; Lacasta, D.; Gonzalez, J.M.; Ferrer, L.M.; Ortega, M.; Ruiz, H.; Ventura, J.A.; Ramos, J.J. Management of Risk Factors Associated with Chronic Oral Lesions in Sheep. Animals 2020, 10, 1529. [Google Scholar] [CrossRef]
- Kennedy, R.S.; Dixon, P.M. The aetiopathogenesis of equine periodontal disease—A fresh perspective. Equine Vet. Educ. 2018, 30, 161–168. [Google Scholar] [CrossRef]
- Kennedy, R.; Lappin, D.F.; Dixon, P.M.; Buijs, M.J.; Zaura, E.; Crielaard, W.; O’Donnell, L.; Bennett, D.; Brandt, B.W.; Riggio, M.P. The microbiome associated with equine periodontitis and oral health. Vet. Res. 2016, 47, 49. [Google Scholar] [CrossRef]
- Dixon, P.M.; Barakzai, S.; Collins, N.; Yates, J. Treatment of equine cheek teeth by mechanical widening of diastemata in 60 horses (2000–2006). Equine Vet. J. 2008, 40, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Dixon, P.M.; Ceen, S.; Barnett, T.; O’Leary, J.M.; Parkin, T.D.; Barakzai, S. A long-term study on the clinical effects of mechanical widening of cheek teeth diastemata for treatment of periodontitis in 202 horses (2008–2011). Equine Vet. J. 2014, 46, 76–80. [Google Scholar] [CrossRef] [PubMed]
- Carmalt, J.L. Evidence-based equine dentistry: Preventive medicine. Vet. Clin. N. Am. Equine Pract. 2007, 23, 519–524. [Google Scholar] [CrossRef] [PubMed]
- Miles, A.E.W.; Grigson, C. (Eds.) Colyer’s Variations and Diseases of the Teeth of Animals; Cambridge University Press: Cambridge, UK, 1990. [Google Scholar]
- Colyer, F. Abnormal Conditions of the Teeth of Animals in Their Relationship to Similar Conditions in Man; The Dental Board of the United Kingdom: London, UK, 1931. [Google Scholar]
- BAKER, G.J. Some Aspects of Equine Dental Disease. Equine Vet. J. 1970, 2, 105–110. [Google Scholar] [CrossRef]
- Baker, G.J.; Easley, J. Equine Dentistry, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2005; p. 368. [Google Scholar]
- Chinkangsadarn, T. Clinical and Microbiological Aspects of Periodontal Disease in Horses in South-East Queensland. Ph.D. Thesis, School of Veterinary Science, The University of Queensland, Brisbane, Australia, 2016. [Google Scholar]
- Ireland, J.L.; McGowan, C.M.; Clegg, P.D.; Chandler, K.J.; Pinchbeck, G.L. A survey of health care and disease in geriatric horses aged 30 years or older. Vet. J. 2012, 192, 57–64. [Google Scholar] [CrossRef]
- Nuttall, H.E.; Ravenhill, P.J. Prevalence and analysis of equine periodontal disease, diastemata and peripheral caries in a first-opinion horse population in the UK. Vet. J. 2019, 246, 98–102. [Google Scholar] [CrossRef]
- Klugh, D.O.; Corey, D.G. A review of equine periodontal disease. Dent. Surg. Lameness 2006, 52, 551–558. [Google Scholar]
- GERE, I.; DIXON, P.M. Post mortem survey of peripheral dental caries in 510 Swedish horses. Equine Vet. J. 2010, 42, 310–315. [Google Scholar] [CrossRef]
- Walker, H.; Chinn, E.; Holmes, S.; Barwise-Munro, L.; Robertson, V.; Mould, R.; Bradley, S.; Shaw, D.J.; Dixon, P.M. Prevalence and some clinical characteristics of equine cheek teeth diastemata in 471 horses examined in a UK first-opinion equine practice (2008 to 2009). Vet. Rec. 2012, 171, 44. [Google Scholar] [CrossRef]
- Jackson, K.; Kelty, E.; Tennant, M. Equine peripheral dental caries: An epidemiological survey assessing prevalence and possible risk factors in Western Australian horses. Equine Vet. J. 2018, 50, 79–84. [Google Scholar] [CrossRef]
- Samad, L.; Tavanaeimanesh, H.; Mehr Azin, H.; Moadab, S.H.; Vajhi, A.R. Clinical dental finding in Iranian horses. Vet. Med. Sci. 2020, 6, 679–685. [Google Scholar] [CrossRef] [PubMed]
- Theilade, E.; Wright, W.H.; Jensen, S.B.; Loe, H. Experimental gingivitis in man. II. A longitudinal clinical and bacteriological investigation. J. Periodontal Res. 1966, 1, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Mariotti, A. Dental Plaque-Induced Gingival Diseases. Ann. Periodontol. 1999, 4, 7–17. [Google Scholar] [CrossRef]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef] [PubMed]
- Hennet, P.R.; Harvey, C.E. Aerobes in Periodontal Disease in the Dog: A Review. J. Vet. Dent. 1991, 8, 11–19. [Google Scholar] [CrossRef]
- Harris, S.; Croft, J.; O’Flynn, C.; Deusch, O.; Colyer, A.; Allsopp, J.; Milella, L.; Davis, I.J. A Pyrosequencing Investigation of Differences in the Feline Subgingival Microbiota in Health, Gingivitis and Mild Periodontitis. PLoS ONE 2015, 10, e0136986. [Google Scholar] [CrossRef]
- Holt, S.C.; Ebersole, J.L. Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: The “red complex”, a prototype polybacterial pathogenic consortium in periodontitis. Periodontology 2000 2005, 38, 72–122. [Google Scholar] [CrossRef]
- Baumgartner, J.C.; Khemaleelakul, S.U.; Xia, T. Identification of spirochetes (treponemes) in endodontic infections. J. Endod. 2003, 29, 794–797. [Google Scholar] [CrossRef]
- Foschi, F.; Cavrini, F.; Montebugnoli, L.; Stashenko, P.; Sambri, V.; Prati, C. Detection of bacteria in endodontic samples by polymerase chain reaction assays and association with defined clinical signs in Italian patients. Oral Microbiol. Immunol. 2005, 20, 289–295. [Google Scholar] [CrossRef]
- Hajishengallis, G.; Lamont, R.J. Beyond the red complex and into more complexity: The polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol. Oral Microbiol. 2012, 27, 409–419. [Google Scholar] [CrossRef]
- Little, W.L. Periodontal Disease in the Horse. J. Comp. Pathol. 1913, 26, 240–249. [Google Scholar] [CrossRef]
- Dixon, P.M.; Dacre, I.; Dacre, K.; Tremaine, W.H.; McCann, J.; Barakzai, S. Standing oral extraction of cheek teeth in 100 horses (1998–2003). Equine Vet. J. 2005, 37, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Cox, A.; Dixon, P.; Smith, S. Histopathological lesions associated with equine periodontal disease. Vet. J. 2012, 194, 386–391. [Google Scholar] [CrossRef] [PubMed]
- Sykora, S.; Pieber, K.; Simhofer, H.; Hackl, V.; Brodesser, D.; Brandt, S. Isolation of Treponema and Tannerella spp. from equine odontoclastic tooth resorption and hypercementosis related periodontal disease. Equine Vet. J. 2014, 46, 358–363. [Google Scholar] [CrossRef]
- Socransky, S.S.; Gibbons, R.J.; Dale, A.C.; Bortnick, L.; Rosenthal, E.; Macdonald, J.B. The microbiota of the gingival crevice area of man. I. Total microscopic and viable counts and counts of specific organisms. Arch. Oral Biol. 1963, 8, 275–280. [Google Scholar] [CrossRef]
- Wara-Aswapati, N.; Pitiphat, W.; Chanchaimongkon, L.; Taweechaisupapong, S.; Boch, J.A.; Ishikawa, I. Red bacterial complex is associated with the severity of chronic periodontitis in a Thai population. Oral Dis. 2009, 15, 354–359. [Google Scholar] [CrossRef]
- Dugdale, A.H.; Grove-White, D.; Curtis, G.C.; Harris, P.A.; Argo, C.M. Body condition scoring as a predictor of body fat in horses and ponies. Vet. J. 2012, 194, 173–178. [Google Scholar] [CrossRef]
- Kuboniwa, M.; Amano, A.; Kimura, K.R.; Sekine, S.; Kato, S.; Yamamoto, Y.; Okahashi, N.; Iida, T.; Shizukuishi, S. Quantitative detection of periodontal pathogens using real-time polymerase chain reaction with TaqMan probes. Oral Microbiol. Immunol. 2004, 19, 168–176. [Google Scholar] [CrossRef]
- Sanchez, M.C.; Llama-Palacios, A.; Fernandez, E.; Figuero, E.; Marin, M.J.; Leon, R.; Blanc, V.; Herrera, D.; Sanz, M. An in vitro biofilm model associated to dental implants: Structural and quantitative analysis of in vitro biofilm formation on different dental implant surfaces. Dent. Mater. 2014, 30, 1161–1171. [Google Scholar] [CrossRef]
- Coffey, J.; Choudhry, M.; Shlossman, M.; Makin, I.R.S.; Singh, V.K. Multiplex real-time PCR detection and relative quantification of periodontal pathogens. Clin. Exp. Dent. Res. 2016, 2, 185–192. [Google Scholar] [CrossRef]
- Cohen, J. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.; Routledge: New York, NY, USA, 1988; p. 567. [Google Scholar]
- Gieche, J.M. How to Assess the Equine Periodontium. AAEP Proc. 2010, 56, 441–449. [Google Scholar]
- Sommerville, R.; Brown, A.F.; Upjohn, M. A standardised equine-based welfare assessment tool used for six years in low and middle income countries. PLoS ONE 2018, 13, e0192354. [Google Scholar] [CrossRef] [PubMed]
- Lee, L.; Reardon, R.J.M.; Dixon, P.M. A post-mortem study on the prevalence of peripheral dental caries in Scottish horses. Equine Vet. Educ. 2019, 31, 96–101. [Google Scholar] [CrossRef]
- Borkent, D.; Reardon, R.J.M.; McLachlan, G.; Smith, S.; Dixon, P.M. An epidemiological survey on the prevalence of equine peripheral dental caries in the United Kingdom and possible risk factors for its development. Equine Vet. J. 2017, 49, 480–485. [Google Scholar] [CrossRef]
- Vlaminck, L.; Huys, L.W.J.; Maes, D.; Steenhaut, M.; Gasthuys, F. Observations on periodontal changes after tooth extraction and possible influence of a partial tooth replacement therapy. Equine Vet. Educ. 2006, 18, 439–440. [Google Scholar]
- Bottegaro, N.B.; Kos, J.; Smolec, O.; Vnuk, D.; Matičić, D.; Pirkic, B.; Radišić, B.; Vrbanac, Z.; Selanec, J. Pathological findings in premolar and molar teeth in 100 horses during routine clinical examinations. Vet. Arh. 2012, 82, 143–153. [Google Scholar]
- Campoy, L.; Sedgwick, S.R. Standing Sedation and Iocoregional Analgesia in Equine Dental Surgery. Vet. Clin. N. Am. Equine Pract. 2020, 36, 477–499. [Google Scholar] [CrossRef]
- Moore, N.T. Clinical findings and treatment of shear mouth in two horses associated with ipsilateral painful dental disease. Equine Vet. Educ. 2016, 28, 13–19. [Google Scholar] [CrossRef]
- Sharma, A. Virulence mechanisms of Tannerella forsythia. Periodontology 2000 2010, 54, 106–116. [Google Scholar] [CrossRef]
Specie Target | Primers and Probes | Sequence (5′-3′) | Size | References | |
---|---|---|---|---|---|
Fusobacterium nucleatum | Primer | FN-For | GGCTTCCCCATCGGCATTTC | 123 bp | [44] |
FN-Rev | AATGCAGGGCTCAACTCTGT | ||||
Probe | FN-Pb | TCCGCTTACCTCTCCAG | |||
Treponema denticola | Primer | TD-For | GTTGTTCGGAATTATTGG | 109 bp | [44] |
TD-Rev | GATTCAAGTCAAGCAGTA | ||||
Probe | TD-Pb | TCACACCAGGCTTACC | |||
Veilonella parvula | Primer | VP-For | TGCTAATACCGCATACGATCTAACC | 66 bp | [43] |
VP-Rev | GCTTATAAATAGAGGCCACCTTTCA | ||||
Probe | VP-Pb | CTATCCTCGATGCCGA | |||
Porphyromonas gingivalis | Primer | PG-For | CCGTTGAAAGACGGCCTAA | 110 bp | [42] |
PG-Rev | CCCATCCCTTACCGGRA | ||||
Probe | PG-Pb | CCCGATGTGTTTCATTGACGGCATC | |||
Tannarella forsythia | Primer | TF-For | GAGGTTGTGGAAGGTATG | 108 bp | [44] |
TF-Rev | GTAGATCAGAATGTACGGATT | ||||
Probe | TF-Pb | TCTCCGCTTATTTCGTGAC |
Variable | Categories | Lesion | Cramer’s V | ||||
---|---|---|---|---|---|---|---|
None | Fracture or Other | Diastema | Total Number | ||||
Treponema denticola | Negative | 46 | 1 | 9 | 13 | 69 | 0.475 |
Positive | 14 | 13 | 8 | 21 | 56 | ||
Tannerella forsythia | Negative | 41 | 2 | 6 | 8 | 57 | 0.451 |
Positive | 19 | 12 | 11 | 26 | 68 | ||
Porphyromonas gingivalis | Negative | 60 | 151 | 17 | 31 | 122 | 0.257 |
Positive | 0 | 0 | 0 | 3 | 3 | ||
Fusobacterium nucleatum | Negative | 29 | 5 | 7 | 8 | 49 | 0.214 |
Positive | 31 | 9 | 10 | 26 | 76 | ||
Veilonella parvula | Negative | 6 | 1 | 0 | 2 | 9 | 0.13 |
Positive | 54 | 13 | 17 | 32 | 116 | ||
Prevotella intermedia | Negative | 47 | 8 | 11 | 21 | 87 | 0.187 |
Positive | 13 | 6 | 6 | 13 | 38 |
Variable | Categories | Total Number | EPD (%) |
---|---|---|---|
Region of animal origin | Apulia | 112 | 55 (49.1) |
Basilicata | 2 | 2 (100) | |
Campania | 6 | 4 (66.6) | |
Molise | 5 | 4 (80.0) | |
Age | Juvenile horse (1–10 years) | 41 | 13 (31.7) |
Adult horse (11–20 years) | 58 | 33 (56.8) | |
Elderly horse (>20 years) | 26 | 19 (73.0) | |
Sex | Female | 48 | 26 (54.1) |
Male | 77 | 39 (50.6) | |
Breed | Murgese | 6 | 2 (33.3) |
American Saddlebred | 99 | 50 (50.5) | |
Trotter | 7 | 4 (57.14) | |
Pony | 13 | 9 (69.2) | |
Type of feed | Hay and concentrate | 112 | 62 (55.3) |
Hay | 3 | 3 (100) | |
BCS | BCS = 5 | 97 | 52 (53.6) |
1 ≤ BCS ≤ 4 | 9 | 8 (88.8) | |
6 ≤ BCS ≤ 9 | 19 | 5 (26.3) | |
Treponema denticola | Negative | 69 | 25 (36.2) |
Positive | 56 | 40 (71.4) | |
Tannerella forsythia | Negative | 57 | 16 (28.0) |
Positive | 68 | 49 (72.0) | |
Porphyromonas gingivalis | Negative | 122 | 63 (51.6) |
Positive | 3 | 2 (66.6) | |
Fusobacterium nucleatum | Negative | 49 | 21 (42.8) |
Positive | 76 | 44 (57.8) | |
Veilonella parvula | Negative | 11 | 4 (36.3) |
Positive | 84 | 61 (72.6) | |
Prevotella intermedia | Negative | 88 | 43 (48.8) |
Positive | 37 | 22 (59.4) |
B | S.E. | Wald | gl | Sign. | Exp(B) | ||
---|---|---|---|---|---|---|---|
First Phase | Treponema denticola | 0.309 | 0.127 | 5.864 | 1 | 0.015 | 1.362 |
Tannerella forsythia | −0.067 | 0.045 | 2.185 | 1 | 0.139 | 0.935 | |
Fusobacterium nucleatum | 0.044 | 0.038 | 1.303 | 1 | 0.254 | 1.045 | |
Porphyromonas gingivalis | 0.283 | 586.380 | 0.000 | 1 | 1.000 | 1.327 | |
Prevotella intermedia | 0.044 | 0.045 | 0.918 | 1 | 0.338 | 1.045 | |
Veilonella parvula | −0.095 | 0.155 | 0.376 | 1 | 0.540 | 0.909 | |
Age | 0.144 | 0.084 | 2.946 | 1 | 0.086 | 1.154 | |
Sex dicot (1) | 0.238 | 1.150 | 0.043 | 1 | 0.836 | 1.269 | |
PonyYesNo (1) | −3.698 | 2.539 | 2.121 | 1 | 0.145 | 0.025 | |
Type of feed (1) | 14.547 | 18,603.731 | 0.000 | 1 | 0.999 | 2,077,489.922 | |
Lesion | 5.870 | 1.920 | 9.347 | 1 | 0.002 | 354.184 | |
Costant | −14.237 | 8.605 | 2.738 | 1 | 0.098 | 0.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Occhiogrosso, L.; Capozza, P.; Buonavoglia, A.; Decaro, N.; Trotta, A.; Marin, C.; Corrente, M. Bacterial Periodontitis in Horses: An Epidemiological Study in Southern Italy. Animals 2023, 13, 1814. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13111814
Occhiogrosso L, Capozza P, Buonavoglia A, Decaro N, Trotta A, Marin C, Corrente M. Bacterial Periodontitis in Horses: An Epidemiological Study in Southern Italy. Animals. 2023; 13(11):1814. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13111814
Chicago/Turabian StyleOcchiogrosso, Leonardo, Paolo Capozza, Alessio Buonavoglia, Nicola Decaro, Adriana Trotta, Claudia Marin, and Marialaura Corrente. 2023. "Bacterial Periodontitis in Horses: An Epidemiological Study in Southern Italy" Animals 13, no. 11: 1814. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13111814