Genetic Diversity and Population Structure in Captive Populations of Formosan Sambar Deer (Rusa unicolor swinhoei)
Abstract
:Simple Summary
Abstract
1. Introduction
- (1)
- To assess whether the microsatellites utilized in this study are suitable for individual discrimination and parentage analysis of the Formosan sambar deer.
- (2)
- To examine the genetic variation and structure of captive deer farms in Taiwan.
2. Materials and Methods
2.1. Sample Collection, and DNA Extraction
2.2. Microsatellite Analysis
2.3. Discrimination Ability of the Microsatellites
2.4. Genetic Diversity and Differentiation Analysis
2.5. Assessment of Kin Relationships
2.6. Population Structure Analysis
3. Results
3.1. Discrimination Ability of 13 Polymorphic Microsatellite Markers
3.2. Genetic Diversity of Formosan Sambar Deer
3.3. Genetic Variations and Population Genetic Structure in 15 Captive Populations
3.4. Parentage Analysis
4. Discussion
4.1. Resolution Power of Microsatellites for Individual Discrimination and Parentage Analysis
4.2. Reduced Genetic Diversity in Captive Populations of Formosan Sambar Deer
4.3. Low to Moderate Levels of Population Differentiation among Captive Populations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Leslie, D.M. Rusa unicolor (Artiodactyla: Cervidae). Mamm. Species 2011, 43, 1–30. [Google Scholar] [CrossRef]
- Ali, N.; Abdullah, M.L.; Nor, S.A.M.; Pau, T.M.; Kulaimi, N.A.M.; Naim, D.M. A review of the genus Rusa in the indo-malayan archipelago and conservation efforts. Saudi J. Biol. Sci. 2021, 28, 10–26. [Google Scholar] [CrossRef]
- Yen, S.C.; Wang, Y.; Ou, H.Y. Habitat of the Vulnerable Formosan sambar deer Rusa unicolor swinhoii in Taiwan. Oryx 2014, 48, 232–240. [Google Scholar] [CrossRef]
- Timmins, R.; Kawanishi, K.; Giman, B.; Lynam, A.; Chan, B.; Steinmetz, R.; Sagar Baral, H.; Samba Kumar, N. Rusa unicolor. IUCN Red List. Threat. Species 2015, 2015, e.T41790A85628124. [Google Scholar]
- Dai, T.Y.; Wang, C.H.; Chen, K.N.; Huang, I.N.; Hong, W.S.; Wang, S.Y.; Chen, Y.P.; Kuo, C.Y.; Chen, M.J. The Antiinfective effects of velvet antler of Formosan Sambar Deer (Cervus unicolor swinhoei) on staphylococcus aureus-infected mice. Evid. Based Complement Alternat. Med. 2011, 2011, 534069. [Google Scholar] [CrossRef]
- Zhou, R.; Wang, J.; Li, S.; Liu, Y. Supercritical fluid extraction of monoamine oxidase inhibitor from antler velvet. Sep. Purif. Technol. 2009, 65, 275–281. [Google Scholar] [CrossRef]
- Kuo, C.Y.; Wang, T.; Dai, T.Y.; Wang, C.H.; Chen, K.N.; Chen, Y.P.; Chen, M.J. Effect of the velvet antler of Formosan Sambar Deer (Cervus unicolor swinhoei) on the prevention of an allergic airway response in mice. Evid. Based Complement Alternat. Med. 2012, 2012, 481318. [Google Scholar] [CrossRef] [PubMed]
- Jhon, G.J.; Park, S.Y.; Han, S.Y.; Lee, S.; Kim, Y.; Chang, Y.S. Studies of the chemical structure of gangliosides in deer antler, Cervus nippon. Chem. Pharm. Bull. 1999, 47, 123–127. [Google Scholar] [CrossRef]
- Allen, M.; Oberle, K.; Grace, M.; Russell, A.; Adewale, A.J. A randomized clinical trial of elk velvet antler in rheumatoid arthritis. Biol. Res. Nurs. 2008, 9, 254–261. [Google Scholar] [CrossRef]
- Kim, K.S.; Choi, Y.H.; Kim, K.H.; Lee, Y.C.; Kim, C.H.; Moon, S.H.; Kang, S.G.; Park, Y.G. Protective and anti-arthritic effects of deer antler aqua-acupuncture (DAA), inhibiting dihydroorotate dehydrogenase, on phosphate ions-mediated chondrocyte apoptosis and rat collagen-induced arthritis. Int. Immunopharmacol. 2004, 4, 963–973. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Lim, H.K.; Park, W.K. Antinarcotic effects of the velvet antler water extract on morphine in mice. J. Ethnopharmacol. 1999, 66, 41–49. [Google Scholar] [CrossRef] [PubMed]
- Boettcher, P.J.; Hoffmann, I.; Baumung, R.; Drucker, A.G.; McManus, C.; Berg, P.; Stella, A.; Nilsen, L.B.; Moran, D.; Naves, M.; et al. Genetic resources and genomics for adaptation of livestock to climate change. Front. Genet. 2015, 5, 461. [Google Scholar] [CrossRef] [PubMed]
- Keller, L.F.; Waller, D.M. Inbreeding effects in wild populations. Trends Ecol. Evol. 2002, 17, 230–241. [Google Scholar] [CrossRef]
- Charlesworth, B.; Charlesworth, D. Elements of Evolutionary Genetics; Roberts & Company Publishers: Greenwood Village, CO, USA, 2010. [Google Scholar]
- Jangtarwan, K.; Kamsongkram, P.; Subpayakom, N.; Sillapaprayoon, S.; Muangmai, N.; Kongphoemph, A.; Wongsodchuen, A.; Intapan, S.; Chamchumroon, W.; Safoowong, M.; et al. Predictive genetic plan for a captive population of the Chinese goral (Naemorhedus griseus) and prescriptive action for ex situ and in situ conservation management in Thailand. PLoS ONE 2020, 15, e0234064. [Google Scholar] [CrossRef]
- Fan, H.; Chu, J.Y. A brief review of short tandem repeat mutation. Genom. Proteom. Bioinform. 2007, 5, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Polziehn, R.O.; Hamr, J.; Mallory, F.F.; Strobeck, C. Microsatellite analysis of North American wapiti (Cervus elaphus) populations. Mol. Ecol. 2000, 9, 1561–1576. [Google Scholar] [CrossRef]
- Norton, J.E.; Ashley, M.V. Genetic variability and population differentiation in captive baird’s Tapirs (Tapirus bairdii). Zoo Biol. 2004, 23, 521–531. [Google Scholar] [CrossRef]
- Hu, J.; Pan, H.J.; Wan, Q.H.; Fang, S.G. Nuclear DNA microsatellite analysis of genetic diversity in captive populations of Chinese water deer. Small Rumin. Res. 2007, 67, 252–256. [Google Scholar] [CrossRef]
- Okada, A.; Tamate, H.B. Pedigree analysis of the sika deer (Cervus nippon) using microsatellite markers. Zool. Sci. 2000, 17, 335–340. [Google Scholar]
- Jangtarwan, K.; Koomgun, T.; Prasongmaneerut, T.; Thongchum, R.; Singchat, W.; Tawichasri, P.; Fukayama, T.; Sillapaprayoon, S.; Kraichak, E.; Muangmai, N.; et al. Take one step backward to move forward: Assessment of genetic diversity and population structure of captive Asian woolly-necked storks (Ciconia episcopus). PLoS ONE 2019, 14, e0223726. [Google Scholar] [CrossRef]
- Castillo-Rodríguez, R.G.; Serna-Lagunes, R.; Cruz-Romero, A.; Núñez-Pastrana, R.; Rojas-Avelizapa, L.I.; Régulo, C.L.-H.; Dávila, J.A. Characterization of the genetic diversity of a population of Odocoileus virginianus veraecrucis in captivity using microsatellite markers. Neotrop. Biol. Conserv. 2020, 15, 29–41. [Google Scholar] [CrossRef]
- Weng, G.J.; Chen, S.M.; Yin, L.M.; Wu, I.C.; Chou, T.A. Bark-stripping Behavior of Formosan Sambar (Rusa unicolor swinhoii) at Tataka, Yushan National Park in Taiwan. Zool. Stud. 2022, 61, e19. [Google Scholar] [PubMed]
- Li, K.Y.; Hsiao, C.; Yen, S.C.; Hung, C.Y.; Lin, Y.Z.; Jheng, S.W.; Yu, P.J.; Hwang, M.H.; Weng, G.J.; Chen, K.L.; et al. Phylogenetic divergence associated with climate oscillations and topology illustrates the dispersal history of Formosan sambar deer (Rusa unicolor swinhoii) in Taiwan. Mamm. Res. 2023, 68, 283–294. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Purification of nucleic acids by extraction with phenol:chloroform. CSH Protoc. 2006, 2006, pdb.prot4455. [Google Scholar] [CrossRef]
- Gaur, A.; Singh, A.; Arunabala, V.; Umapathy, G.; Shailaja, K.; Singh, L. Development and characterization of 10 novel microsatellite markers from Chital deer (Cervus axis) and their cross–amplification in other related species. Mol. Ecol. Notes 2003, 3, 607–609. [Google Scholar] [CrossRef]
- Lin, D.Y.; Chiang, T.Y.; Huang, C.C.; Lin, H.D.; Tzeng, S.J.; Kang, S.R.; Sung, H.M.; Wu, M.C. Polymorphic microsatellite loci isolated from Cervus unicolor (Cervidae) show inbreeding in a domesticated population of Taiwan Sambar deer. Genet. Mol. Res. 2014, 13, 3967–3971. [Google Scholar] [CrossRef]
- He, Y.; Wang, Z.H.; Wang, X.M. Genetic diversity and population structure of a Sichuan sika deer (Cervus sichuanicus) population in Tiebu Nature Reserve based on microsatellite variation. Zool. Res. 2014, 35, 528–536. [Google Scholar]
- Zhang, Q.; Zeng, Z.-G.; Song, Y.-L. Isolation and characterization of eight microsatellite loci for the vulnerable Hainan Eld’s deer (Cervus eldi hainanus) in China. Conserv. Genet. 2008, 9, 965–967. [Google Scholar] [CrossRef]
- Tessier, C.; David, J.; This, P.; Boursiquot, J.M.; Charrier, A. Optimization of the choice of molecular markers for varietal identification in Vitis vinifera L. Theor. Appl. Genet. 1999, 98, 171–177. [Google Scholar] [CrossRef]
- Fisher, R.A. Standard calculations for evaluating a blood-group system. Heredity 1951, 5, 95–102. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Luikart, G.; Cornuet, J.-M. Empirical evaluation of a test for identifying recently bottlenecked populations from allele frequency data. Conserv. Biol. 1998, 12, 228–237. [Google Scholar] [CrossRef]
- Cornuet, J.M.; Luikart, G. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 1996, 144, 2001–2014. [Google Scholar] [CrossRef]
- Ohta, T.; Kimura, M. A model of mutation appropriate to estimate the number of electrophoretically detectable alleles in a finite population. Genet. Res. 1973, 22, 201–204. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M.; Crow, J.F. The Number of alleles that can be maintained in a finite population. Genetics 1964, 49, 725–738. [Google Scholar] [CrossRef]
- Di Rienzo, A.; Peterson, A.C.; Garza, J.C.; Valdes, A.M.; Slatkin, M.; Freimer, N.B. Mutational processes of simple-sequence repeat loci in human populations. Proc. Natl. Acad. Sci. USA 1994, 91, 3166–3170. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Wagner, A.P.; Taper, M.L. ML-RELATE: A computer program for maximum likelihood estimation of relatedness and relationship. Mol. Ecol. Notes 2006, 6, 576–579. [Google Scholar] [CrossRef]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945. [Google Scholar] [CrossRef] [PubMed]
- Earl, D.; vonHoldt, B. Structure Harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Poetsch, M.; Seefeldt, S.; Maschke, M.; Lignitz, E. Analysis of microsatellite polymorphism in red deer, roe deer, and fallow deer—Possible employment in forensic applications. Forensic Sci. Int. 2001, 116, 1–8. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Radko, A.; Podbielska, A. Microsatellite DNA analysis of genetic diversity and parentage testing in the popular dog breeds in Poland. Genes 2021, 12, 485. [Google Scholar] [CrossRef]
- Lipinski, M.J.; Amigues, Y.; Blasi, M.; Broad, T.E.; Cherbonnel, C.; Cho, G.J.; Corley, S.; Daftari, P.; Delattre, D.R.; Dileanis, S.; et al. An international parentage and identification panel for the domestic cat (Felis catus). Anim. Genet. 2007, 38, 371–377. [Google Scholar] [CrossRef]
- Luttman, A.M.; Komine, M.; Thaiwong, T.; Carpenter, T.; Ewart, S.L.; Kiupel, M.; Langohr, I.M.; Venta, P.J. Development of a 17-plex of penta- and tetra-nucleotide microsatellites for DNA profiling and paternity testing in horses. Front. Vet. Sci. 2022, 9, 861623. [Google Scholar] [CrossRef]
- Pei, J.; Bao, P.; Chu, M.; Liang, C.; Ding, X.; Wang, H.; Wu, X.; Guo, X.; Yan, P. Evaluation of 17 microsatellite markers for parentage testing and individual identification of domestic yak (Bos grunniens). Peer J. 2018, 6, e5946. [Google Scholar] [CrossRef]
- Yang, W.; Zheng, J.; Jia, B.; Wei, H.; Wang, G.; Yang, F. Isolation of novel microsatellite markers and their application for genetic diversity and parentage analyses in sika deer. Gene 2018, 643, 68–73. [Google Scholar] [CrossRef]
- Sun, N.C.M.; Chang, S.P.; Lin, J.S.; Tseng, Y.W.; Pei, K.J.C.; Hung, K.H. The genetic structure and mating system of a recovered Chinese pangolin population (Manis pentadactyla Linnaeus, 1758) as inferred by microsatellite markers. Glob. Ecol. Conserv. 2020, 23, e01195. [Google Scholar]
- Mishra, S.; Singh, S.K.; Munjal, A.K.; Aspi, J.; Goyal, S.P. Panel of polymorphic heterologous microsatellite loci to genotype critically endangered Bengal tiger: A pilot study. SpringerPlus 2014, 3, 4. [Google Scholar] [CrossRef] [PubMed]
- Wanjala, G.; Kusuma Astuti, P.; Bagi, Z.; Kichamu, N.; Strausz, P.; Kusza, S. A review on the potential effects of environmental and economic factors on sheep genetic diversity: Consequences of climate change. Saudi J. Biol. Sci. 2023, 30, 103505. [Google Scholar] [CrossRef] [PubMed]
- Cruz, F.; Vilà, C.; Webster, M.T. The legacy of domestication: Accumulation of deleterious mutations in the dog genome. Mol. Biol. Evol. 2008, 25, 2331–2336. [Google Scholar] [CrossRef]
- Bosse, M.; Megens, H.J.; Derks, M.F.L.; de Cara Á, M.R.; Groenen, M.A.M. Deleterious alleles in the context of domestication, inbreeding, and selection. Evol. Appl. 2019, 12, 6–17. [Google Scholar] [CrossRef]
- Feulner, P.G.D.; Bielfeldt, W.; Zachos, F.E.; Bradvarovic, J.; Eckert, I.; Hartl, G.B. Mitochondrial DNA and microsatellite analyses of the genetic status of the presumed subspecies Cervus elaphus montanus (Carpathian red deer). Heredity 2004, 93, 299–306. [Google Scholar] [CrossRef]
- Hmwe, S.S.; Zachos, F.E.; Sale, J.B.; Rose, H.R.; Hartl, G.B. Genetic variability and differentiation in red deer (Cervus elaphus) from Scotland and England. J. Zool. 2006, 270, 479–487. [Google Scholar] [CrossRef]
- Takagi, T.; Murakami, R.; Takano, A.; Torii, H.; Kaneko, S.; Tamate, H.B. A historic religious sanctuary may have preserved ancestral genetics of Japanese sika deer (Cervus nippon). J. Mammal. 2023, 104, 303–315. [Google Scholar] [CrossRef]
- Liu, H.; Ju, Y.; Tamate, H.; Wang, T.; Xing, X. Phylogeography of sika deer (Cervus nippon) inferred from mitochondrial cytochrome-b gene and microsatellite DNA. Gene 2021, 772, 145375. [Google Scholar] [CrossRef] [PubMed]
- Thévenon, S.; Thuy, L.T.; Ly, L.V.; Maudet, F.; Bonnet, A.; Jarne, P.; Maillard, J.C. Microsatellite analysis of genetic diversity of the Vietnamese sika deer (Cervus nippon pseudaxis). J. Hered. 2004, 95, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.K.; Joshi, B.D.; Bhat, G.J.; Singh, S.K.; Chandra, K.; Sharma, L.K.; Thakur, M. Population genetics of Sambar (Rusa unicolor) from the Western Himalayas: Preliminary findings. Mol. Biol. Rep. 2022, 49, 811–816. [Google Scholar] [CrossRef]
- Palstra, F.P.; Ruzzante, D.E. Genetic estimates of contemporary effective population size: What can they tell us about the importance of genetic stochasticity for wild population persistence? Mol. Ecol. 2008, 17, 3428–3447. [Google Scholar] [CrossRef] [PubMed]
- Anello, M.; Daverio, M.S.; Romero, S.R.; Rigalt, F.; Silbestro, M.B.; Vidal-Rioja, L.; Di Rocco, F. Genetic diversity and conservation status of managed vicuña (Vicugna vicugna) populations in Argentina. Genetica 2016, 144, 85–97. [Google Scholar] [CrossRef] [PubMed]
- Sork, V.L. Gene flow and natural selection shape spatial patterns of genes in tree populations: Implications for evolutionary processes and applications. Evol. Appl. 2016, 9, 291–310. [Google Scholar] [CrossRef]
- Wright, S. Isolation by Distance. Genetics 1943, 28, 114–138. [Google Scholar] [CrossRef] [PubMed]
- Hartl, D.L.; Clark, A.G. Principles of Population Genetics, 3rd ed.; Sinauer Associates: Sunderland, UK, 1997. [Google Scholar]
Symbols | City | Number |
---|---|---|
TXG | Taichung, Taiwan | |
TXG1 | Taichung, Taiwan | 15 |
TXG2 | Taichung, Taiwan | 18 |
NTO | Nantou, Taiwan | |
NTO1 | Nantou, Taiwan | 21 |
YUN | Yunlin, Taiwan | |
YUN1 | Yunlin, Taiwan | 8 |
YUN2 | Yunlin, Taiwan | 3 |
YUN3 | Yunlin, Taiwan | 28 |
YUN4 | Yunlin, Taiwan | 5 |
TNN | Tainan, Taiwan | |
TNN1 | Tainan, Taiwan | 9 |
TNN2 | Tainan, Taiwan | 14 |
TNN3 | Tainan, Taiwan | 10 |
TNN4 | Tainan, Taiwan | 22 |
TNN5 | Tainan, Taiwan | 26 |
KHH | Kaohsiung, Taiwan | |
KHH1 | Kaohsiung, Taiwan | 4 |
KHH2 | Kaohsiung, Taiwan | 38 |
KHH3 | Kaohsiung, Taiwan | 18 |
Total | 239 |
Locus | Primer (5′-3′) | Repeat Motif | Tm (°C) | Reference |
---|---|---|---|---|
Ca13 | F: CAGAAAGTTGTGAGGCACAG | (CA)20 | 60 | [26] |
R: GTGGCCTCTGTTTCAGTGTA | ||||
Ca18 | F: TTCCGTCTCTCCCCTTAATA | (CA)19 | 56 | [26] |
R: TGGATCTGAGATTTCTGCTG | ||||
Ca30 | F: CTATCCCATAGCCCAGTGAT | (GT)15 | 56 | [26] |
R: TTTCCTCTTCCCTCTTCCTT | ||||
Ca67 | F: TAATCCTAACTCCTGGACCC | (GT)16 | 57 | [26] |
R: CAAGAATTTTGGAGGGAAGC | ||||
Ca71 | F: TGCACACCCCCAGTCTGGT | (CT)12 | 60 | [26] |
R: GTCTCACCTTTCCCATCAGC | ||||
Cu02 | F: GGGAGTCCTTCCTGTTCCTT | (CT)9 | 57 | [27] |
R: CCAAGATCCCCCTTCTTGTT | ||||
Cu05 | F: AACAGCCTCACACACTCCAA | (AG)9 | 57 | [27] |
R: CCTTTCTCTCTGTGGCCAGT | ||||
Cu09 | F: AGACATGCACAAGGCTCCTC | (AG)10 | 59 | [27] |
R: GACTCCAAGCACTGGGATACA | ||||
Cu10 | F: CCCACTCGCACTCTCTCTCT | (AG)18 | 60 | [27] |
R: ACTCAAGGGCCAGGGACTAT | ||||
BM4107 | F: AGCCCCTGCTATTGTGTGAG | (AC)n(TC)n(TG)n | 55 | [28] |
R: ATAGGCTTTGCATTGTTCAGG | ||||
RT1 | F: TGCCTTCTTTCATCCAACAA | (GT)n | 56 | [28] |
R: CATCTTCCCATCCTCTTTAC | ||||
TGLA53 | F: CAGCAGACAGCTGCAAGAGTTAGC | (AC)n | 50 | [28] |
R: CTTTCAGAAATAGTTTGCATTCATGCAG | ||||
CEH-5 | F: GAGCTGGTCCTCTGCGTGAT | (AC)3AA(AC)11 | 60 | [29] |
R: CAGGCAGATTCTTTACCGTTG |
Locus | A | Ho | He | FIS | PIC | HWE | PI | PIsibs | PD | Orders of PD |
---|---|---|---|---|---|---|---|---|---|---|
Ca13 | 14.000 | 0.561 | 0.727 | 0.228 | 0.695 | p < 0. 05 | 0.107 | 0.413 | 0.727 | 2 |
Ca18 | 15.000 | 0.544 | 0.785 | 0.307 | 0.759 | p < 0. 05 | 0.073 | 0.375 | 0.785 | 1 |
Cu02 | 2.000 | 0.009 | 0.009 | −0.005 | 0.009 | p > 0.05 | 0.982 | 0.991 | 0.009 | 12 |
Cu05 | 5.000 | 0.176 | 0.221 | 0.206 | 0.211 | p < 0. 05 | 0.617 | 0.793 | 0.221 | 10 |
Ca67 | 7.000 | 0.706 | 0.731 | 0.034 | 0.683 | p < 0. 05 | 0.121 | 0.415 | 0.731 | 3 |
Cu09 | 3.000 | 0.130 | 0.122 | −0.067 | 0.115 | p > 0.05 | 0.777 | 0.883 | 0.122 | 11 |
Cu10 | 6.000 | 0.374 | 0.346 | −0.079 | 0.322 | p < 0.05 | 0.452 | 0.690 | 0.346 | 9 |
Ca30 | 2.000 | 0.008 | 0.496 | 0.983 | 0.373 | p < 0. 05 | 0.377 | 0.596 | 0.496 | 6 |
BM4107 | 7.000 | 0.431 | 0.452 | 0.047 | 0.415 | p < 0. 05 | 0.337 | 0.608 | 0.452 | 7 |
RT1 | 7.000 | 0.452 | 0.628 | 0.281 | 0.569 | p < 0. 05 | 0.198 | 0.485 | 0.628 | 4 |
Ca71 | 2.000 | 0.004 | 0.004 | −0.002 | 0.004 | p > 0.05 | 0.992 | 0.996 | 0.004 | 13 |
CEH-5 | 6.000 | 0.155 | 0.414 | 0.626 | 0.384 | p < 0. 05 | 0.371 | 0.636 | 0.414 | 8 |
TGLA53 | 7.000 | 0.339 | 0.535 | 0.366 | 0.503 | p < 0. 05 | 0.249 | 0.545 | 0.535 | 5 |
Average | 6.385 | 0.299 | 0.421 | - | 0.388 | - | - | - | 0.421 | - |
Population | A | Ho | He | FIS |
---|---|---|---|---|
TXG | 3.846 | 0.291 | 0.417 | 0.262 |
TXG1 | 2.769 | 0.241 | 0.374 | 0.268 |
TXG2 | 3.538 | 0.333 | 0.426 | 0.200 |
NTO | ||||
NTO | 2.231 | 0.256 | 0.299 | 0.146 |
YUN | 4.231 | 0.311 | 0.404 | 0.212 |
YUN1 | 3.000 | 0.308 | 0.370 | 0.140 |
YUN2 | 2.231 | 0.308 | 0.346 | 0.054 |
YUN3 | 3.615 | 0.328 | 0.397 | 0.149 |
YUN4 | 2.462 | 0.231 | 0.355 | 0.305 |
TNN | 5.385 | 0.312 | 0.424 | 0.250 |
TNN1 | 2.846 | 0.222 | 0.371 | 0.333 |
TNN2 | 3.308 | 0.346 | 0.424 | 0.185 |
TNN3 | 2.538 | 0.300 | 0.300 | 0.055 |
TNN4 | 3.923 | 0.322 | 0.398 | 0.191 |
TNN5 | 3.923 | 0.319 | 0.414 | 0.204 |
KHH | 4.769 | 0.293 | 0.423 | 0.229 |
KHH1 | 2.385 | 0.250 | 0.317 | 0.176 |
KHH2 | 3.846 | 0.281 | 0.391 | 0.229 |
KHH3 | 3.769 | 0.326 | 0.449 | 0.245 |
Average | 3.092 | 0.291 | 0.375 | 0.195 |
TXG1 | TXG2 | NTO | YUN1 | YUN2 | YUN3 | YUN4 | TNN1 | TNN2 | TNN3 | TNN4 | TNN5 | KHH1 | KHH2 | KHH3 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TXG1 | 0.000 | 0.028 | 0.001 | 0.159 | 0.004 | 0.019 | 0.065 | 0.701 | 0.061 | 0.002 | 0.003 | 0.007 | 0.002 | 0.027 | 0.009 |
TXG2 | 0.032 | 0.000 | 0.001 | 0.209 | 0.047 | 0.019 | 0.093 | 0.165 | 0.002 | 0.001 | 0.022 | 0.003 | 0.007 | 0.038 | 0.002 |
NTO | 0.097 | 0.065 | 0.000 | 0.001 | 0.003 | 0.001 | 0.025 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
YUN1 | 0.037 | 0.031 | 0.086 | 0.000 | 0.206 | 0.097 | 0.649 | 0.244 | 0.007 | 0.001 | 0.042 | 0.172 | 0.003 | 0.299 | 0.023 |
YUN2 | 0.093 | 0.053 | 0.092 | 0.058 | 0.000 | 0.017 | 0.494 | 0.039 | 0.009 | 0.001 | 0.040 | 0.009 | 0.044 | 0.017 | 0.002 |
YUN3 | 0.028 | 0.027 | 0.043 | 0.033 | 0.068 | 0.000 | 0.095 | 0.172 | 0.006 | 0.001 | 0.008 | 0.116 | 0.002 | 0.107 | 0.002 |
YUN4 | 0.081 | 0.062 | 0.086 | 0.048 | 0.054 | 0.063 | 0.000 | 0.218 | 0.038 | 0.001 | 0.124 | 0.256 | 0.010 | 0.277 | 0.027 |
TNN1 | 0.024 | 0.032 | 0.097 | 0.045 | 0.094 | 0.029 | 0.083 | 0.000 | 0.525 | 0.005 | 0.018 | 0.063 | 0.122 | 0.079 | 0.004 |
TNN2 | 0.043 | 0.043 | 0.095 | 0.063 | 0.081 | 0.040 | 0.082 | 0.031 | 0.000 | 0.001 | 0.001 | 0.016 | 0.022 | 0.001 | 0.002 |
TNN3 | 0.075 | 0.102 | 0.120 | 0.095 | 0.149 | 0.063 | 0.112 | 0.088 | 0.098 | 0.000 | 0.001 | 0.002 | 0.001 | 0.002 | 0.001 |
TNN4 | 0.037 | 0.032 | 0.070 | 0.039 | 0.057 | 0.032 | 0.060 | 0.052 | 0.060 | 0.092 | 0.000 | 0.003 | 0.015 | 0.061 | 0.001 |
TNN5 | 0.037 | 0.031 | 0.051 | 0.030 | 0.064 | 0.016 | 0.052 | 0.039 | 0.035 | 0.051 | 0.036 | 0.000 | 0.001 | 0.290 | 0.003 |
KHH1 | 0.073 | 0.060 | 0.120 | 0.108 | 0.096 | 0.071 | 0.139 | 0.062 | 0.063 | 0.140 | 0.058 | 0.079 | 0.000 | 0.001 | 0.001 |
KHH2 | 0.027 | 0.023 | 0.058 | 0.023 | 0.060 | 0.017 | 0.048 | 0.038 | 0.047 | 0.067 | 0.018 | 0.013 | 0.071 | 0.000 | 0.005 |
KHH3 | 0.043 | 0.039 | 0.077 | 0.046 | 0.084 | 0.036 | 0.074 | 0.058 | 0.046 | 0.069 | 0.062 | 0.030 | 0.106 | 0.035 | 0.000 |
PO | FS | HS | U | |
---|---|---|---|---|
Within farms | 81 | 222 | 425 | 1749 |
(0.285%) | (0.780%) | (1.494%) | (6.149%) | |
Among farms | 394 | 813 | 3384 | 21,373 |
(1.385%) | (2.859%) | (11.899%) | (75.149%) | |
Total | 475 | 1035 | 3809 | 23,122 |
(1.670%) | (3.639%) | (13.393%) | (81.298%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, H.-M.; Yang, K.-T.; Cheng, Y.-T.; Chang, S.-C.; Lin, C.-Y.; Tsai, M.-Y.; Lin, D.-Y.; Hung, K.-H. Genetic Diversity and Population Structure in Captive Populations of Formosan Sambar Deer (Rusa unicolor swinhoei). Animals 2023, 13, 3106. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13193106
Liang H-M, Yang K-T, Cheng Y-T, Chang S-C, Lin C-Y, Tsai M-Y, Lin D-Y, Hung K-H. Genetic Diversity and Population Structure in Captive Populations of Formosan Sambar Deer (Rusa unicolor swinhoei). Animals. 2023; 13(19):3106. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13193106
Chicago/Turabian StyleLiang, Hsiao-Mei, Kuo-Tai Yang, Yu-Tzu Cheng, Shen-Chang Chang, Cheng-Yung Lin, Ming-Yang Tsai, Der-Yuh Lin, and Kuo-Hsiang Hung. 2023. "Genetic Diversity and Population Structure in Captive Populations of Formosan Sambar Deer (Rusa unicolor swinhoei)" Animals 13, no. 19: 3106. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13193106