Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Animals, and Diets
2.2. Sampling
2.3. Analytical Procedures
2.4. Statistical Analysis
3. Results and Discussion
3.1. Cow Parameters
3.2. Calf Performance
3.3. Relative mRNA Expression
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nathanielsz, P.W.; Poston, L.; Taylor, P.D. In Utero Exposure to Maternal Obesity and Diabetes: Animal Models That Identify and Characterize Implications for Future Health. Clin. Perinatol. 2007, 34, 515–526. [Google Scholar] [CrossRef]
- Zhu, M.J.; Ford, S.P.; Means, W.J.; Hess, B.W.; Nathanielsz, P.W.; Du, M. Maternal Nutrient Restriction Affects Properties of Skeletal Muscle in Offspring. J. Physiol. 2006, 575, 241–250. [Google Scholar] [CrossRef] [PubMed]
- Woo, M.; Isganaitis, E.; Cerletti, M.; Fitzpatrick, C.; Wagers, A.J.; Jimenez-Chillaron, J.; Patti, M.E. Early Life Nutrition Modulates Muscle Stem Cell Number: Implications for Muscle Mass and Repair. Stem. Cells Dev. 2011, 20, 1763–1769. [Google Scholar] [CrossRef]
- Du, M.; Wang, B.; Fu, X.; Yang, Q.; Zhu, M.J. Fetal Programming in Meat Production. Meat Sci. 2015, 109, 40–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, M.; Huang, Y.; Das, A.K.; Yang, Q.; Duarte, M.S.; Dodson, M.V.; Zhu, M.J. Meat Science and Muscle Biology Symposium: Manipulating Mesenchymal Progenitor Cell Differentiation to Optimize Performance and Carcass Value of Beef Cattle. J. Anim. Sci. 2013, 91, 1419–1427. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.E.; Lambert, M.H.; Montana, V.G.; Parks, D.J.; Blanchard, S.G.; Brown, P.J.; Sternbach, D.D.; Rgen, J.; Lehmann, M.; Wisely, G.B.; et al. Molecular Recognition of Fatty Acids by Peroxisome Proliferator–Activated Receptors. Mol. Cell 1999, 3, 397–403. [Google Scholar] [CrossRef] [PubMed]
- Thoennes, S.R.; Tate, P.L.; Price, T.M.; Kilgore, M.W. Differential Transcriptional Activation of Peroxisome Proliferator-Activated Receptor Gamma by Omega-3 and Omega-6 Fatty Acids in MCF-7 Cells. Mol. Cell. Endocrinol. 2000, 160, 67–73. [Google Scholar] [CrossRef]
- Kamolrat, T.; Gray, S.R. The Effect of Eicosapentaenoic and Docosahexaenoic Acid on Protein Synthesis and Breakdown in Murine C2C12 Myotubes. Biochem. Biophys. Res. Commun. 2013, 432, 593–598. [Google Scholar] [CrossRef]
- Capel, F.; Acquaviva, C.; Pitois, E.; Laillet, B.; Rigaudière, J.P.; Jouve, C.; Pouyet, C.; Gladine, C.; Comte, B.; Vianey Saban, C.; et al. DHA at Nutritional Doses Restores Insulin Sensitivity in Skeletal Muscle by Preventing Lipotoxicity and Inflammation. J. Nutr. Biochem. 2015, 26, 949–959. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, X.; Liu, Y.; Zhang, L.; Odle, J.; Lin, X.; Zhu, H.; Wang, X.; Liu, Y. EPA and DHA Inhibit Myogenesis and Downregulate the Expression of Muscle-Related Genes in C2C12 Myoblasts. Genes 2019, 10, 64. [Google Scholar] [CrossRef]
- Hsueh, T.Y.; Baum, J.I.; Huang, Y. Effect of Eicosapentaenoic Acid and Docosahexaenoic Acid on Myogenesis and Mitochondrial Biosynthesis during Murine Skeletal Muscle Cell Differentiation. Front. Nutr. 2018, 5, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, C.C.; Coleman, D.N.; Garcia, L.G.; Furnus, C.C.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep. III. Effect of Eicosapentaenoic Acid and Docosahexaenoic Acid during Finishing on Performance, Hypothalamus Gene Expression, and Muscle Fatty Acids Composition in Lambs. J. Anim. Sci. 2018, 96, 5300–5310. [Google Scholar] [CrossRef]
- Marques, R.S.; Cooke, R.F.; Rodrigues, M.C.; Brandão, A.P.; Schubach, K.M.; Lippolis, K.D.; Moriel, P.; Perry, G.A.; Lock, A.; Bohnert, D.W. Effects of Supplementing Calcium Salts of Polyunsaturated Fatty Acids to Late-Gestating Beef Cows on Performance and Physiological Responses of the Offspring. J. Anim. Sci. 2017, 95, 5347–5357. [Google Scholar] [CrossRef] [PubMed]
- Shao, T.; Ireland, F.A.; Mccann, J.C.; Shike, D.W. Effects of Supplements Differing in Fatty Acid Profile to Late Gestational Beef Cows on Cow Performance, Calf Growth Performance, and MRNA Expression of Genes Associated with Myogenesis and Adipogenesis. J. Anim. Sci. Biotechnol. 2021, 12, 67. [Google Scholar] [CrossRef]
- Papadopoulos, G.A.; Maes, D.G.; Van Weyenberg, S.; van Kempen, T.A.T.G.; Buyse, J.; Janssens, G.P.J. Peripartal Feeding Strategy with Different N-6:N-3 Ratios in Sows: Effects on Sows’ Performance, Inflammatory and Periparturient Metabolic Parameters. Br. J. Nutr. 2009, 101, 348–357. [Google Scholar] [CrossRef] [Green Version]
- Larson, J.E.; Lamb, G.C.; Stevenson, J.S.; Johnson, S.K.; Day, M.L.; Geary, T.W.; Kesler, D.J.; DeJarnette, J.M.; Schrick, F.N.; DiCostanzo, A.; et al. Synchronization of Estrus in Suckled Beef Cows for Detected Estrus and Artificial Insemination and Timed Artificial Insemination Using Gonadotropin-Releasing Hormone, Prostaglandin F2α, and Progesterone1. J. Anim. Sci. 2006, 84, 332–342. [Google Scholar] [CrossRef] [PubMed]
- Beal, W.E.; Notter, D.R.; Akers, R.M. Techniques for Estimation of Milk Yield in Beef Cows and Relationships of Milk Yield to Calf Weight Gain and Postpartum Reproduction. J. Anim. Sci. 1990, 68, 937–943. [Google Scholar] [CrossRef] [Green Version]
- Sukhija, P.S.; Palmquist, D.L. Rapid Method for Determination of Total Fatty Acid Content and Composition of Feedstuffs and Feces. J. Agric. Food Chem. 1988, 36, 1202–1206. [Google Scholar] [CrossRef]
- Kadegowda, A.K.G.; Bionaz, M.; Thering, B.; Piperova, L.S.; Erdman, R.A.; Loor, J.J. Identification of Internal Control Genes for Quantitative Polymerase Chain Reaction in Mammary Tissue of Lactating Cows Receiving Lipid Supplements. J. Dairy Sci. 2009, 92, 2007–2019. [Google Scholar] [CrossRef] [Green Version]
- Goselink, R.M.A.; van Baal, J.; Widjaja, H.C.A.; Dekker, R.A.; Zom, R.L.G.; de Veth, M.J.; van Vuuren, A.M. Effect of Rumen-Protected Choline Supplementation on Liver and Adipose Gene Expression during the Transition Period in Dairy Cattle. J. Dairy Sci. 2013, 96, 1102–1116. [Google Scholar] [CrossRef]
- Wang, Y.H.; Byrne, K.A.; Reverter, A.; Harper, G.S.; Taniguchi, M.; McWilliam, S.M.; Mannen, H.; Oyama, K.; Lehnert, S.A. Transcriptional Profiling of Skeletal Muscle Tissue from Two Breeds of Cattle. Mamm. Genome 2005, 16, 201–210. [Google Scholar] [CrossRef]
- Rocco, S.M.; McNamara, J.P. Regulation of Bovine Adipose Tissue Metabolism during Lactation. 7. Metabolism and Gene Expression as a Function of Genetic Merit and Dietary Energy Intake. J. Dairy Sci. 2013, 96, 3108–3119. [Google Scholar] [CrossRef] [Green Version]
- Mukesh, M.; Bionaz, M.; Graugnard, D.E.; Drackley, J.K.; Loor, J.J. Adipose Tissue Depots of Holstein Cows Are Immune Responsive: Inflammatory Gene Expression in Vitro. Domest. Anim. Endocrinol. 2010, 38, 168–178. [Google Scholar] [CrossRef] [PubMed]
- Su, X.; Wang, Y.; Li, A.; Zan, L.; Wang, H. Neudesin Neurotrophic Factor Promotes Bovine Preadipocyte Differentiation and Inhibits Myoblast Myogenesis. Animals 2019, 9, 1109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duarte, M.S.; Paulino, P.V.R.; Das, A.K.; Wei, S.; Serão, N.V.L.; Fu, X.; Harris, S.M.; Dodson, M.V.; Du, M. Enhancement of Adipogenesis and Fibrogenesis in Skeletal Muscle of Wagyu Compared with Angus Cattle. J. Anim. Sci. 2013, 91, 2938–2946. [Google Scholar] [CrossRef] [PubMed]
- Ji, P.; Osorio, J.S.; Drackley, J.K.; Loor, J.J. Overfeeding a Moderate Energy Diet Prepartum Does Not Impair Bovine Subcutaneous Adipose Tissue Insulin Signal Transduction and Induces Marked Changes in Peripartal Gene Network Expression. J. Dairy Sci. 2012, 95, 4333–4351. [Google Scholar] [CrossRef] [Green Version]
- Segers, J.R.; Loor, J.J.; Moisá, S.J.; Gonzalez, D.; Shike, D.W. Effects of Protein and Fat Concentration in Coproduct-Based Growing Calf Diets on Adipogenic and Lipogenic Gene Expression, Blood Metabolites, and Carcass Composition. J. Anim. Sci. 2017, 95, 2767–2781. [Google Scholar] [CrossRef]
- Thering, B.J.; Bionaz, M.; Loor, J.J. Long-Chain Fatty Acid Effects on Peroxisome Proliferator-Activated Receptor-α-Regulated Genes in Madin-Darby Bovine Kidney Cells: Optimization of Culture Conditions Using Palmitate. J. Dairy Sci. 2009, 92, 2027–2037. [Google Scholar] [CrossRef] [Green Version]
- Jeong, J.; Kwon, E.G.; Im, S.K.; Seo, K.S.; Baik, M. Expression of Fat Deposition and Fat Removal Genes Is Associated with Intramuscular Fat Content in Longissimus Dorsi Muscle of Korean Cattle Steers. J. Anim. Sci. 2012, 90, 2044–2053. [Google Scholar] [CrossRef]
- Bionaz, M.; Loor, J.J. Gene Networks Driving Bovine Milk Fat Synthesis during the Lactation Cycle. BMC Genom. 2008, 9, 366. [Google Scholar] [CrossRef]
- Taniguchi, M.; Guan, L.L.; Zhang, B.; Dodson, M.V.; Okine, E.; Moore, S.S. Adipogenesis of Bovine Perimuscular Preadipocytes. Biochem. Biophys. Res. Commun. 2008, 366, 54–59. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.J.; Jacometo, C.B.; Graugnard, D.E.; Corrêa, M.N.; Schmitt, E.; Cardoso, F.; Loor, J.J. Overfeeding Dairy Cattle during Late-Pregnancy Alters Hepatic Pparα-Regulated Pathways Including Hepatokines: Impact on Metabolism and Peripheral Insulin Sensitivity. Gene Regul. Syst. Biol. 2014, 2014, 97–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brandão, A.P.; Cooke, R.F.; Schubach, K.M.; Rett, B.; Souza, O.A.; Schachtschneider, C.L.; Perry, G.A.; Arispe, S.A.; Jump, D.B.; Pohler, K.G.; et al. Supplementing Ca Salts of Soybean Oil to Late-Gestating Beef Cows: Impacts on Performance and Physiological Responses of the Offspring. J. Anim. Sci. 2020, 98, skaa247. [Google Scholar] [CrossRef]
- Nakamura, M.T.; Nara, T.Y. Structure, Function, and Dietary Regulation of Δ6, Δ5, and Δ9 Desaturases. Annu. Rev. Nutr. 2004, 24, 345–376. [Google Scholar] [CrossRef]
- Coleman, D.N.; Murphy, K.D.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep. II. Supplementation of Eicosapentaenoic Acid and Docosahexaenoic Acid during Late Gestation Alters the Fatty Acid Profile of Plasma, Colostrum, Milk and Adipose Tissue, and Increases Lipogenic Gene Expression. J. Anim. Sci. 2018, 96, 1181–1204. [Google Scholar] [CrossRef] [Green Version]
- Bellows, R.A.; Grings, E.E.; Simms, D.D.; Geary, T.W.; Bergman, J.W. Effects of Feeding Supplemental Fat during Gestation to First-Calf Beef Heifers. Prof. Anim. Sci. 2001, 17, 81–89. [Google Scholar] [CrossRef]
- Stokes, R.S.; Volk, M.J.; Ireland, F.A.; Gunn, P.J.; Shike, D.W. Effect of Repeated Trace Mineral Injections on Beef Heifer Development and Reproductive Performance. J. Anim. Sci. 2018, 96, 3943–3954. [Google Scholar] [CrossRef] [PubMed]
- Ratnayake, W.N. Concerns about the Use of 15:0, 17:0, and Trans-16:1n–7 as Biomarkers of Dairy Fat Intake in Recent Observational Studies That Suggest Beneficial Effects of Dairy Food on Incidence of Diabetes and Stroke. Am. J. Clin. Nutr. 2015, 101, 1102–1103. [Google Scholar] [CrossRef] [Green Version]
- Chilliard, Y.; Ferlay, A.; Mansbridge, R.M.; Doreau, M. Ruminant Milk Fat Plasticity: Nutritional Control of Saturated, Polyunsaturated, Trans and Conjugated Fatty Acids. Ann. Zootech. 2000, 49, 181–205. [Google Scholar] [CrossRef] [Green Version]
- Burns, P.D.; Bonnette, T.R.; Engle, T.E.; Whittier, J.C. Effects of Fishmeal Supplementation on Fertility and Plasma Ω-3 Fatty Acid Profiles in Primiparous, Lactating Beef Cows. Prof. Anim. Sci. 2002, 18, 373–379. [Google Scholar] [CrossRef]
- Mattos, R.; Staples, C.R.; Thatcher, W.W. Effects of Dietary Fatty Acids on Reproduction in Ruminants. Rev. Reprod. 2000, 5, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Espinoza, J.L.; Ramirez-Godinez, J.A.; Jimenez, J.A.; Flores, A. Effects of Calcium Soaps of Fatty Acids on Postpartum Reproductive Activity in Beef Cows and Growth of Calves. J. Anim. Sci. 1995, 73, 2888. [Google Scholar] [CrossRef] [PubMed]
- Thomas, M.G.; Bao, B.; Williams, G.L. Dietary Fats Varying in Their Fatty Acid Composition Differentially Influence Follicular Growth in Cows Fed Isoenergetic Diets. J. Anim. Sci. 1997, 75, 2512. [Google Scholar] [CrossRef] [PubMed]
- De Fries, C.A.; Neuendorff, D.A.; Randel, R.D. Fat Supplementation Influences Postpartum Reproductive Performance in Brahman Cows. J. Anim. Sci. 1998, 76, 864–870. [Google Scholar] [CrossRef]
- Ricks, R.E.; Cook, E.K.; Long, N.M. Effects of Supplementing Ruminal-Bypass Unsaturated Fatty Acids during Late Gestation on Beef Cow and Calf Serum and Colostrum Fatty Acids, Transfer of Passive Immunity, and Cow and Calf Performance. Appl. Anim. Sci. 2020, 36, 271–284. [Google Scholar] [CrossRef]
- Garcia, M.; Greco, L.F.; Favoreto, M.G.; Marsola, R.S.; Martins, L.T.; Bisinotto, R.S.; Shin, J.H.; Lock, A.L.; Block, E.; Thatcher, W.W.; et al. Effect of Supplementing Fat to Pregnant Nonlactating Cows on Colostral Fatty Acid Profile and Passive Immunity of the Newborn Calf. J. Dairy Sci. 2014, 97, 392–405. [Google Scholar] [CrossRef] [Green Version]
- Or-Rashid, M.M.; Fisher, R.; Karrow, N.; AlZahal, O.; McBride, B.W. Fatty Acid Profile of Colostrum and Milk of Ewes Supplemented with Fish Meal and the Subsequent Plasma Fatty Acid Status of Their Lambs. J. Anim. Sci. 2010, 88, 2092–2102. [Google Scholar] [CrossRef]
- Coleman, D.N.; Rivera-Acevedo, K.C.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep I. Eicosapentaenoic and Docosahexaenoic Acid Supplementation Do Not Modify Ewe and Lamb Metabolic Status and Performance through Weaning. J. Anim. Sci. 2018, 96, 364–374. [Google Scholar] [CrossRef] [Green Version]
- Asfour, H.A.; Allouh, M.Z.; Said, R.S. Myogenic Regulatory Factors: The Orchestrators of Myogenesis after 30 Years of Discovery. Exp. Biol. Med. 2018, 243, 118–128. [Google Scholar] [CrossRef]
- McKinnell, I.W.; Ishibashi, J.; Le Grand, F.; Punch, V.G.J.; Addicks, G.C.; Greenblatt, J.F.; Dilworth, F.J.; Rudnicki, M.A. Pax7 Activates Myogenic Genes by Recruitment of a Histone Methyltransferase Complex. Nat. Cell Biol. 2008, 10, 77–84. [Google Scholar] [CrossRef]
- Soleimani, V.D.; Punch, V.G.; Kawabe, Y.; Jones, A.E.; Palidwor, G.A.; Porter, C.J.; Cross, J.W.; Carvajal, J.J.; Kockx, C.E.M.; van IJcken, W.F.J.; et al. Transcriptional Dominance of PAX7 in Adult Myogenesis Is Due to High-Affinity Recognition of Homeodomain Motifs. Dev. Cell 2012, 22, 1208–1220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Von Maltzahn, J.; Jones, A.E.; Parks, R.J.; Rudnicki, M.A. Pax7 Is Critical for the Normal Function of Satellite Cells in Adult Skeletal Muscle. Proc. Natl. Acad. Sci. USA 2013, 110, 16474–16479. [Google Scholar] [CrossRef] [Green Version]
- Clark, D.L.; Boler, D.D.; Kutzler, L.W.; Jones, K.A.; McKeith, F.K.; Killefer, J.; Carr, T.R.; Dilger, A.C. Muscle Gene Expression Associated with Increased Marbling in Beef Cattle. Anim. Biotechnol. 2011, 22, 51–63. [Google Scholar] [CrossRef] [PubMed]
- Dervishi, E.; Serrano, C.; Joy, M.; Serrano, M.; Rodellar, C.; Calvo, J.H. The Effect of Feeding System in the Expression of Genes Related with Fat Metabolism in Semitendinous Muscle in Sheep. Meat Sci. 2011, 89, 91–97. [Google Scholar] [CrossRef]
- Rosen, E.D.; MacDougald, O.A. Adipocyte Differentiation from the inside Out. Nat. Rev. Mol. Cell. Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Fajas, L.; Debril, M.B.; Auwerx, J. Peroxisome Proliferator-Activated Receptor-γ: From Adipogenesis to Carcinogenesis. J. Mol. Endocrinol. 2001, 27, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Soret, B.; Mendizabal, J.A.; Arana, A.; Alfonso, L. Expression of Genes Involved in Adipogenesis and Lipid Metabolism in Subcutaneous Adipose Tissue and Longissimus Muscle in Low-Marbled Pirenaica Beef Cattle. Animal 2016, 10, 2018–2026. [Google Scholar] [CrossRef] [Green Version]
- Gupta, R.K.; Arany, Z.; Seale, P.; Mepani, R.J.; Ye, L.; Conroe, H.M.; Roby, Y.A.; Kulaga, H.; Reed, R.R.; Spiegelman, B.M. Transcriptional Control of Preadipocyte Determination by Zfp423. Nature 2010, 464, 619–623. [Google Scholar] [CrossRef]
Item (Dry Matter Basis) | CON | SFA/MUFA | PUFA |
---|---|---|---|
Ingredients, kg/cow/d | |||
Soybean hull | 0.16 | 0.77 | 0.77 |
Whole-shelled corn | 0.91 | - | - |
EnerGII | - | 0.155 | - |
Prequel | - | - | 0.12 |
Strata | - | - | 0.04 |
Macronutrient intake, kg/cow/d | |||
Dry matter | 1.07 | 0.93 | 0.93 |
Crude protein | 0.08 | 0.08 | 0.08 |
Total fat | 0.05 | 0.16 | 0.15 |
Total digestible nutrients 2 | 0.90 | 0.90 | 0.89 |
Fatty acid intake, g/d | |||
C16:0 | 4.0 | 55.6 | 21.7 |
C16:1c9 | 0.1 | 0.3 | 3.4 |
C18:0 | 0.6 | 5.8 | 5.6 |
C18:1c9 | 7.1 | 42.9 | 24.9 |
C18:2n-6 | 13.4 | 13.7 | 45.8 |
C18:3n-3 | 0.6 | 1.5 | 2.5 |
C20:5n-3 | - | - | 2.8 |
C22:6n-3 | - | - | 1.9 |
Item (% of Dry Matter) | Forage | Soybean Hull | Whole-Shelled Corn | EnerGII | Prequel | Strata |
---|---|---|---|---|---|---|
Dry matter, % | 30.2 | 86.9 | 87.2 | 96.5 | 95.6 | 96.3 |
Crude protein, % | 14.3 | 10.0 | 7.2 | - | - | - |
Neutral detergent fiber, % | 52.5 | 65.5 | 7.4 | - | - | - |
Acid detergent fiber, % | 28.2 | 48.3 | 2.6 | - | - | - |
Total fat, % | 2.9 | 3.0 | 3.6 | 83.9 | 78.2 | 78.2 |
Total fatty acid, % | 1.1 | 1.7 | 2.6 | 71.1 | 68.2 | 59.7 |
Fatty acid profile, % of total fatty acid | ||||||
C16:0 | 21.8 | 18.6 | 14.6 | 48.3 | 15.3 | 28.5 |
C16:1c9 | 2.3 | 0.8 | 0.2 | 0.2 | 0.6 | 11.6 |
C18:0 | 2.5 | 6.5 | 1.9 | 4.5 | 4.2 | 5.8 |
C18:1c9 | 5.8 | 17.2 | 27.9 | 36.9 | 26.9 | 2.8 |
C18:2n-6 | 21.6 | 40.6 | 52.1 | 7.7 | 48.2 | 4.7 |
C18:3n-3 | 37.4 | 9.6 | 1.4 | 0.2 | 1.2 | 1.2 |
C20:5n-3 | 0 | 0 | 0 | 0 | 0 | 11.6 |
C22:6n-3 | 0 | 0 | 0 | 0 | 0 | 7.8 |
Item | Common Diet |
---|---|
Ingredients, % DM basis | |
Whole-shelled corn | 50.5 |
Corn distillers grains | 34.9 |
Co-product balancer 1 | 4.4 |
Hay | 10.2 |
Analyzed nutrient content, % DM | |
DM | 86.3 |
CP | 14.8 |
NDF | 35.8 |
ADF | 12.1 |
Crude fat | 4.2 |
Accession Number | Gene 1 | Direction | Primer Sequences (5′ to 3′) | Amplicon Length (bp) |
---|---|---|---|---|
NM_001034034.2 | GAPDH [19] | F78 | AAGGTCGGAGTGAACGGATTC | 98 |
R175 | AAGGGGTCATTGATGGCGAC | |||
NM_173979.3 | ACTB [20] | F862 | GCCCTGAGGCTCTCTTCCA | 100 |
R961 | CGGATGTCGACGTCACACTT | |||
NM_001012682.1 | RPLP0 [21] | F657 | CAACCCTGAAGTGCTTGACAT | 227 |
R883 | AGGCAGATGGATCAGCCA | |||
NM_001033613 | BRPS2 [22] | F320 | GGAGCATCCCTGAAGGATGA | 101 |
R420 | TCCCCGATAGCAACAAACG | |||
BC103464 | SLC35B2 [23] | F894 | ACATTGCTTTCGACAGCTTCAC | 95 |
R988 | GAAGAGATTGACCCCAAACATCA | |||
NM_174116.1 | MYF5 [24] | F892 | CCTCTAGTTCCAGGCTCATCTA | 90 |
R981 | ACCTCCTTCCTCCTGTGTAATA | |||
NM_001111325 | MYOG [24] | F222 | GGCGTGTAAGGTGTGTAAG | 85 |
R306 | CTTCTTGAGTCTGCGCTTCT | |||
NM_001040478.2 | MYOD1 [14] | F827 | AACTGTTCCGACGGCATGAT | 105 |
R931 | CCGGGGTTCGTTGGGC | |||
XM_015460690.2 | PAX7 [14] | F435 | AGATCGAGGAGTACAAGAGGGA | 112 |
R545 | ATCGAACTCACTGAGGGCACG | |||
NM_174727.1 | MYH7 [14] | F2160 | TTCCGGCAGAGGTATCGAAT | 128 |
R2287 | TGGCCGAACTTATACTGGTTGTG | |||
NM_001046113 | MEF2C [24] | F703 | CCTGATGCAGACGATTCAGTAG | 123 |
R825 | AAAGTTGGGAGGTGGAACAG | |||
NM_001101893.1 | ZFP423 [25] | F240 | GGATTCCTCCGTGACAGCA | 120 |
R359 | TCGTCCTCATTCCTCTCCTCT | |||
NM_181024.2 | PPARG [26] | F135 | CCAAATATCGGTGGGAGTCG | 101 |
R235 | ACAGCGAAGGGCTCACTCTC | |||
NM_176784.2 | CEBPA [14] | F385 | TTCAACGACGAGTTCCTGGC | 107 |
R491 | CCCGGGTAGTCAAAGTCGTT | |||
NM_176788.1 | CEBPB [25] | F333 | CGGGCAGCACCACGACTTCC | 106 |
R438 | CCCCAGTCGGCCCAGACTCA | |||
NM_174314.2 | FABP4 [27] | F401 | TGGTGCTGGAATGTGTCATGA | 101 |
R501 | TGGAGTTCGATGCAAACGTC | |||
NM_177945 | PPARGC1A [28] | F2001 | GTACCAGCACGAAAGGCTCAA | 120 |
R2120 | ATCACACGGCGCTCTTCAA | |||
NM_177518 | AGPAT1 [29] | F563 | TGCCATCAGTGTCATGTCTG | 86 |
R648 | GGTTTCTCGTGCCCTCAG | |||
CR552737 | FASN [30] | F6383 | ACCTCGTGAAGGCTGTGACTCA | 92 |
R6474 | TGAGTCGAGGCCAAGGTCTGGAA | |||
NM_001113302.1 | SREBP1 [31] | F2858 | TACCTGCAGCTTCTCCATCA | 145 |
R3002 | CACCAATGGGTACAGCCTCT | |||
NM_173959.4 | SCD [32] | F809 | TCCTGTTGTTGTGCTTCATCC | 101 |
R909 | GGCATAACGGAATAAGGTGGC | |||
NM_174224.2 | ACACA [14] | F182 | TGTGAAGTATCCTTCTGGAGGT | 99 |
R280 | CTTCCAAAAAGAACTCAGAGACC |
Item | Mid-Sup 2 | At-Calving 3 | SEM | p-Value 4 | ||||||
---|---|---|---|---|---|---|---|---|---|---|
CON 5 | SFA/ MUFA 6 | PUFA 7 | CON | SFA/MUFA | PUFA | Trt | Time | Trt x Time | ||
Groups, n | 4 | 4 | 4 | 4 | 4 | 4 | ||||
C15:0 | 44 | 51 | 44 | 31 | 27 | 37 | 4 | 0.76 | <0.01 | 0.17 |
C16:0 | 1008 | 1353 | 1078 | 1373 | 1274 | 1589 | 121.8 | 0.47 | 0.03 | 0.09 |
C16:1c9 | 17.8 | 16.4 | 7.1 | 46.4 | 31.8 | 45.9 | 4.73 | 0.29 | <0.01 | 0.09 |
C17:0 | 68 | 78 | 77 | 49 | 42 | 58 | 5.2 | 0.22 | <0.01 | 0.26 |
C18:0 | 1420 | 1787 | 1468 | 1303 | 1219 | 1465 | 124.9 | 0.52 | 0.05 | 0.11 |
C18:1c9 | 481 | 669 | 446 | 975 | 774 | 696 | 120.6 | 0.38 | 0.02 | 0.31 |
C18:2n-6 | 975 | 1705 | 1499 | 779 | 977 | 1379 | 150.3 | 0.01 | 0.02 | 0.14 |
C18:3n-3 | 277 | 316 | 196 | 159 | 169 | 183 | 45.7 | 0.53 | 0.04 | 0.35 |
C20:0 | 3.2 | 3.8 | 3.9 | 2.4 | 3.0 | 4.0 | 0.57 | 0.16 | 0.32 | 0.69 |
C20:3n-6 | 114 | 128 | 103 | 67 | 56 | 65 | 12.1 | 0.75 | <0.01 | 0.30 |
C20:4n-6 | 132 | 176 | 141 | 138 | 131 | 169 | 20.3 | 0.57 | 0.83 | 0.23 |
C20:5n-3 | 34 | 41 | 49 | 31 | 33 | 46 | 7.1 | 0.15 | 0.47 | 0.92 |
Item 1 | CON 2 | SFA/MUFA 3 | PUFA 4 | SEM | p-Value |
---|---|---|---|---|---|
Cow BW, kg | |||||
Initial (d -82) | 611 | 613 | 608 | 13.7 | 0.93 |
Mid supplementation (d -42) | 662 | 665 | 661 | 14.4 | 0.96 |
Calving (4 ± 2 d post-calving) | 628 | 637 | 623 | 14.8 | 0.60 |
WSW (d 68) | 622 | 636 | 626 | 15.9 | 0.66 |
AI (d 85) | 629 | 649 | 638 | 16.5 | 0.47 |
AI-conception check (d 120) | 567 | 590 | 601 | 15.9 | 0.13 |
Weaning (d 174) | 563 | 578 | 569 | 16.1 | 0.64 |
Cow BCS | |||||
Initial | 6.1 | 6.1 | 6.0 | 0.19 | 0.98 |
Mid supplementation | 6.2 | 6.6 | 6.2 | 0.24 | 0.19 |
Calving | 5.4 | 5.4 | 5.3 | 0.18 | 0.55 |
WSW | 5.3 | 5.6 | 5.2 | 0.15 | 0.11 |
AI | 5.1 | 5.2 | 4.9 | 0.22 | 0.45 |
AI-conception check | 5.0 | 5.0 | 5.0 | 0.04 | 0.29 |
Weaning | 5.0 | 5.1 | 5.0 | 0.07 | 0.64 |
Item 1 | CON 2 | SFA/MUFA 3 | PUFA 4 | SEM | p-Value |
---|---|---|---|---|---|
Gestation length, d | 279 | 279 | 278 | 1.3 | 0.63 |
Milk production1 (kg/d) | 9.3 | 8.1 | 8.7 | 1.78 | 0.80 |
Composition | |||||
Fat, % | 3.2 | 2.5 | 3.1 | 0.47 | 0.28 |
Protein, % | 2.7 | 2.8 | 3.0 | 0.12 | 0.12 |
Lactose, % | 4.9 | 4.8 | 4.6 | 0.18 | 0.28 |
Other solids, % | 6.0 | 5.9 | 5.7 | 0.16 | 0.29 |
Total solids, % | 11.9 | 11.2 | 11.8 | 0.42 | 0.24 |
MUN, mg/dL | 5.0 | 4.1 | 5.1 | 0.75 | 0.31 |
AI pregnancy, % | 31.6 | 34.4 | 29.0 | - | 0.96 |
Overall pregnancy, % | 99.3 | 98.5 | 98.9 | - | 0.88 |
Item (g/100 g Fatty Acid) | CON 2 | SFA/MUFA 3 | PUFA 4 | SEM | p-Value |
---|---|---|---|---|---|
Groups, n | 4 | 4 | 4 | ||
C4:0 | 4.1 | 4.1 | 4.1 | 0.15 | 0.99 |
C6:0 | 1.8 | 1.8 | 1.8 | 0.06 | 0.51 |
C8:0 5 | 1.0 | 1.1 | 1.0 | - | 0.31 |
C10:0 | 2.2 | 2.4 | 2.2 | 0.13 | 0.41 |
C12:0 | 2.5 | 2.7 | 2.5 | 0.16 | 0.45 |
C14:0 | 8.9 | 9.4 | 9.1 | 0.44 | 0.54 |
C15:0 | 1.1 b | 1.2 ab | 1.3 a | 0.05 | 0.05 |
C16:0 | 27 | 26 | 26 | 0.8 | 0.76 |
C16:1 c9 | 2.1 | 1.9 | 2.0 | 0.08 | 0.07 |
C17:0 | 0.9 | 0.9 | 1.0 | 0.03 | 0.08 |
C18:0 | 10.1 | 10.4 | 10.6 | 0.67 | 0.76 |
C18:1 t6, 8 | 0.22 | 0.24 | 0.24 | 0.015 | 0.47 |
C18:1 t9 | 0.19 | 0.19 | 0.18 | 0.011 | 0.78 |
C18:1 t11 | 2.2 | 2.3 | 2.3 | 0.14 | 0.77 |
C18:1 t12 | 0.19 | 0.19 | 0.19 | 0.012 | 0.86 |
C18:1 c9 | 24 | 23 | 23 | 0.9 | 0.34 |
C18:1 c11 | 0.58 | 0.52 | 0.57 | 0.033 | 0.30 |
C18:1 c12 | 0.07 | 0.07 | 0.07 | 0.005 | 0.90 |
C18:1 t16 | 0.16 | 0.17 | 0.17 | 0.010 | 0.43 |
C18:2 c9, c12 | 1.9 | 2.0 | 2.0 | 0.10 | 0.37 |
C20:0 5 | 0.18 | 0.19 | 0.20 | - | 0.30 |
C20:1 c11 5 | 0.05 | 0.04 | 0.05 | - | 0.28 |
C18:3 c9, c12, c15 | 0.54 | 0.58 | 0.64 | 0.037 | 0.07 |
CLA c9, t11 | 1.08 | 1.08 | 1.05 | 0.063 | 0.80 |
C22:0 | 0.07 | 0.08 | 0.09 | 0.008 | 0.06 |
C20:3 n6 5 | 0.07 | 0.08 | 0.08 | - | 0.29 |
C20:4 n6 5 | 0.14 | 0.14 | 0.14 | - | 0.98 |
C20:5 n3 | 0.05 | 0.05 | 0.05 | 0.004 | 0.23 |
C22:5 n3 | 0.11 | 0.12 | 0.13 | 0.010 | 0.41 |
Total n-3 | 0.70 b | 0.75 ab | 0.83 a | 0.008 | 0.05 |
Total n-6 | 2.1 | 2.2 | 2.3 | 0.12 | 0.39 |
Item 1 | CON 2 | SFA/MUFA 3 | PUFA 4 | SEM | p-Value |
---|---|---|---|---|---|
Groups, n | 4 | 4 | 4 | ||
C15:0 | 20 | 22 | 26 | 3.1 | 0.38 |
C16:0 | 1080 | 1168 | 1206 | 47.6 | 0.21 |
C16:1c9 | 34 | 24 | 34 | 6.1 | 0.43 |
C17:0 | 33 ab | 28 b | 47 a | 4.5 | 0.04 |
C18:0 | 932 | 976 | 1071 | 46.2 | 0.16 |
C18:1c9 | 901 | 789 | 783 | 55.9 | 0.30 |
C18:2n-6 | 624 b | 746 ab | 990 a | 86.1 | 0.04 |
C18:3n-3 | 103 | 60 | 113 | 19.5 | 0.19 |
C20:0 | 3.6 ab | 1.9 b | 5.9 a | 0.74 | 0.02 |
C20:3n-6 | 28 ab | 19 b | 51 a | 7.6 | 0.05 |
C20:4n-6 | 103 b | 70 b | 171 a | 20.3 | 0.02 |
C20:5n-3 | 27 ab | 15 b | 44 a | 5.4 | 0.02 |
Item 1 | CON 2 | SFA/MUFA 3 | PUFA 4 | SEM | p-Value |
---|---|---|---|---|---|
Birth BW, kg | 33.7 | 34.1 | 32.7 | 0.74 | 0.19 |
Weaning BW, kg | 183 | 186 | 190 | 4.5 | 0.34 |
Pre-weaning ADG, kg/d | 0.85 | 0.87 | 0.90 | 0.027 | 0.21 |
Weaning age, d | 174 | 173 | 175 | 1.4 | 0.63 |
Backgrounding BW, kg | 244 | 244 | 248 | 6.2 | 0.76 |
Backgrounding5 ADG, kg/d | 1.43 | 1.40 | 1.43 | 0.057 | 0.85 |
Gene 6 | Birth | Weaning | p-Value 5 | ||||||
---|---|---|---|---|---|---|---|---|---|
CON 2 | SFA/MUFA 3 | PUFA 4 | CON | SFA/MUFA | PUFA | Trt | Time | Trt × Time | |
MYOD1 | 1.033 | 1.080 | 1.191 | 0.997 | 0.770 | 0.891 | 0.56 | 0.02 | 0.36 |
MYOG | 0.912 | 1.020 | 0.982 | 0.897 | 0.940 | 0.975 | 0.69 | 0.68 | 0.93 |
PAX7 | 0.992 b | 1.232 a | 1.230 a | 0.910 b | 0.745 c | 0.753 c | 0.98 | <0.01 | <0.01 |
MYF5 | 0.992 | 1.071 | 1.059 | 0.834 | 0.784 | 0.833 | 0.89 | <0.01 | 0.61 |
MYH7 | 0.614 | 0.597 | 0.846 | 1.225 | 1.193 | 1.467 | 0.01 | <0.01 | 0.44 |
AGPAT1 | 0.786 c | 0.904 b | 0.989 ab | 1.036 a | 0.915 ab | 0.893 b | 0.55 | 0.08 | <0.01 |
CPT1 | 0.739 c | 0.795 bc | 1.040 a | 0.924 ab | 0.814 bc | 0.895 abc | 0.15 | 0.53 | 0.02 |
PPARG | 0.112 | 0.125 | 0.138 | 0.213 | 0.246 | 0.231 | 0.10 | <0.01 | 0.36 |
ZFP423 | 0.641 | 0.732 | 0.810 | 1.072 | 1.193 | 1.211 | 0.12 | <0.01 | 0.68 |
CEBPA | 0.076 | 0.074 | 0.093 | 0.411 | 0.510 | 0.454 | 0.47 | <0.01 | 0.28 |
CEBPB | 0.057 | 0.058 | 0.081 | 0.297 | 0.350 | 0.342 | 0.12 | <0.01 | 0.08 |
Gene 6 | Birth | Weaning | p-Value 5 | ||||||
---|---|---|---|---|---|---|---|---|---|
CON 2 | SFA/MUFA 3 | PUFA 4 | CON | SFA/ MUFA | PUFA | Trt | Time | Trt × Time | |
ZFP423 | 1.055 | 1.114 | 1.134 | 1.324 | 1.205 | 1.073 | 0.48 | 0.09 | 0.07 |
ACACA | 1.470 | 1.537 | 1.309 | 0.157 | 0.250 | 0.169 | 0.75 | <0.01 | 0.86 |
CEBPA | 0.624 | 0.692 | 0.875 | 0.665 | 0.615 | 0.622 | 0.64 | 0.16 | 0.21 |
CEBPB | 0.469 | 0.477 | 0.619 | 0.527 | 0.466 | 0.489 | 0.16 | 0.41 | 0.07 |
PPARG | 1.039 | 0.964 | 1.132 | 0.848 | 0.794 | 0.757 | 0.87 | <0.01 | 0.58 |
SCD | 0.634 | 0.572 | 0.462 | 0.082 | 0.097 | 0.079 | 0.72 | <0.01 | 0.78 |
FASN | 0.991 | 0.591 | 0.672 | 0.117 | 0.103 | 0.131 | 0.69 | <0.01 | 0.69 |
FABP4 | 0.974 | 0.874 | 1.220 | 1.044 | 0.942 | 0.905 | 0.61 | 0.53 | 0.16 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shao, T.; McCann, J.C.; Shike, D.W. Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development. Animals 2023, 13, 437. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13030437
Shao T, McCann JC, Shike DW. Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development. Animals. 2023; 13(3):437. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13030437
Chicago/Turabian StyleShao, Taoqi, Joshua C. McCann, and Daniel W. Shike. 2023. "Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development" Animals 13, no. 3: 437. https://0-doi-org.brum.beds.ac.uk/10.3390/ani13030437