Brown Algae-Derived Fucoidan Exerts Oxidative Stress-Dependent Antiproliferation on Oral Cancer Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Cell Cultures
2.3. Cell Viability Assays
2.4. Cell Cycle Assays
2.5. Apoptosis (Annexin V/7AAD) Assays
2.6. Apoptosis (Caspases 3, 8, and 9) Assays
2.7. Reactive Oxygen Species (ROS), Mitochondrial Superoxide (MitoSOX), and Glutathione (GSH) Assays
2.8. Quantitative PCR (qPCR)
2.9. γH2AX/7AAD and 8-Hydroxy-2-Deoxyguanosine (8-OHdG) Detections
2.10. Statistical Analysis
3. Results
3.1. Preferential Antiproliferation Effect of Fucoidan
3.2. Cell Cycle Effect of Fucoidan
3.3. Preferential Apoptosis Effect of Fucoidan
3.4. Preferential Apoptosis Signaling Effect of Fucoidan
3.5. Preferential ROS and MitoSOX Generations, and GSH Depletion Effects of Fucoidan
3.6. Preferential Antioxidant Signaling Effects of Fucoidan
3.7. Preferential DNA Damage Effect of Fucoidan
4. Discussion
4.1. Fucoidan Induces Preferential Antiproliferation Effect
4.2. Fucoidan Causes Preferential Oxidative Stress
4.3. Fucoidan Causes Preferential Downregulation of Antioxidant Signaling
4.4. Fucoidan Causes Preferential Apoptosis
4.5. Fucoidan Causes Preferential DNA Damage
4.6. Fucoidan Causes Preferential Cell Cycle Arrest
4.7. Preferential Oxidative Stress Plays a Vital Role in Fucoidan-Induced Preferential Antiproliferation Mechanisms
4.8. Limitation of Our Fucoidan-Treated Oral Cancer Cell Study
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Silverman, S., Jr. Oral cancer: Complications of therapy. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 1999, 88, 122–126. [Google Scholar] [CrossRef]
- Wells, M.L.; Potin, P.; Craigie, J.S.; Raven, J.A.; Merchant, S.S.; Helliwell, K.E.; Smith, A.G.; Camire, M.E.; Brawley, S.H. Algae as nutritional and functional food sources: Revisiting our understanding. J. Appl. Phycol. 2017, 29, 949–982. [Google Scholar] [CrossRef] [PubMed]
- Ngo, D.H.; Kim, S.K. Sulfated polysaccharides as bioactive agents from marine algae. Int. J. Biol. Macromol. 2013, 62, 70–75. [Google Scholar] [CrossRef] [PubMed]
- Hentati, F.; Tounsi, L.; Djomdi, D.; Pierre, G.; Delattre, C.; Ursu, A.V.; Fendri, I.; Abdelkafi, S.; Michaud, P. Bioactive polysaccharides from seaweeds. Molecules 2020, 25, 3152. [Google Scholar] [CrossRef]
- Lin, Y.; Qi, X.; Liu, H.; Xue, K.; Xu, S.; Tian, Z. The anti-cancer effects of fucoidan: A review of both In Vivo and In Vitro investigations. Cancer Cell Int. 2020, 20, 154. [Google Scholar] [CrossRef]
- Phull, A.R.; Kim, S.J. Fucoidan as bio-functional molecule: Insights into the anti-inflammatory potential and associated molecular mechanisms. J. Funct. Foods 2017, 38, 415–426. [Google Scholar] [CrossRef]
- Durig, J.; Bruhn, T.; Zurborn, K.H.; Gutensohn, K.; Bruhn, H.D.; Beress, L. Anticoagulant fucoidan fractions from Fucus vesiculosus induce platelet activation In Vitro. Thromb. Res. 1997, 85, 479–491. [Google Scholar] [CrossRef]
- Liu, M.; Liu, Y.; Cao, M.J.; Liu, G.M.; Chen, Q.; Sun, L.; Chen, H. Antibacterial activity and mechanisms of depolymerized fucoidans isolated from Laminaria japonica. Carbohydr. Polym. 2017, 172, 294–305. [Google Scholar] [CrossRef]
- Hsu, H.Y.; Hwang, P.A. Clinical applications of fucoidan in translational medicine for adjuvant cancer therapy. Clin. Transl. Med. 2019, 8, 15. [Google Scholar] [CrossRef] [Green Version]
- Boo, H.J.; Hong, J.Y.; Kim, S.C.; Kang, J.I.; Kim, M.K.; Kim, E.J.; Hyun, J.W.; Koh, Y.S.; Yoo, E.S.; Kwon, J.M.; et al. The anticancer effect of fucoidan in PC-3 prostate cancer cells. Mar. Drugs 2013, 11, 2982–2999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagamine, T.; Hayakawa, K.; Kusakabe, T.; Takada, H.; Nakazato, K.; Hisanaga, E.; Iha, M. Inhibitory effect of fucoidan on Huh7 hepatoma cells through downregulation of CXCL12. Nutr. Cancer 2009, 61, 340–347. [Google Scholar] [CrossRef]
- Zhang, Z.; Teruya, K.; Eto, H.; Shirahata, S. Fucoidan extract induces apoptosis in MCF-7 cells via a mechanism involving the ROS-dependent JNK activation and mitochondria-mediated pathways. PLoS ONE 2011, 6, e27441. [Google Scholar] [CrossRef] [PubMed]
- Xue, M.; Ge, Y.; Zhang, J.; Liu, Y.; Wang, Q.; Hou, L.; Zheng, Z. Fucoidan inhibited 4T1 mouse breast cancer cell growth in vivo and In Vitro via downregulation of Wnt/beta-catenin signaling. Nutr. Cancer 2013, 65, 460–468. [Google Scholar] [CrossRef] [PubMed]
- Citkowska, A.; Szekalska, M.; Winnicka, K. Possibilities of fucoidan utilization in the development of pharmaceutical dosage forms. Mar. Drugs 2019, 17, 458. [Google Scholar] [CrossRef] [Green Version]
- Han, M.H.; Lee, D.S.; Jeong, J.W.; Hong, S.H.; Choi, I.W.; Cha, H.J.; Kim, S.; Kim, H.S.; Park, C.; Kim, G.Y.; et al. Fucoidan induces ROS-dependent apoptosis in 5637 human bladder cancer cells by downregulating telomerase activity via inactivation of the PI3K/Akt signaling pathway. Drug Dev. Res. 2017, 78, 37–48. [Google Scholar] [CrossRef]
- Srinivas, U.S.; Tan, B.W.Q.; Vellayappan, B.A.; Jeyasekharan, A.D. ROS and the DNA damage response in cancer. Redox Biol. 2019, 25, 101084. [Google Scholar] [CrossRef]
- Ma, Q. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [Green Version]
- Weber, D.J.; Rutala, W.A.; Anderson, D.J.; Chen, L.F.; Sickbert-Bennett, E.E.; Boyce, J.M. Effectiveness of ultraviolet devices and hydrogen peroxide systems for terminal room decontamination: Focus on clinical trials. Am. J. Infect. Control. 2016, 44, e77–e84. [Google Scholar] [CrossRef]
- Ge, J.; Zhang, C.; Sun, Y.C.; Zhang, Q.; Lv, M.W.; Guo, K.; Li, J.L. Cadmium exposure triggers mitochondrial dysfunction and oxidative stress in chicken (Gallus gallus) kidney via mitochondrial UPR inhibition and Nrf2-mediated antioxidant defense activation. Sci. Total Environ. 2019, 689, 1160–1171. [Google Scholar] [CrossRef]
- Huang, C.H.; Yeh, J.M.; Chan, W.H. Hazardous impacts of silver nanoparticles on mouse oocyte maturation and fertilization and fetal development through induction of apoptotic processes. Environ. Toxicol. 2018, 33, 1039–1049. [Google Scholar] [CrossRef]
- Liu, Y.C.; Peng, B.R.; Hsu, K.C.; El-Shazly, M.; Shih, S.P.; Lin, T.E.; Kuo, F.W.; Chou, Y.C.; Lin, H.Y.; Lu, M.C. 13-Acetoxysarcocrassolide exhibits cytotoxic activity against oral cancer cells through the interruption of the Keap1/Nrf2/p62/SQSTM1 pathway: The need to move beyond classical concepts. Mar. Drugs 2020, 18, 382. [Google Scholar] [CrossRef]
- Wong, D.Y.; Chang, K.W.; Chen, C.F.; Chang, R.C. Characterization of two new cell lines derived from oral cavity human squamous cell carcinomas—OC1 and OC2. J. Oral Maxillofac. Surg. 1990, 48, 385–390. [Google Scholar] [CrossRef]
- Yang, C.Y.; Meng, C.L. Regulation of PG synthase by EGF and PDGF in human oral, breast, stomach, and fibrosarcoma cancer cell lines. J. Dent. Res. 1994, 73, 1407–1415. [Google Scholar] [CrossRef]
- Kasten, F.H.; Pineda, L.F.; Schneider, P.E.; Rawls, H.R.; Foster, T.A. Biocompatibility testing of an experimental fluoride releasing resin using human gingival epithelial cells In Vitro. Cell Dev. Biol. 1989, 25, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Kasten, F.H.; Soileau, K.; Meffert, R.M. Quantitative evaluation of human gingival epithelial cell attachment to implant surfaces In Vitro. Int. J. Periodontics Restor. Dent. 1990, 10, 68–79. [Google Scholar]
- Hsieh, P.L.; Liao, Y.W.; Hsieh, C.W.; Chen, P.N.; Yu, C.C. Soy isoflavone genistein impedes cancer stemness and mesenchymal transition in head and neck cancer through activating miR-34a/RTCB axis. Nutrients 2020, 12, 1924. [Google Scholar] [CrossRef]
- Wang, H.R.; Tang, J.Y.; Wang, Y.Y.; Farooqi, A.A.; Yen, C.Y.; Yuan, S.F.; Huang, H.W.; Chang, H.W. Manoalide preferentially provides antiproliferation of oral cancer cells by oxidative stress-mediated apoptosis and DNA damage. Cancers 2019, 11, 1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yeh, C.C.; Tseng, C.N.; Yang, J.I.; Huang, H.W.; Fang, Y.; Tang, J.Y.; Chang, F.R.; Chang, H.W. Antiproliferation and induction of apoptosis in Ca9-22 oral cancer cells by ethanolic extract of Gracilaria tenuistipitata. Molecules 2012, 17, 10916–10927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vignon, C.; Debeissat, C.; Georget, M.T.; Bouscary, D.; Gyan, E.; Rosset, P.; Herault, O. Flow cytometric quantification of all phases of the cell cycle and apoptosis in a two-color fluorescence plot. PLoS ONE 2013, 8, e68425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, H.C.; Hsieh, Y.C.; Li, L.H.; Chang, C.C.; Janouskova, K.; Ramani, M.V.; Subbaraju, G.V.; Cheng, K.T.; Chang, C.C. Dehydroxyhispolon methyl ether, a hispolon derivative, inhibits WNT/beta-catenin signaling to elicit human colorectal carcinoma cell apoptosis. Int. J. Mol. Sci. 2020, 21, 8839. [Google Scholar] [CrossRef]
- Lin, C.H.; Chan, H.S.; Tsay, H.S.; Funayama, S.; Kuo, C.L.; Chung, J.G. Ethyl acetate fraction from methanol extraction of Vitis thunbergii var. taiwaniana induced G0 /G1 phase arrest via inhibition of cyclins D and E and induction of apoptosis through caspase-dependent and -independent pathways in human prostate carcinoma DU145 cells. Environ. Toxicol. 2018, 33, 41–51. [Google Scholar] [CrossRef]
- Liu, S.L.; Yang, K.H.; Yang, C.W.; Lee, M.Y.; Chuang, Y.T.; Chen, Y.N.; Chang, F.R.; Chen, C.Y.; Chang, H.W. Burmannic acid inhibits proliferation and induces oxidative stress response of oral cancer cells. Antioxidants 2021, 10, 1588. [Google Scholar] [CrossRef] [PubMed]
- Yang, I.H.; Tsai, Y.T.; Chiu, S.J.; Liu, L.T.; Lee, H.H.; Hou, M.F.; Hsu, W.L.; Chen, B.K.; Chang, W.C. Involvement of STIM1 and Orai1 in EGF-mediated cell growth in retinal pigment epithelial cells. J. Biomed. Sci. 2013, 20, 41. [Google Scholar] [CrossRef] [Green Version]
- Chang, H.W.; Yen, C.Y.; Chen, C.H.; Tsai, J.H.; Tang, J.Y.; Chang, Y.T.; Kao, Y.H.; Wang, Y.Y.; Yuan, S.F.; Lee, S.Y. Evaluation of the mRNA expression levels of integrins alpha3, alpha5, beta1 and beta6 as tumor biomarkers of oral squamous cell carcinoma. Oncol. Lett. 2018, 16, 4773–4781. [Google Scholar] [CrossRef] [PubMed]
- Chiu, C.C.; Huang, J.W.; Chang, F.R.; Huang, K.J.; Huang, H.M.; Huang, H.W.; Chou, C.K.; Wu, Y.C.; Chang, H.W. Golden berry-derived 4beta-hydroxywithanolide E for selectively killing oral cancer cells by generating ROS, DNA damage, and apoptotic pathways. PLoS ONE 2013, 8, e64739. [Google Scholar] [CrossRef] [Green Version]
- Espinosa-Diez, C.; Miguel, V.; Mennerich, D.; Kietzmann, T.; Sanchez-Perez, P.; Cadenas, S.; Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol 2015, 6, 183–197. [Google Scholar] [CrossRef] [Green Version]
- Mizrachi, A.; Shamay, Y.; Shah, J.; Brook, S.; Soong, J.; Rajasekhar, V.K.; Humm, J.L.; Healey, J.H.; Powell, S.N.; Baselga, J.; et al. Tumour-specific PI3K inhibition via nanoparticle-targeted delivery in head and neck squamous cell carcinoma. Nat. Commun. 2017, 8, 14292. [Google Scholar] [CrossRef]
- Lin, J.; Wang, K.; Wang, H.; Shao, Q.; Luan, Y.; Xu, Y.; Song, X.; Tan, W.; Liu, S.; Wei, F.; et al. Fucoidan reduced the invasion of oral squamous cell carcinoma cells and modified their effects to macrophages. Med. Oncol. 2017, 34, 9. [Google Scholar] [CrossRef] [PubMed]
- Hsu, H.Y.; Lin, T.Y.; Hu, C.H.; Shu, D.T.F.; Lu, M.K. Fucoidan upregulates TLR4/CHOP-mediated caspase-3 and PARP activation to enhance cisplatin-induced cytotoxicity in human lung cancer cells. Cancer Lett. 2018, 432, 112–120. [Google Scholar] [CrossRef]
- Chantree, P.; Surarak, T.; Sangpairoj, K.; Aguilar, P.; Hitakomate, E. Antitumor effects of fucoidan via apoptotic and autophagic induction on HSC-3 oral squamous cellcarcinoma. Asian Pac. J. Cancer Prev. 2020, 21, 2469–2477. [Google Scholar] [CrossRef]
- Zhang, N.; Gao, L.; Ren, W.; Li, S.; Zhang, D.; Song, X.; Zhao, C.; Zhi, K. Fucoidan affects oral squamous cell carcinoma cell functions in vitro by regulating FLNA-derived circular RNA. Ann. N. Y. Acad. Sci. 2020, 1462, 65–78. [Google Scholar] [CrossRef]
- Yang, K.H.; Lin, Y.S.; Wang, S.C.; Lee, M.Y.; Tang, J.Y.; Chang, F.R.; Chuang, Y.T.; Sheu, J.H.; Chang, H.W. Soft coral-derived dihydrosinularin exhibits antiproliferative effects associated with apoptosis and DNA damage in oral cancer cells. Pharmaceuticals 2021, 14, 994. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.Y.; Wu, C.Y.; Shu, C.W.; Wang, S.C.; Chang, M.Y.; Chang, H.W. A novel sulfonyl chromen-4-ones (CHW09) preferentially kills oral cancer cells showing apoptosis, oxidative stress, and DNA damage. Environ. Toxicol. 2018, 33, 1195–1203. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.J.; Hsieh, C.Y.; Tang, J.Y.; Lin, L.C.; Huang, H.W.; Wang, H.R.; Yeh, Y.C.; Chuang, Y.T.; Ou-Yang, F.; Chang, H.W. Antimycin A shows selective antiproliferation to oral cancer cells by oxidative stress-mediated apoptosis and DNA damage. Environ. Toxicol. 2020, 35, 1212–1224. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.Y.; Wu, K.H.; Wang, Y.Y.; Farooqi, A.A.; Huang, H.W.; Yuan, S.F.; Jian, R.I.; Tsao, L.Y.; Chen, P.A.; Chang, F.R.; et al. Methanol extract of Usnea barbata induces cell killing, apoptosis, and DNA damage against oral cancer cells through oxidative stress. Antioxidant 2020, 9, 694. [Google Scholar] [CrossRef]
- Aldossary, S.A. Review on pharmacology of cisplatin: Clinical use, toxicity and mechanism of resistance of cisplatin. Biomed. Pharm. J. 2019, 12, 7–15. [Google Scholar] [CrossRef]
- Bouayed, J.; Bohn, T. Exogenous antioxidants--Double-edged swords in cellular redox state: Health beneficial effects at physiologic doses versus deleterious effects at high doses. Oxidative Med. Cell. Longev. 2010, 3, 228–237. [Google Scholar] [CrossRef]
- Laeliocattleya, R.A.; Suloi, A.; Gayatri, P.; Putri, N.; Anggraeni, Y. Fucoidan content from brown seaweed (Sargassum filipendula) and its potential as radical scavenger. J. Phys. Conf. Ser. 2020, 1430, 012023. [Google Scholar] [CrossRef]
- Fidelis, G.P.; Silva, C.H.F.; Nobre, L.; Medeiros, V.P.; Rocha, H.A.O.; Costa, L.S. Antioxidant fucoidans obtained from tropical seaweed protect pre-osteoblastic cells from hydrogen peroxide-induced damage. Mar. Drugs 2019, 17, 506. [Google Scholar] [CrossRef] [Green Version]
- Banafa, A.M.; Roshan, S.; Liu, Y.Y.; Chen, H.J.; Chen, M.J.; Yang, G.X.; He, G.Y. Fucoidan induces G1 phase arrest and apoptosis through caspases-dependent pathway and ROS induction in human breast cancer MCF-7 cells. J. Huazhong Univ. Sci. Technol. 2013, 33, 717–724. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.; Xiao, Q.; Kuang, X.; Zhang, T.; Yang, Z.; Wang, L. Fucoidan inhibits proliferation of the SKM-1 acute myeloid leukaemia cell line via the activation of apoptotic pathways and production of reactive oxygen species. Mol. Med. Rep. 2015, 12, 6649–6655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Narayani, S.S.; Saravanan, S.; Ravindran, J.; Ramasamy, M.S.; Chitra, J. In Vitro anticancer activity of fucoidan extracted from Sargassum cinereum against Caco-2 cells. Int. J. Biol. Macromol. 2019, 138, 618–628. [Google Scholar] [CrossRef]
- Yang, L.; Wang, P.; Wang, H.; Li, Q.; Teng, H.; Liu, Z.; Yang, W.; Hou, L.; Zou, X. Fucoidan derived from Undaria pinnatifida induces apoptosis in human hepatocellular carcinoma SMMC-7721 cells via the ROS-mediated mitochondrial pathway. Mar. Drugs 2013, 11, 1961–1976. [Google Scholar] [CrossRef] [Green Version]
- Blaszczak, W.; Lach, M.S.; Barczak, W.; Suchorska, W.M. Fucoidan exerts anticancer effects against head and neck squamous cell carcinoma In Vitro. Molecules 2018, 23, 3302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abboud, M.M.; Al Awaida, W.; Alkhateeb, H.H.; Abu-Ayyad, A.N. Antitumor action of amygdalin on human breast cancer cells by selective sensitization to oxidative stress. Nutr. Cancer 2019, 71, 483–490. [Google Scholar] [CrossRef]
- Edamatsu, T.; Fujieda, A.; Itoh, Y. Phenyl sulfate, indoxyl sulfate and p-cresyl sulfate decrease glutathione level to render cells vulnerable to oxidative stress in renal tubular cells. PLoS ONE 2018, 13, e0193342. [Google Scholar] [CrossRef] [Green Version]
- Tang, J.Y.; Ou-Yang, F.; Hou, M.F.; Huang, H.W.; Wang, H.R.; Li, K.T.; Fayyaz, S.; Shu, C.W.; Chang, H.W. Oxidative stress-modulating drugs have preferential anticancer effects—Involving the regulation of apoptosis, DNA damage, endoplasmic reticulum stress, autophagy, metabolism, and migration. Semin. Cancer Biol. 2019, 58, 109–117. [Google Scholar] [CrossRef]
- Sies, H. Oxidative stress: Eustress and distress in redox homeostasis. In Stress: Physiology, Biochemistry, and Pathology; Elsevier: Amsterdam, The Netherlands, 2019; pp. 153–163. [Google Scholar]
- Ahmad, T.; Suzuki, Y.J. Juglone in oxidative stress and cell signaling. Antioxidants 2019, 8, 91. [Google Scholar] [CrossRef] [Green Version]
- Jasek-Gajda, E.; Jurkowska, H.; Jasinska, M.; Lis, G.J. Targeting the MAPK/ERK and PI3K/AKT signaling pathways affects NRF2, Trx and GSH antioxidant systems in leukemia cells. Antioxidants 2020, 9, 633. [Google Scholar] [CrossRef]
- Rostila, A.M.; Anttila, S.L.; Lalowski, M.M.; Vuopala, K.S.; Toljamo, T.I.; Lindstrom, I.; Baumann, M.H.; Puustinen, A.M. Reactive oxygen species-regulating proteins peroxiredoxin 2 and thioredoxin, and glyceraldehyde-3-phosphate dehydrogenase are differentially abundant in induced sputum from smokers with lung cancer or asbestos exposure. Eur. J. Cancer Prev. 2020, 29, 238–247. [Google Scholar] [CrossRef] [PubMed]
- Carlisi, D.; Buttitta, G.; Di Fiore, R.; Scerri, C.; Drago-Ferrante, R.; Vento, R.; Tesoriere, G. Parthenolide and DMAPT exert cytotoxic effects on breast cancer stem-like cells by inducing oxidative stress, mitochondrial dysfunction and necrosis. Cell Death Dis. 2016, 7, e2194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Wu, Q.; Chen, Y.; Zhang, J.; Li, H.; Yang, Z.; Yang, Y.; Deng, Y.; Zhang, L.; Liu, B. Diosmetin induces apoptosis and enhances the chemotherapeutic efficacy of paclitaxel in non-small cell lung cancer cells via Nrf2 inhibition. Br. J. Pharmacol. 2019, 176, 2079–2094. [Google Scholar] [CrossRef] [PubMed]
- Hawkes, H.J.; Karlenius, T.C.; Tonissen, K.F. Regulation of the human thioredoxin gene promoter and its key substrates: A study of functional and putative regulatory elements. Biochim. Biophys. Acta Gener. Subj. 2014, 1840, 303–314. [Google Scholar] [CrossRef]
- Alam, J.; Stewart, D.; Touchard, C.; Boinapally, S.; Choi, A.M.; Cook, J.L. Nrf2, a Cap’n’Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J. Biol. Chem. 1999, 274, 26071–26078. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, S.Y.; Lin, L.C.; Chen, S.R.; Farooqi, A.A.; Cheng, Y.B.; Tang, J.Y.; Chang, H.W. Pomegranate extract (POMx) induces mitochondrial dysfunction and apoptosis of oral cancer cells. Antioxidants 2021, 10, 1117. [Google Scholar] [CrossRef]
- Zou, Z.; Chang, H.; Li, H.; Wang, S. Induction of reactive oxygen species: An emerging approach for cancer therapy. Apoptosis Int. J. Program. Cell Death 2017, 22, 1321–1335. [Google Scholar] [CrossRef]
- Gao, J.; Wang, Z.; Guo, Q.; Tang, H.; Wang, Z.; Yang, C.; Fan, H.; Zhang, W.; Ren, C.; Liu, J. Mitochondrion-targeted supramolecular “nano-boat” simultaneously inhibiting dual energy metabolism for tumor selective and synergistic chemo-radiotherapy. Theranostics 2022, 12, 1286–1302. [Google Scholar] [CrossRef]
- Arfin, S.; Jha, N.K.; Jha, S.K.; Kesari, K.K.; Ruokolainen, J.; Roychoudhury, S.; Rathi, B.; Kumar, D. Oxidative stress in cancer cell metabolism. Antioxidants 2021, 10, 642. [Google Scholar] [CrossRef]
- Safdar, S.; Ali, S.; Fayyaz, H.; Munir, H.; Atif, F.; Majeed, S.; Jabeen, S. Ameliorating effect of zinc on protein supplement induced DNA and sperm damage in male sprague dawley rats. Pak. J. Physiol. 2021, 17, 22–26. [Google Scholar]
- Fernando, I.P.S.; Sanjeewa, K.K.A.; Lee, H.G.; Kim, H.S.; Vaas, A.; De Silva, H.I.C.; Nanayakkara, C.M.; Abeytunga, D.T.U.; Lee, D.S.; Lee, J.S.; et al. Fucoidan purified from Sargassum polycystum induces apoptosis through mitochondria-mediated pathway in HL-60 and MCF-7 Cells. Mar. Drugs 2020, 18, 196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.Y.; Park, S.H.; Jeong, J.W.; Yoon, D.; Han, M.H.; Lee, D.S.; Choi, G.; Yim, M.J.; Lee, J.M.; Kim, D.H.; et al. Induction of p53-independent apoptosis and G1 cell cycle arrest by fucoidan in HCT116 human colorectal carcinoma cells. Mar. Drugs 2017, 15, 154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, Y.; Li, J.; Jing, X.; Ding, X.; Yu, Y.; Zhao, Q. Fucoidan induces apoptosis and inhibits proliferation of hepatocellular carcinoma via the p38 MAPK/ERK and PI3K/Akt signal pathways. Cancer Manag. Res. 2020, 12, 1713–1723. [Google Scholar] [CrossRef] [Green Version]
- Myers, J.N.; Holsinger, F.C.; Jasser, S.A.; Bekele, B.N.; Fidler, I.J. An orthotopic nude mouse model of oral tongue squamous cell carcinoma. Clin. Cancer Res. 2002, 8, 293–298. [Google Scholar]
- Masood, R.; Hochstim, C.; Cervenka, B.; Zu, S.; Baniwal, S.K.; Patel, V.; Kobielak, A.; Sinha, U.K. A novel orthotopic mouse model of head and neck cancer and lymph node metastasis. Oncogenesis 2013, 2, e68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luthuli, S.; Wu, S.; Cheng, Y.; Zheng, X.; Wu, M.; Tong, H. Therapeutic effects of fucoidan: A review on recent studies. Mar. Drugs 2019, 17, 487. [Google Scholar] [CrossRef] [Green Version]
- Qiu, W.L.; Tseng, A.J.; Hsu, H.Y.; Hsu, W.H.; Lin, Z.H.; Hua, W.J.; Lin, T.Y. Fucoidan increased the sensitivity to gefitinib in lung cancer cells correlates with reduction of TGFbeta-mediated Slug expression. Int. J. Biol. Macromol. 2020, 153, 796–805. [Google Scholar] [CrossRef]
- NCT04597476, C.g.I. A Randomized, Double-Blind Study to Evaluate the Clinical Effect and Safety of Fucoidan in Patients with Squamous Cell Carcinomas of the Head and Neck. Available online: https://clinicaltrials.gov/ct2/show/NCT04597476 (accessed on 22 April 2022).
Genes | Forward Primers (5’ → 3’) | Reverse Primers (5’ → 3’) | Accession Number |
---|---|---|---|
NRF2 | GATCTGCCAACTACTCCCAGGTT | CTGTAACTCAGGAATGGATAATAGCTCC | NM_006164.5 |
TXN | GAAGCAGATCGAGAGCAAGACTG | GCTCCAGAAAATTCACCCACCT | NM_003329.4 |
HMOX1 | CCTTCTTCACCTTCCCCAACAT | GGCAGAATCTTGCACTTTGTTGC | NM_002133.3 |
GAPDH | CCTCAACTACATGGTTTACATGTTCC | CAAATGAGCCCCAGCCTTCT | NM_002046.7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shiau, J.-P.; Chuang, Y.-T.; Yang, K.-H.; Chang, F.-R.; Sheu, J.-H.; Hou, M.-F.; Jeng, J.-H.; Tang, J.-Y.; Chang, H.-W. Brown Algae-Derived Fucoidan Exerts Oxidative Stress-Dependent Antiproliferation on Oral Cancer Cells. Antioxidants 2022, 11, 841. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11050841
Shiau J-P, Chuang Y-T, Yang K-H, Chang F-R, Sheu J-H, Hou M-F, Jeng J-H, Tang J-Y, Chang H-W. Brown Algae-Derived Fucoidan Exerts Oxidative Stress-Dependent Antiproliferation on Oral Cancer Cells. Antioxidants. 2022; 11(5):841. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11050841
Chicago/Turabian StyleShiau, Jun-Ping, Ya-Ting Chuang, Kun-Han Yang, Fang-Rong Chang, Jyh-Horng Sheu, Ming-Feng Hou, Jiiang-Huei Jeng, Jen-Yang Tang, and Hsueh-Wei Chang. 2022. "Brown Algae-Derived Fucoidan Exerts Oxidative Stress-Dependent Antiproliferation on Oral Cancer Cells" Antioxidants 11, no. 5: 841. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11050841