Restoration of Osteogenesis by CRISPR/Cas9 Genome Editing of the Mutated COL1A1 Gene in Osteogenesis Imperfecta
Abstract
:1. Introduction
2. Experimental Section
2.1. Ethical Approval
2.2. PBMC Isolation from OI Patients
2.3. Generation and Maintenance of OI-iPSCs
2.4. Construction of RGEN, ssODN and Surrogate Reporter Gene
2.5. T7 Endonuclease 1 (T7E1) Mismatch Detection Assay
2.6. Osteogenic Differentiation of OI-iPSCs
2.7. Alizarin Red S Staining
2.8. Von Kossa Staining
2.9. OsteoImage Mineralization Assay
2.10. Real-Time Polymerase Chain Reaction (PCR)
2.11. Immunofluorescence Staining
2.12. Western Blot Analysis for Type I Collagen
2.13. Sample Preparation for TEM
2.14. Teratoma Formation
2.15. Label-Free Quantification
2.16. Statistical Analysis
3. Results
3.1. Generation of Osteogenesis Imperfecta Patient Derived iPSCs
3.2. OI Patient-Derived iPSCs Exhibit Delayed OB Differentiation
3.3. Correction of COL1A1 Mutation by CRISPR/Cas9
3.4. Recovery of Collagen Fibril Structure of Bone Formation in Gene-Edited OI-iPSCs
3.5. Label-Free Quantitative Proteomic Analysis of OI-OBs and Gene-Edited OI-OBs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gajko-Galicka, A. Mutations in type I collagen genes resulting in osteogenesis imperfecta in humans. Acta Biochim. Pol. 2002, 49, 433–441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flier, J.S.; Underhill, L.H.; Prockop, D.J. Mutations in Collagen Genes as a Cause of Connective-Tissue Diseases. N. Engl. J. Med. 1992, 326, 540–546. [Google Scholar] [CrossRef] [PubMed]
- Byers, P.H.; Bonadio, J.F.; Cohn, D.H.; Starman, B.J.; Wenstrup, R.J.; Willing, M.C. Osteogenesis imperfecta: The molecular basis of clinical heterogeneity. Ann. N. Y. Acad. Sci. 1988, 543, 117–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malfait, F.; Wenstrup, R.J.; De Paepe, A. Clinical and genetic aspects of Ehlers-Danlos syndrome, classic type. Genet. Med. 2010, 12, 597–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andriotis, O.G.; Chang, S.W.; Vanleene, M.; Howarth, P.H.; Davies, D.E.; Shefelbine, S.J.; Buehler, M.J.; Thurner, P.J.; Andriotis, O.G.; Chang, S.W.; et al. Structure–mechanics relationships of collagen fibrils in the osteogenesis imperfecta mouse model. J. R. Soc. Interface 2015, 12, 20150701. [Google Scholar] [CrossRef]
- Körkkö, J.; Ala-Kokko, L.; De Paepe, A.; Nuytinck, L.; Earley, J.; Prockop, D.J. Analysis of the COL1A1 and COL1A2 genes by PCR amplification and scanning by conformation-sensitive Gel electrophoresis identifies only COL1A1 mutations in 15 patients with osteogenesis imperfecta type I: Identification of common sequences of null-allele mutations. Am. J. Hum. Genet. 1998, 62, 98–110. [Google Scholar] [CrossRef] [Green Version]
- Marini, J.C.; Forlino, A.; Cabral, W.A.; Barnes, A.M.; Antonio, J.D.S.; Milgrom, S.; Hyland, J.C.; Körkkö, J.; Prockop, D.J.; De Paepe, A.; et al. Consortium for osteogenesis imperfecta mutations in the helical domain of type I collagen: Regions rich in lethal mutations align with collagen binding sites for integrins and proteoglycans. Hum. Mutat. 2007, 28, 209–221. [Google Scholar] [CrossRef]
- Rauch, F.; Glorieux, F.H. Osteogenesis imperfecta. Lancet 2004, 363, 1377–1385. [Google Scholar] [CrossRef]
- Cole, W.G.; Campbell, P.E.; Rogers, J.G.; Bateman, J.F. The clinical features of osteogenesis imperfecta resulting from a non-functional carboxy terminal pro alpha 1(I) propeptide of type I procollagen and a severe deficiency of normal type I collagen in tissues. J. Med. Genet. 1990, 27, 545–551. [Google Scholar] [CrossRef] [Green Version]
- Glorieux, F.H. Experience with bisphosphonates in osteogenesis imperfecta. Pediatrics 2007, 119, 163–165. [Google Scholar] [CrossRef] [Green Version]
- Mathews, S.; Gupta, P.K.; Bhonde, R.; Totey, S. Chitosan enhances mineralization during osteoblast differentiation of human bone marrow-derived mesenchymal stem cells, by upregulating the associated genes. Cell Prolif. 2011, 44, 537–549. [Google Scholar] [CrossRef]
- Gershlak, J.R.; Hernandez, S.; Fontana, G.; Perreault, L.R.; Hansen, K.J.; Larson, S.A.; Binder, B.Y.; Dolivo, D.; Yang, T.; Dominko, T.; et al. Crossing kingdoms: Using decellularized plants as perfusable tissue engineering scaffolds. Biomaterials 2017, 125, 13–22. [Google Scholar] [CrossRef]
- Valadares, E.R.; Carneiro, T.B.; Santos, P.M.; Oliveira, A.C.; Zabel, B. What is new in genetics and osteogenesis imperfecta classification? J. Pediatr. 2014, 90, 536–541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forlino, A.; Cabral, W.A.; Barnes, A.M.; Marini, J.C. New perspectives on osteogenesis imperfecta. Nat. Rev. Endocrinol. 2011, 7, 540–557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darnell, M.; Young, S.; Gu, L.; Shah, N.; Lippens, E.; Weaver, J.; Duda, G.; Mooney, D. Substrate stress-relaxation regulates scaffold remodeling and bone formation in vivo. Adv. Healthc. Mater. 2017, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allen, G.C.; Flores-Vergara, M.A.; Krasynanski, S.; Kumar, S.; Thompson, W. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat. Protoc. 2006, 1, 2320–2325. [Google Scholar] [CrossRef] [PubMed]
- Taylor, D.A.; Sampaio, L.C. Stem cells and liver regeneration. In Transplantation of the Liver, 3rd ed.; Busuttil, R.W., Klintmalm, G.B.G., Eds.; W.B. Saunders: Philadelphia, PA, USA, 2014; pp. 1429–1437. [Google Scholar]
- Modulevsky, D.J.; Cuerrier, C.M.; Pelling, A.E. Biocompatibility of subcutaneously implanted plant-derived cellulose biomaterials. PLoS ONE 2016, 11, e0157894. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Green Version]
- Tong, Z.; Solanki, A.; Hamilos, A.; Levy, O.; Wen, K.; Yin, X.; Karp, J.M. Application of biomaterials to advance induced pluripotent stem cell research and therapy. EMBO J. 2015, 34, 987–1008. [Google Scholar] [CrossRef] [Green Version]
- Okano, H.; Nakamura, M.; Yoshida, K.; Okada, Y.; Tsuji, O.; Nori, S.; Ikeda, E.; Yamanaka, S.; Miura, K. Steps toward safe cell therapy using induced pluripotent stem cells. Circ. Res. 2013, 112, 523–533. [Google Scholar] [CrossRef] [Green Version]
- Hsu, P.; Lander, E.S.; Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van, G.V.; Hyon, L.; Hwan, S.K.; Eva, B.; An, S.S.A. Genome-editing applications of CRISPR–Cas9 to promote in vitro studies of Alzheimer’s disease. Clin. Interv. Aging 2018, 13, 221–233. [Google Scholar]
- Webber, B.R.; Osborn, M.J.; McElroy, A.N.; Twaroski, K.; Lonetree, C.-L.; DeFeo, A.P.; Xia, L.; Eide, C.; Lees, C.J.; McElmurry, R.T.; et al. CRISPR/Cas9-based genetic correction for recessive dystrophic epidermolysis bullosa. NPJ Regen. Med. 2016, 1, 16014. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.; Rim, Y.A.; Yi, H.; Park, N.; Park, S.-H.; Ju, J.H. The generation of human induced pluripotent stem cells from blood cells: An efficient protocol using serial plating of reprogrammed cells by centrifugation. Stem Cells Int. 2016, 2016, 1–9. [Google Scholar] [CrossRef]
- Zhang, H.; Zhou, Y.; Wang, Y.; Zhao, Y.; Qiu, Y.; Zhang, X.; Yue, D.; Zhou, Z.; Wei, W. A surrogate reporter system for multiplexable evaluation of CRISPR/Cas9 in targeted mutagenesis. Sci. Rep. 2018, 8, 1042. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Kim, Y.; Yi, H.; Diecke, S.; Kim, J.; Jung, H.; Rim, Y.; Jung, S.; Kim, M.; Kim, Y. Generation of disease-specific induced pluripotent stem cells from patients withrheumatoid arthritis and osteoarthritis. Arthritis Res. Ther. 2014, 16, 41. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Jung, H.; Park, N.; Park, S.-H.; Ju, J.H. Induced osteogenesis in plants decellularized scaffolds. Sci. Rep. 2019, 9, 1–10. [Google Scholar] [CrossRef]
- Kim, S.; Kim, D.; Cho, S.W.; Kim, J.; Kim, J.-S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 2014, 24, 1012–1019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bae, S.; Park, J.; Kim, J.S. Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 2014, 30, 1473–1475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xing, H.; Komasa, S.; Taguchi, Y.; Sekino, T.; Okazaki, J. Osteogenic activity of titanium surfaces with nanonetwork structures. Int. J. Nanomed. 2014, 9, 1741–1755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brenner, R.E.; Vetter, U.; Nerlich, A.; Wörsdorfer, O.; Teller, W.M.; Müller, P.K. Osteogenesis imperfecta: Insufficient collagen synthesis in early childhood as evidenced by analysis of compact bone and fibroblast cultures. Eur. J. Clin. Investig. 1989, 19, 159–166. [Google Scholar] [CrossRef]
- Orgel, J.P.R.O.; Irving, T.C.; Miller, A.; Wess, T.J. Microfibrillar structure of type I collagen in situ. Proc. Natl. Acad. Sci. USA 2006, 103, 9001–9005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rowe, D.W.; Shapiro, J.R.; Poirier, M.; Schlesinger, S.; Rowe, D.W.; Shapiro, J.R.; Poirier, M.; Schlesinger, S. Diminished type I collagen synthesis and reduced alpha 1(I) collagen messenger RNA in cultured fibroblasts from patients with dominantly inherited (type I) osteogenesis imperfecta. J. Clin. Investig. 1985, 76, 604–611. [Google Scholar] [CrossRef]
- Barsh, G.S.; Byers, P.H. Reduced secretion of structurally abnormal type I procollagen in a form of osteogenesis imperfecta. Proc. Natl. Acad. Sci. USA 1981, 78, 5142–5146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; López, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
- Fiser, A.; Šali, A. Modeller: Generation and refinement of homology-based protein structure models. Methods Enzymol. 2003, 374, 461–491. [Google Scholar] [CrossRef]
- Prockop, D. Mutations in collagen genes as a cause of rare and perhaps common diseases of connective tissue. Acta Paediatr. 1991, 80, 55–57. [Google Scholar] [CrossRef] [PubMed]
- Case, D.A.; Cheatham, T.E.; Darden, T.; Gohlke, H.; Luo, R.; Merz, K.M.; Onufriev, A.; Simmerling, C.; Wang, B.; Woods, R.J. The Amber biomolecular simulation programs. J. Comput. Chem. 2005, 26, 1668–1688. [Google Scholar] [CrossRef] [Green Version]
- Niyibizi, C.; Bonadio, J.; Byers, P.H.; Eyre, D.R. Incorporation of type I collagen molecules that contain a mutant alpha 2(I) chain (Gly580-->Asp) into bone matrix in a lethal case of osteogenesis imperfecta. J. Biol. Chem. 1992, 267, 23108–23112. [Google Scholar] [CrossRef]
- Lindorff-Larsen, K.; Piana, S.; Palmo, K.; Maragakis, P.; Klepeis, J.L.; Dror, R.O.; Shaw, D.E. Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins Struct. Funct. Bioinform. 2010, 78, 1950–1958. [Google Scholar] [CrossRef] [Green Version]
- Mörike, M.; Brenner, R.E.; Bushart, G.B.; Teller, W.M.; Vetter, U. Collagen metabolism in cultured osteoblasts from osteogenesis imperfecta patients. Biochem. J. 1992, 286, 73–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trancozo, M.; Moraes, M.V.; Silva, D.A.; Soares, J.A.; Barbirato, C.; Almeida, M.G.; Santos, L.R.; Rebouças, M.R.G.O.; Jr, A.N.A.; Sipolatti, V.; et al. Osteogenesis imperfecta in Brazilian patients. Genet. Mol. Biol. 2019, 42, 344–350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kawai, S.; Yoshitomi, H.; Sunaga, J.; Alev, C.; Nagata, S.; Nishio, M.; Hada, M.; Koyama, Y.; Uemura, M.; Sekiguchi, K.; et al. In vitro bone-like nodules generated from patient-derived iPSCs recapitulate pathological bone phenotypes. Nat. Biomed. Eng. 2019, 3, 558–570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mark, P.; Nilsson, L. Structure and dynamics of the TIP3P, SPC, and SPC/E water models at 298 K. J. Phys. Chem. A 2001, 105, 9954–9960. [Google Scholar] [CrossRef]
- Wang, Y.; Deng, J.; Fan, R.; Tong, A.; Zhang, X.; Zhou, L.; Zheng, Y.; Xu, J.; Guo, G. Novel nanoscale topography on poly(propylene carbonate)/poly(ε-caprolactone) electrospun nanofibers modifies osteogenic capacity of ADCs. RSC Adv. 2015, 5, 82834–82844. [Google Scholar] [CrossRef]
- Moshaverinia, A.; Chen, C.; Xu, X.; Akiyama, K.; Ansari, S.; Zadeh, H.; Shi, S. Bone regeneration potential of stem cells derived from periodontal ligament or gingival tissue sources encapsulated in RGD-modified alginate scaffold. Tissue Eng. Part A 2013, 20, 611–621. [Google Scholar] [CrossRef] [Green Version]
- Spicer, P.P.; Kretlow, J.D.; Young, S.; Jansen, J.A.; Kasper, F.; Mikos, A.G. Evaluation of bone regeneration using the rat critical size calvarial defect. Nat. Protoc. 2012, 7, 1918–1929. [Google Scholar] [CrossRef] [Green Version]
RGEN | Target Sequence | GC Contents (%) | Out-of-Frame Score | 0 bp Mismatch | 1 bp Mismatch | 2 bp Mismatch |
---|---|---|---|---|---|---|
hCOL1A1_RG1 | AAAGGCGAACCTGGTGATGCTGG | 21 | 55 | 1 | 0 | 0 |
hCOL1A1_RG2 | GCTGGTGCTAAAGGCGATGCTGG | 30.3 | 60 | 1 | 0 | 0 |
hCOL1A1_RG3 | GGGGTCCAGCGGGTCCGGCAGGG | 41 | 80 | 1 | 0 | 0 |
hCOL1A1_RG4 | GGGGGTCCAGCGGGTCCGGCAGG | 41.5 | 85 | 1 | 0 | 0 |
Target Name | Direction | Primer Sequence | Target Size (bp) | Gene Reference |
---|---|---|---|---|
humanOCT3/4 | Forward | ACCCCTGGTGCCGTGAA | 190 | NM_001173531.1 |
Reverse | GGCTGAATACCTTCCCAAATA | |||
humanSOX2 | Forward | CAGCGCATGGACAGTTAC | 321 | NM_003106.3 |
Reverse | GGAGTGGGAGGAAGAGGT | |||
humanLIN28 | Forward | GTTCGGCTTCCTGTCCAT | 122 | NM_024674.4 |
Reverse | CTGCCTCACCCTCCTTCA | |||
humanNANOG | Forward | AAAGGCAAACAACCCACT | 270 | NM_024865.2 |
Reverse | GCTATTCTTCGGCCAGTT | |||
humanTDGF1 | Forward | TCCTTCTACGGACGGAACTG | 140 | NM_003212.3 |
Reverse | AGAAATGCCTGAGGAAAGCA | |||
humanDPPA5 | Forward | CGGCTGCTGAAAGCCATTTT | 215 | NM_001025290.2 |
Reverse | AGTTTGAGCATCCCTCGCTC | |||
humanRUNX2 | Forward | AGTGGACCCTTCCAGACCAG | 261 | NM_001015051.3 |
Reverse | ATGGTCGCCAAACAGATTCA | |||
humanCOL1A1 | Forward | CAGGGTGTTCCTGGAGACCT | 291 | NM_000088.3 |
Reverse | AGGAGAGCCATCAGCACCTT | |||
humanOCN | Forward | CCAGGCGCTACCTGTATCAA | 231 | NM_199173.5 |
Reverse | AGGGGAAGAGGAAAGAAGGG | |||
humanGAPDH | Forward | GAATGGGCAGCCGTTAGGAA | 414 | NM_002046 |
Reverse | GACTCCACGACGTACTCAGC |
OI type | Type | Exon | Nucleotide Change | Protein Mutation |
---|---|---|---|---|
I | DNA mutation | 36 | c.2523delT | p.Gly842Alafs * |
Target Name | Target Sequence | Target Size (bp) | Tm |
---|---|---|---|
COL1A1_ex36_F | CCCCCATCATTTTTCATCAC | 477 | 60 |
COL1A1_ex36_R | CAGAGAGGCGGGTGATACTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jung, H.; Rim, Y.A.; Park, N.; Nam, Y.; Ju, J.H. Restoration of Osteogenesis by CRISPR/Cas9 Genome Editing of the Mutated COL1A1 Gene in Osteogenesis Imperfecta. J. Clin. Med. 2021, 10, 3141. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10143141
Jung H, Rim YA, Park N, Nam Y, Ju JH. Restoration of Osteogenesis by CRISPR/Cas9 Genome Editing of the Mutated COL1A1 Gene in Osteogenesis Imperfecta. Journal of Clinical Medicine. 2021; 10(14):3141. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10143141
Chicago/Turabian StyleJung, Hyerin, Yeri Alice Rim, Narae Park, Yoojun Nam, and Ji Hyeon Ju. 2021. "Restoration of Osteogenesis by CRISPR/Cas9 Genome Editing of the Mutated COL1A1 Gene in Osteogenesis Imperfecta" Journal of Clinical Medicine 10, no. 14: 3141. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10143141