Alterations in the Gut Microbiome and Suppression of Histone Deacetylases by Resveratrol Are Associated with Attenuation of Colonic Inflammation and Protection Against Colorectal Cancer
Abstract
:1. Introduction
2. Experimental Section
3. Results
3.1. Resveratrol Attenuates AOM-Induced CRC by Preventing Early Onset of Inflammation and Decreasing Tumor Burden
3.2. Resveratrol Treatment Reduces Inflammatory T Cell Subsets While Increasing Anti-Inflammatory T Cells in AOM-Induced CRC
3.3. Alterations in Gut Microbiota and SCFA Composition in AOM-DSS Colorectal Induced Mice Treated With Resveratrol
3.4. Fecal Transfer from Resveratrol-Treated Groups Attenuates AOM/DSS-Induced CRC and Alters the T Cell-Specific Immune Response
3.5. Butyrate Supplementation Attenuates AOM/DSS-Induced CRC and Promotes an Anti-Inflammatory T Cell Response Similar to Resveratrol
3.6. Supplementation of Butyrate Alters the Microbial Profile in AOM-Induced CRC With Similarities to Resveratrol Treatment
3.7. Resveratrol and BUT Inhibit HDACs In Vivo and In Vitro
3.8. Increased Expression of Anti-Inflammatory T Cell Markers Results in Increased Survival in Human CRC Patients
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fitzmaurice, C.; Dicker, D.; Pain, A.; Hamavid, H.; Moradi-Lakeh, M.; MacIntyre, M.F.; Allen, C.; Hansen, G.; Woodbrook, R.; Wolfe, C.; et al. The Global Burden of Cancer 2013. JAMA Oncol. 2015, 1, 505–527. [Google Scholar] [CrossRef] [PubMed]
- Edwards, B.K.; Noone, A.-M.; Mariotto, A.B.; Simard, E.P.; Boscoe, F.P.; Henley, S.J.; Jemal, A.; Cho, H.; Anderson, R.N.; Kohler, B.A.; et al. Annual Report to the Nation on the status of cancer, 1975–2010, featuring prevalence of comorbidity and impact on survival among persons with lung, colorectal, breast, or prostate cancer. Cancer 2013, 120, 1290–1314. [Google Scholar] [CrossRef] [PubMed]
- Pittman, M.E. Fecal Microbiota and Screening for Colorectal Cancer. Clin. Chem. 2018, 64, 1273–1274. [Google Scholar] [CrossRef]
- Bose, D.; Zimmerman, L.J.; Pierobon, M.; Petricoin, E.; Tozzi, F.; Parikh, A.; Fan, F.; Dallas, N.; Xia, L.; Gaur, P.; et al. Chemoresistant colorectal cancer cells and cancer stem cells mediate growth and survival of bystander cells. Br. J. Cancer 2011, 105, 1759–1767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lopez, A.; Pouillon, L.; Beaugerie, L.; Danese, S.; Peyrin-Biroulet, L. Colorectal cancer prevention in patients with ulcerative colitis. Best Pr. Res. Clin. Gastroenterol. 2018, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Song, M.; Sasazuki, S.; Camargo, M.C.; Shimazu, T.; Charvat, H.; Yamaji, T.; Sawada, N.; Kemp, T.J.; Pfeiffer, R.M.; Hildesheim, A.; et al. Circulating inflammatory markers and colorectal cancer risk: A prospective case-cohort study in Japan. Int. J. Cancer 2018, 143, 2767–2776. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Tabung, F.K.; Zhang, L.; Nowak, J.A.; Qian, Z.R.; Hamada, T.; Nevo, D.; Bullman, S.; Mima, K.; Kosumi, K.; et al. Diets That Promote Colon Inflammation Associate with Risk of Colorectal Carcinomas That Contain Fusobacterium nucleatum. Clin. Gastroenterol. Hepatol. 2018, 16, 1622–1631.e3. [Google Scholar] [CrossRef] [Green Version]
- Tabung, F.K.; Liu, L.; Wang, W.; Fung, T.T.; Wu, K.; Smith-Warner, S.A.; Cao, Y.; Hu, F.B.; Ogino, S.; Fuchs, C.S.; et al. Association of Dietary Inflammatory Potential with Colorectal Cancer Risk in Men and Women. JAMA Oncol. 2018, 4, 366–373. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Pitmon, E.; Wang, K. Microbiome, inflammation and colorectal cancer. Semin. Immunol. 2017, 32, 43–53. [Google Scholar] [CrossRef]
- Song, M.; Garrett, W.S.; Chan, A.T. Nutrients, foods, and colorectal cancer prevention. Gastroenterology 2015, 148, 1244–1260.e16. [Google Scholar] [CrossRef] [Green Version]
- Busbee, P.B.; Rouse, M.; Nagarkatti, M.; Nagarkatti, P.S. Use of natural AhR ligands as potential therapeutic modalities against inflammatory disorders. Nutr. Rev. 2013, 71, 353–369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elshaer, M.; Chen, Y.; Wang, X.J.; Tang, X. Resveratrol: An overview of its anti-cancer mechanisms. Life Sci. 2018, 207, 340–349. [Google Scholar] [CrossRef] [PubMed]
- Hofseth, L.J.; Singh, U.P.; Singh, N.P.; Nagarkatti, M.; Nagarkatti, P.S. Taming the beast within: Resveratrol suppresses colitis and prevents colon cancer. Aging 2010, 2, 183–184. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buhrmann, C.; Shayan, P.; Goel, A.; Shakibaei, M. Resveratrol Regulates Colorectal Cancer Cell Invasion by Modulation of Focal Adhesion Molecules. Nutrients 2017, 9, 1073. [Google Scholar] [CrossRef]
- Zeng, Y.-H.; Zhou, L.-Y.; Chen, Q.-Z.; Li, Y.; Shao, Y.; Ren, W.-Y.; Liao, Y.-P.; Wang, H.; Zhu, J.-H.; Huang, M.; et al. Resveratrol inactivates PI3K/Akt signaling through upregulating BMP7 in human colon cancer cells. Oncol. Rep. 2017, 38, 456–464. [Google Scholar] [CrossRef] [Green Version]
- Hipólito-Luengo, Á.S.; Alcaide, A.; Ramos, M.; Cercas, E.; Vallejo, S.; Romero, A.; Talero, E.; Sánchez-Ferrer, C.F.; Motilva, V.; Peiró, C. Dual Effects of Resveratrol on Cell Death and Proliferation of Colon Cancer Cells. Nutr. Cancer 2017, 69, 1019–1027. [Google Scholar] [CrossRef]
- Gong, W.H.; Zhao, N.; Zhang, Z.M.; Zhang, Y.X.; Yan, L.; Li, J.B. The inhibitory effect of resveratrol on COX-2 expression in human colorectal cancer: A promising therapeutic strategy. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 1136–1143. [Google Scholar]
- Yang, S.; Li, W.; Sun, H.; Wu, B.; Ji, F.; Sun, T.; Chang, H.; Shen, P.; Wang, Y.; Zhou, D.-S. Resveratrol elicits anti-colorectal cancer effect by activating miR-34c-KITLG in vitro and in vivo. BMC Cancer 2015, 15, 969. [Google Scholar] [CrossRef] [Green Version]
- Altamemi, I.; Murphy, E.A.; Catroppo, J.F.; Zumbrun, E.; Zhang, J.; McClellan, J.L.; Singh, U.P.; Nagarkatti, P.S.; Nagarkatti, M. Role of microRNAs in resveratrol-mediated mitigation of colitis-associated tumorigenesis in Apc(Min/+) mice. J. Pharmacol. Exp. Ther. 2014, 350, 99–109. [Google Scholar] [CrossRef] [Green Version]
- Cui, X.; Jin, Y.; Hofseth, A.B.; Pena, E.; Habiger, J.; Chumanevich, A.; Poudyal, D.; Nagarkatti, M.; Nagarkatti, P.S.; Singh, U.P.; et al. Resveratrol suppresses colitis and colon cancer associated with colitis. Cancer Prev. Res. 2010, 3, 549–559. [Google Scholar] [CrossRef] [Green Version]
- Chen, G.Y. The Role of the Gut Microbiome in Colorectal Cancer. Clin. Colon Rectal Surg. 2018, 31, 192–198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zou, S.; Fang, L.; Lee, M.-H. Dysbiosis of gut microbiota in promoting the development of colorectal cancer. Gastroenterol. Rep. 2017, 6, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rezasoltani, S.; Asadzadeh-Aghdaei, H.; Nazemalhosseini-Mojarad, E.; Dabiri, H.; Ghanbari, R.; Zali, M.R. Gut microbiota, epigenetic modification and colorectal cancer. Iran. J. Microbiol. 2017, 9, 55–63. [Google Scholar] [PubMed]
- Jobin, C. Human Intestinal Microbiota and Colorectal Cancer: Moving Beyond Associative Studies. Gastroenterology 2017, 153, 1475–1478. [Google Scholar] [CrossRef] [Green Version]
- Hibberd, A.; Lyra, A.; Ouwehand, A.C.; Rolny, P.; Lindegren, H.; Cedgård, L.; Wettergren, Y. Intestinal microbiota is altered in patients with colon cancer and modified by probiotic intervention. BMJ Open Gastroenterol. 2017, 4, e000145. [Google Scholar] [CrossRef] [Green Version]
- Sethi, V.; Kurtom, S.; Tarique, M.; Lavania, S.; Malchiodi, Z.; Hellmund, L.; Zhang, L.; Sharma, U.; Giri, B.; Garg, B.; et al. Gut Microbiota Promotes Tumor Growth in Mice by Modulating Immune Response. Gastroenterology 2018, 155, 33–37.e6. [Google Scholar] [CrossRef]
- Kim, T.; Parajuli, N.; Sung, M.M.; Bairwa, S.C.; Levasseur, J.; Soltys, C.-L.M.; Wishart, D.S.; Madsen, K.; Schertzer, J.D.; Dyck, J.R.B. Fecal transplant from resveratrol-fed donors improves glycaemia and cardiovascular features of the metabolic syndrome in mice. Am. J. Physiol. Metab. 2018, 315, E511–E519. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, Q.; Ma, W.; Tian, F.; Shen, H.; Song, J. A combination of quercetin and resveratrol reduces obesity in high-fat diet-fed rats by modulation of gut microbiota. Food Funct. 2017, 8, 4644–4656. [Google Scholar] [CrossRef]
- Chen, M.-L.; Yi, L.; Zhang, Y.; Zhou, X.; Ran, L.; Yang, J.; Zhu, J.-D.; Zhang, Q.-Y.; Mi, M.-T. Resveratrol Attenuates Trimethylamine-N-Oxide (TMAO)-Induced Atherosclerosis by Regulating TMAO Synthesis and Bile Acid Metabolism via Remodeling of the Gut Microbiota. MBio 2016, 7, e02210-15. [Google Scholar] [CrossRef] [Green Version]
- Qiao, Y.; Sun, J.; Xia, S.; Tang, X.; Shi, Y.; Luo, T. Effects of resveratrol on gut microbiota and fat storage in a mouse model with high-fat-induced obesity. Food Funct. 2014, 5, 1241. [Google Scholar] [CrossRef]
- Wang, P.; Li, D.; Ke, W.; Liang, D.; Hu, X.; Chen, F. Resveratrol-induced gut microbiota reduces obesity in high-fat diet-fed mice. Int. J. Obes. 2019, 44, 213–225. [Google Scholar] [CrossRef] [PubMed]
- Meng, Q.; Sun, S.; Luo, Z.; Shi, B.; Shan, A.; Cheng, B. Maternal dietary resveratrol alleviates weaning-associated diarrhea and intestinal inflammation in pig offspring by changing intestinal gene expression and microbiota. Food Funct. 2019, 10, 5626–5643. [Google Scholar] [CrossRef] [PubMed]
- Schanz, O.; Chijiiwa, R.; Cengiz, S.; Majlesain, Y.; Weighardt, H.; Takeyama, H.; Förster, I. Dietary AhR Ligands Regulate AhRR Expression in Intestinal Immune Cells and Intestinal Microbiota Composition. Int. J. Mol. Sci. 2020, 21, 3189. [Google Scholar] [CrossRef] [PubMed]
- Fukumoto, S.; Toshimitsu, T.; Matsuoka, S.; Maruyama, A.; Oh-Oka, K.; Takamura, T.; Nakamura, Y.; Ishimaru, K.; Fujii-Kuriyama, Y.; Ikegami, S.; et al. Identification of a probiotic bacteria-derived activator of the aryl hydrocarbon receptor that inhibits colitis. Immunol. Cell Boil. 2014, 92, 460–465. [Google Scholar] [CrossRef] [PubMed]
- Pernomian, L.; Duarte-Silva, M.; Cardoso, C.R.D.B. The Aryl Hydrocarbon Receptor (AHR) as a Potential Target for the Control of Intestinal Inflammation: Insights from an Immune and Bacteria Sensor Receptor. Clin. Rev. Allergy Immunol. 2020, 1–9. [Google Scholar] [CrossRef]
- Busbee, P.B.; Menzel, L.; Alrafas, H.R.; Dopkins, N.; Becker, W.; Miranda, K.; Tang, C.; Chatterjee, S.; Singh, U.P.; Nagarkatti, M.; et al. Indole-3-carbinol prevents colitis and associated microbial dysbiosis in an IL-22–dependent manner. JCI Insight 2020, 5, 5. [Google Scholar] [CrossRef] [Green Version]
- Singh, U.P.; Singh, N.P.; Singh, B.; Hofseth, L.J.; Price, R.L.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol (trans-3,5,4’-trihydroxystilbene) induces silent mating type information regulation-1 and down-regulates nuclear transcription factor-kappaB activation to abrogate dextran sulfate sodium-induced colitis. J. Pharmacol. Exp. Ther. 2009, 332, 829–839. [Google Scholar] [CrossRef] [Green Version]
- Singh, N.P.; Hegde, V.; Hofseth, L.J.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol (trans-3,5,4′-Trihydroxystilbene) Ameliorates Experimental Allergic Encephalomyelitis, Primarily via Induction of Apoptosis in T Cells Involving Activation of Aryl Hydrocarbon Receptor and Estrogen Receptor. Mol. Pharmacol. 2007, 72, 1508–1521. [Google Scholar] [CrossRef] [Green Version]
- Salimi, V.; Shahsavari, Z.; Safizadeh, B.; Hosseini, A.; Khademian, N.; Tavakoli-Yaraki, M. Sodium butyrate promotes apoptosis in breast cancer cells through reactive oxygen species (ROS) formation and mitochondrial impairment. Lipids Heal. Dis. 2017, 16, 208. [Google Scholar] [CrossRef] [Green Version]
- Kespohl, M.; Vachharajani, N.; Luu, M.; Harb, H.; Pautz, S.; Wolff, S.; Sillner, N.; Walker, A.; Schmitt-Kopplin, P.; Boettger, T.; et al. The Microbial Metabolite Butyrate Induces Expression of Th1-Associated Factors in CD4+ T Cells. Front. Immunol. 2017, 8, 8. [Google Scholar] [CrossRef]
- Chitrala, K.N.; Guan, H.; Singh, N.P.; Busbee, B.; Gandy, A.; Mehrpouya-Bahrami, P.; Ganewatta, M.S.; Tang, C.; Chatterjee, S.; Nagarkatti, P.S.; et al. CD44 deletion leading to attenuation of experimental autoimmune encephalomyelitis results from alterations in gut microbiome in mice. Eur. J. Immunol. 2017, 47, 1188–1199. [Google Scholar] [CrossRef] [Green Version]
- Weber, M.; Liou, D.; Dommer, J.; MacMenamin, P.; Quiñones, M.; Misner, I.; Oler, A.J.; Wan, J.; Kim, L.; McCarthy, M.C.; et al. Nephele: A cloud platform for simplified, standardized and reproducible microbiome data analysis. Bioinformatics 2017, 34, 1411–1413. [Google Scholar] [CrossRef] [PubMed]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Boil. 2011, 12, R60. [Google Scholar] [CrossRef] [Green Version]
- Zhao, G.; Nyman, M.; Jönsson, J. Åke Rapid determination of short-chain fatty acids in colonic contents and faeces of humans and rats by acidified water-extraction and direct-injection gas chromatography. Biomed. Chromatogr. 2006, 20, 674–682. [Google Scholar] [CrossRef] [PubMed]
- Bacolod, M.D.; Das, S.K.; Sokhi, U.K.; Bradley, S.; Fenstermacher, D.A.; Pellecchia, M.; Emdad, L.; Sarkar, D.; Fisher, P.B. Examination of Epigenetic and other Molecular Factors Associated with mda-9/Syntenin Dysregulation in Cancer Through Integrated Analyses of Public Genomic Datasets. Adv. Breast Cancer Res. 2015, 127, 49–121. [Google Scholar] [CrossRef] [Green Version]
- Kishore, J.; Goel, M.K.; Khanna, P. Understanding survival analysis: Kaplan-Meier estimate. Int. J. Ayurveda Res. 2010, 1, 274–278. [Google Scholar] [CrossRef] [Green Version]
- Agawa, S.; Muto, T.; Morioka, Y. Mucin abnormality of colonic mucosa in ulcerative colitis associated with carcinoma and/or dysplasia. Dis. Colon Rectum 1988, 31, 387–389. [Google Scholar] [CrossRef]
- Sun, H.-L.; Zhou, X.; Xue, Y.-F.; Wang, K.; Shen, Y.-F.; Mao, J.-J.; Guo, H.-F.; Miao, Z.-N. Increased frequency and clinical significance of myeloid-derived suppressor cells in human colorectal carcinoma. World J. Gastroenterol. 2012, 18, 3303–3309. [Google Scholar]
- Langille, M.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Thurber, R.L.V.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef]
- Slattery, M.L.; Mullany, L.E.; Wolff, R.K.; Sakoda, L.C.; Samowitz, W.S.; Herrick, J.S. The p53-signaling pathway and colorectal cancer: Interactions between downstream p53 target genes and miRNAs. Genomics 2019, 111, 762–771. [Google Scholar] [CrossRef]
- Becker, W.; Nagarkatti, M.; Nagarkatti, P.S. Mir-466a Targeting of TGF-β2 Contributes to FoxP3+ Regulatory T Cell Differentiation in a Murine Model of Allogeneic Transplantation. Front. Immunol. 2018, 9, 688. [Google Scholar] [CrossRef] [Green Version]
- Marchix, J.; Goddard, G.; Helmrath, M.A. Host-Gut Microbiota Crosstalk in Intestinal Adaptation. Cell. Mol. Gastroenterol. Hepatol. 2018, 6, 149–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sitkin, S.; Pokrotnieks, J. Clinical Potential of Anti-inflammatory Effects of Faecalibacterium prausnitzii and Butyrate in Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2019, 25, e40–e41. [Google Scholar] [CrossRef] [PubMed]
- Van Der Beek, C.M.; DeJong, C.H.; Troost, F.; Masclee, A.A.; Lenaerts, K. Role of short-chain fatty acids in colonic inflammation, carcinogenesis, and mucosal protection and healing. Nutr. Rev. 2017, 75, 286–305. [Google Scholar] [CrossRef]
- Řezanka, T.; Reichelová, J.; Kopecky, J. Isobutyrate as a precursor of n-butyrate in the biosynthesis of tylosine and fatty acids. FEMS Microbiol. Lett. 1991, 84, 33–36. [Google Scholar] [CrossRef]
- Arpaia, N.; Campbell, C.; Fan, X.; Dikiy, S.; Van Der Veeken, J.; DeRoos, P.; Liu, H.; Cross, J.; Pfeffer, K.; Coffer, P.J.; et al. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature 2013, 504, 451–455. [Google Scholar] [CrossRef]
- Vieira, R.D.S.; Castoldi, A.; Basso, P.J.; Hiyane, M.I.; Câmara, N.O.S.; Almeida, R.R. Butyrate Attenuates Lung Inflammation by Negatively Modulating Th9 Cells. Front. Immunol. 2019, 10, 67. [Google Scholar] [CrossRef]
- Han, A.; Bennett, N.; Ahmed, B.; Whelan, J.; Donohoe, D.R. Butyrate decreases its own oxidation in colorectal cancer cells through inhibition of histone deacetylases. Oncotarget 2018, 9, 27280–27292. [Google Scholar] [CrossRef]
- Martin-Gallausiaux, C.; Béguet-Crespel, F.; Marinelli, L.; Jamet, A.; LeDue, F.; Blottière, H.M.; Lapaque, N. Butyrate produced by gut commensal bacteria activates TGF-beta1 expression through the transcription factor SP1 in human intestinal epithelial cells. Sci. Rep. 2018, 8, 9742. [Google Scholar] [CrossRef]
- Da Silva, L.G.; Ferguson, B.S.; Avila, A.S.; Faciola, A.P. Sodium propionate and sodium butyrate effects on histone deacetylase (HDAC) activity, histone acetylation, and inflammatory gene expression in bovine mammary epithelial cells. J. Anim. Sci. 2018, 96, 5244–5252. [Google Scholar] [CrossRef]
- Zhang, M.; Zhou, Q.; Dorfman, R.G.; Huang, X.; Fan, T.; Zhang, H.; Zhang, J.; Yu, C. Butyrate inhibits interleukin-17 and generates Tregs to ameliorate colorectal colitis in rats. BMC Gastroenterol. 2016, 16, 84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koushki, M.; Dashatan, N.A.; Meshkani, R. Effect of Resveratrol Supplementation on Inflammatory Markers: A Systematic Review and Meta-analysis of Randomized Controlled Trials. Clin. Ther. 2018, 40, 1180–1192.e5. [Google Scholar] [CrossRef] [PubMed]
- Samsamikor, M.; Daryani, N.E.; Asl, P.R.; Hekmatdoost, A. Resveratrol Supplementation and Oxidative/Anti-Oxidative Status in Patients with Ulcerative Colitis: A Randomized, Double-Blind, Placebo-controlled Pilot Study. Arch. Med. Res. 2016, 47, 304–309. [Google Scholar] [CrossRef]
- Singh, C.K.; Kumar, A.; Hitchcock, D.B.; Fan, D.; Goodwin, R.; Lavoie, H.A.; Nagarkatti, P.S.; DiPette, N.J.; Singh, U.S. Resveratrol prevents embryonic oxidative stress and apoptosis associated with diabetic embryopathy and improves glucose and lipid profile of diabetic dam. Mol. Nutr. Food Res. 2011, 55, 1186–1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Oliveira, M.L.; Chenet, A.L.; Duarte, A.R.; Scaini, G.; Quevedo, J. Molecular Mechanisms Underlying the Anti-depressant Effects of Resveratrol: A Review. Mol. Neurobiol. 2017, 55, 4543–4559. [Google Scholar] [CrossRef] [PubMed]
- Finnell, J.E.; Lombard, C.M.; Melson, M.N.; Singh, N.P.; Nagarkatti, M.; Nagarkatti, P.S.; Fadel, J.R.; Wood, C.S.; Wood, S. The protective effects of resveratrol on social stress-induced cytokine release and depressive-like behavior. Brain Behav. Immun. 2017, 59, 147–157. [Google Scholar] [CrossRef] [Green Version]
- Riccioni, G.; Gammone, M.A.; Tettamanti, G.; Bergante, S.; Pluchinotta, F.R.; D’Orazio, N. Resveratrol and anti-atherogenic effects. Int. J. Food Sci. Nutr. 2015, 66, 603–610. [Google Scholar] [CrossRef]
- Li, J.; Zhang, C.-X.; Liu, Y.-M.; Chen, K.-L.; Chen, G. A comparative study of anti-aging properties and mechanism: Resveratrol and caloric restriction. Oncotarget 2017, 8, 65717–65729. [Google Scholar] [CrossRef] [Green Version]
- Ko, J.-H.; Sethi, G.; Um, J.-Y.; Shanmugam, M.K.; Arfuso, F.; Kumar, A.P.; Bishayee, A.; Ahn, K.S. The Role of Resveratrol in Cancer Therapy. Int. J. Mol. Sci. 2017, 18, 2589. [Google Scholar] [CrossRef] [Green Version]
- Singh, N.P.; Singh, U.P.; Hegde, V.; Guan, H.; Hofseth, L.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol (trans-3,5,4′-trihydroxystilbene) suppresses EL4 tumor growth by induction of apoptosis involving reciprocal regulation of SIRT1 and NF-κB. Mol. Nutr. Food Res. 2011, 55, 1207–1218. [Google Scholar] [CrossRef] [Green Version]
- Guan, H.; Singh, N.P.; Singh, U.P.; Nagarkatti, P.S.; Nagarkatti, M. Resveratrol Prevents Endothelial Cells Injury in High-Dose Interleukin-2 Therapy against Melanoma. PLoS ONE 2012, 7, e35650. [Google Scholar] [CrossRef] [PubMed]
- Rieder, S.A.; Nagarkatti, P.S.; Nagarkatti, M. Multiple anti-inflammatory pathways triggered by resveratrol lead to amelioration of staphylococcal enterotoxin B-induced lung injury. Br. J. Pharmacol. 2012, 167, 1244–1258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Yang, S.; Zumbrun, E.E.; Guan, H.; Nagarkatti, P.S.; Nagarkatti, M. Resveratrol attenuates lipopolysaccharide-induced acute kidney injury by suppressing inflammation driven by macrophages. Mol. Nutr. Food Res. 2015, 59, 853–864. [Google Scholar] [CrossRef] [PubMed]
- Alghetaa, H.; Mohammed, A.; Sultan, M.; Busbee, P.; Murphy, A.; Chatterjee, S.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol protects mice against SEB-induced acute lung injury and mortality by miR-193a modulation that targets TGF-β signalling. J. Cell. Mol. Med. 2018, 22, 2644–2655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ehrlich, A.K.; Pennington, J.M.; Bisson, W.H.; Kolluri, S.K.; Kerkvliet, N.I. TCDD, FICZ, and Other High Affinity AhR Ligands Dose-Dependently Determine the Fate of CD4+ T Cell Differentiation. Toxicol. Sci. 2017, 161, 310–320. [Google Scholar] [CrossRef] [Green Version]
- Singh, N.P.; Singh, U.P.; Rouse, M.; Zhang, J.; Chatterjee, S.; Nagarkatti, P.S.; Nagarkatti, M. Dietary Indoles Suppress Delayed-Type Hypersensitivity by Inducing a Switch from Proinflammatory Th17 Cells to Anti-Inflammatory Regulatory T Cells through Regulation of MicroRNA. J. Immunol. 2015, 196, 1108–1122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, P.; Fan, W.; Zhang, Z.; Wang, J.; Wang, P.; Li, Y.; Yu, M. The Clinicopathological and Prognostic Implications of FoxP3+ Regulatory T Cells in Patients with Colorectal Cancer: A Meta-Analysis. Front. Physiol. 2017, 8, 950. [Google Scholar] [CrossRef] [Green Version]
- Hu, G.; Li, Z.; Wang, S. Tumor-infiltrating FoxP3+ Tregs predict favorable outcome in colorectal cancer patients: A meta-analysis. Oncotarget 2017, 8, 75361–75371. [Google Scholar] [CrossRef] [Green Version]
- Yan, G.; Liu, T.; Yin, L.; Kang, Z.; Wang, L. Levels of peripheral Th17 cells and serum Th17-related cytokines in patients with colorectal cancer: A meta-analysis. Cell. Mol. Boil. 2018, 64, 94–102. [Google Scholar] [CrossRef]
- Bedoui, S.A.; Barbirou, M.; Stayoussef, M.; Dallel, M.; Mokrani, A.; Makni, L.; Mezlini, A.; Bouhaouala, B.; Yacoubi-Loueslati, B.; Almawi, W.Y. Association of interleukin-17A polymorphisms with the risk of colorectal cancer: A case-control study. Cytokine 2018, 110, 18–23. [Google Scholar] [CrossRef]
- Lee, J.Y.; Seo, E.-H.; Oh, C.-S.; Paik, J.-H.; Hwang, D.-Y.; Lee, S.H.; Kim, S.-H. Impact of Circulating T Helper 1 And 17 Cells in the Blood on Regional Lymph Node Invasion in Colorectal Cancer. J. Cancer 2017, 8, 1249–1254. [Google Scholar] [CrossRef] [Green Version]
- Zhuo, C.; Xu, Y.; Ying, M.; Li, Q.; Huang, L.; Li, D.; Cai, S.; Li, B. FOXP3+ Tregs: Heterogeneous phenotypes and conflicting impacts on survival outcomes in patients with colorectal cancer. Immunol. Res. 2015, 61, 338–347. [Google Scholar] [CrossRef] [PubMed]
- Timperi, E.; Pacella, I.; Schinzari, V.; Focaccetti, C.; Sacco, L.; Farelli, F.; Caronna, R.; Del Bene, G.; Longo, F.; Ciardi, A.; et al. Regulatory T cells with multiple suppressive and potentially pro-tumor activities accumulate in human colorectal cancer. OncoImmunology 2016, 5, e1175800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amicarella, F.; Muraro, M.G.; Hirt, C.; Cremonesi, E.; Padovan, E.; Mele, V.; Governa, V.; Han, J.; Huber, X.; Droeser, A.R.; et al. Dual role of tumour-infiltrating T helper 17 cells in human colorectal cancer. Gut 2015, 66, 692–704. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.-R.; Jin, H.; Kim, W.-T.; Kim, W.-J.; Kim, S.Z.; Leem, S.-H.; Kim, S.M. Tristetraprolin activation by resveratrol inhibits the proliferation and metastasis of colorectal cancer cells. Int. J. Oncol. 2018, 53, 1269–1278. [Google Scholar] [CrossRef] [PubMed]
- Huderson, A.C.; Devi, P.V.R.; Niaz, M.S.; Adunyah, S.E.; Ramesh, A. Alteration of benzo(a)pyrene biotransformation by resveratrol in ApcMin/+ mouse model of colon carcinogenesis. Investig. New Drugs 2018, 37, 238–251. [Google Scholar] [CrossRef]
- Wong, S.H.; Zhao, L.; Zhang, X.; Nakatsu, G.; Han, J.; Xu, W.; Xiao, X.; Kwong, T.N.; Tsoi, H.; Wu, W.K.; et al. Gavage of Fecal Samples from Patients with Colorectal Cancer Promotes Intestinal Carcinogenesis in Germ-Free and Conventional Mice. Gastroenterology 2017, 153, 1621–1633. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.; Xu, C.; Wu, D.; Wang, Z.; Wu, P.; Li, L.; Huang, J.; Qiu, F. γδ T Cells: Crosstalk Between Microbiota, Chronic Inflammation, and Colorectal Cancer. Front. Immunol. 2018, 9, 9. [Google Scholar] [CrossRef]
- De Almeida, C.V.; Taddei, A.; Amedei, A. The controversial role of Enterococcus faecalis in colorectal cancer. Ther. Adv. Gastroenterol. 2018, 11, 1756284818783606. [Google Scholar] [CrossRef] [Green Version]
- Mori, G.; Rampelli, S.; Orena, B.S.; Rengucci, C.; De Maio, G.; Barbieri, G.; Passardi, A.; Casadei-Gardini, A.; Frassineti, G.L.; Gaiarsa, S.; et al. Shifts of Faecal Microbiota During Sporadic Colorectal Carcinogenesis. Sci. Rep. 2018, 8, 10329. [Google Scholar] [CrossRef]
- Etxeberria, U.; Arias, N.; Boqué, N.; Macarulla, M.; Portillo, M.P.; Martinez, J.; Milagro, F.I. Reshaping faecal gut microbiota composition by the intake of trans-resveratrol and quercetin in high-fat sucrose diet-fed rats. J. Nutr. Biochem. 2015, 26, 651–660. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.-L.; Lee, W.-C.; Wu, K.L.H.; Leu, S.; Chan, J.Y. Resveratrol Prevents the Development of Hypertension Programmed by Maternal Plus Post-Weaning High-Fructose Consumption through Modulation of Oxidative Stress, Nutrient-Sensing Signals, and Gut Microbiota. Mol. Nutr. Food Res. 2018, 62. [Google Scholar] [CrossRef]
- Chen, W.; Liu, F.; Ling, Z.; Tong, X.; Xiang, C. Human Intestinal Lumen and Mucosa-Associated Microbiota in Patients with Colorectal Cancer. PLoS ONE 2012, 7, e39743. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D. Human gut microbiome: Hopes, threats and promises. Gut 2018, 67, 1716–1725. [Google Scholar] [CrossRef] [PubMed]
- Alrafas, H.R.; Busbee, P.B.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol modulates the gut microbiota to prevent murine colitis development through induction of Tregs and suppression of Th17 cells. J. Leukoc. Boil. 2019, 106, 467–480. [Google Scholar] [CrossRef] [PubMed]
- De Preter, V.; Machiels, K.; Joossens, M.; Arijs, I.; Matthys, C.; Vermeire, S.; Rutgeerts, P.; Verbeke, K. Faecal metabolite profiling identifies medium-chain fatty acids as discriminating compounds in IBD. Gut 2014, 64, 447–458. [Google Scholar] [CrossRef]
- Matthies, C.; Schink, B. Reciprocal Isomerization of Butyrate and Isobutyrate by the Strictly Anaerobic Bacterium Strain WoG13 and Methanogenic Isobutyrate Degradation by a Defined Triculture. Appl. Environ. Microbiol. 1992, 58, 1435–1439. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Gao, C.; Guo, H.-L.; Zhang, W.-Q.; Huang, W.; Tang, S.-S.; Gan, W.-J.; Xu, Y.; Zhou, H.; Zhu, Q. Sodium butyrate supplementation ameliorates diabetic inflammation in db/db mice. J. Endocrinol. 2018, 238, 231–244. [Google Scholar] [CrossRef] [Green Version]
- Sun, B.; Jia, Y.; Hong, J.; Sun, Q.; Gao, S.; Hu, Y.; Zhao, N.; Zhao, R. Sodium Butyrate Ameliorates High-Fat-Diet-Induced Non-alcoholic Fatty Liver Disease through Peroxisome Proliferator-Activated Receptor α-Mediated Activation of β Oxidation and Suppression of Inflammation. J. Agric. Food Chem. 2018, 66, 7633–7642. [Google Scholar] [CrossRef]
- Seth, R.; Kimono, D.; Alhasson, F.; Sarkar, S.; Albadrani, M.; Lasley, S.K.; Horner, R.; Janulewicz, P.A.; Nagarkatti, M.; Nagarkatti, P.S.; et al. Increased butyrate priming in the gut stalls microbiome associated-gastrointestinal inflammation and hepatic metabolic reprogramming in a mouse model of Gulf War Illness. Toxicol. Appl. Pharmacol. 2018, 350, 64–77. [Google Scholar] [CrossRef]
- Chen, J.; Vitetta, L. Inflammation-Modulating Effect of Butyrate in the Prevention of Colon Cancer by Dietary Fiber. Clin. Color. Cancer 2018, 17, e541–e544. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Zhu, M.-J. Butyrate Inhibits Indices of Colorectal Carcinogenesis via Enhancing α-Ketoglutarate-Dependent DNA Demethylation of Mismatch Repair Genes. Mol. Nutr. Food Res. 2018, 62. [Google Scholar] [CrossRef]
- Tian, Y.; Xu, Q.; Sun, L.; Ye, Y.; Ji, G. Short-chain fatty acids administration is protective in colitis-associated colorectal cancer development. J. Nutr. Biochem. 2018, 57, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Patnala, R.; Arumugam, T.V.; Gupta, N.; Dheen, S.T. HDAC Inhibitor Sodium Butyrate-Mediated Epigenetic Regulation Enhances Neuroprotective Function of Microglia During Ischemic Stroke. Mol. Neurobiol. 2016, 54, 6391–6411. [Google Scholar] [CrossRef]
- Zhang, H.; Du, M.; Yang, Q.; Zhu, M.-J. Butyrate suppresses murine mast cell proliferation and cytokine production through inhibiting histone deacetylase. J. Nutr. Biochem. 2016, 27, 299–306. [Google Scholar] [CrossRef]
Primer | Forward | Reverse |
---|---|---|
Ruminococcus gnavus | AGAGGGATGTCAAGACCAGGTA | TACTAGGTGTCGGGTGGAAAAG |
Akkermansia muciniphila | GTATCTAATCCCTTTCGCTCCC | GACTAGAGTAATGGAGGGGGAA |
Mucispirillum schaedleri | CACATGCAAGTCAGGGAGAAA | CAGGTCTCCCCAACTTTTCCTA |
HDAC 1 | CCGCATGACTCACAATTTGCT | TCTGGGCGAATAGAACGCAGG |
HDAC 2 | TACAACAGATCGCGTGATGAC | TCCCTTTCCAGCACCAATATC |
HDAC 3 | GAAATGTTGCCCGGTGTTGGA | TGAGTTCTGATTCTCGATGCG |
HDAC 4 | AACTTCTTCCCAGGAAGTGGA | TGCGATAGGCATAACCACCGT |
HDAC 5 | TGGACTGGGATATTCACCATG | AGAGCCTGGAAAGAAGTTCCC |
HDAC 6 | ATTGCTGCTTTCCTGCACATC | AATCAACTTGCCTCCTGCCAA |
HDAC 7 | GCTGAAGAATGGCTTTGCTGT | AATGAGGATCTTGCTGGCTTT |
HDAC 8 | AGTGCCTGATTGACGGGAAGT | CGGTCAAATTTCCGTCGCAAT |
HDAC 9 | AGGATGATGATGCCTGTGGTG | GCCTGGTCAAATTCTGGTGCT |
HDAC 10 | AGCAGAAATATGGGCTGAAGA | AGAAGCTTCCATGCTCATAGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alrafas, H.R.; Busbee, P.B.; Chitrala, K.N.; Nagarkatti, M.; Nagarkatti, P. Alterations in the Gut Microbiome and Suppression of Histone Deacetylases by Resveratrol Are Associated with Attenuation of Colonic Inflammation and Protection Against Colorectal Cancer. J. Clin. Med. 2020, 9, 1796. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm9061796
Alrafas HR, Busbee PB, Chitrala KN, Nagarkatti M, Nagarkatti P. Alterations in the Gut Microbiome and Suppression of Histone Deacetylases by Resveratrol Are Associated with Attenuation of Colonic Inflammation and Protection Against Colorectal Cancer. Journal of Clinical Medicine. 2020; 9(6):1796. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm9061796
Chicago/Turabian StyleAlrafas, Haider Rasheed, Philip Brandon Busbee, Kumaraswamy Naidu Chitrala, Mitzi Nagarkatti, and Prakash Nagarkatti. 2020. "Alterations in the Gut Microbiome and Suppression of Histone Deacetylases by Resveratrol Are Associated with Attenuation of Colonic Inflammation and Protection Against Colorectal Cancer" Journal of Clinical Medicine 9, no. 6: 1796. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm9061796