Nanohydroxyapatite-Coated Titanium Surface Increases Vascular Endothelial Cells Distinct Signaling Responding to High Glucose Concentration
Abstract
:1. Introduction
2. Material and Methods
2.1. Titanium Alloys, Reagents and Titanium-Enriched Medium Preparation
2.2. Experimental Design
2.3. Cell Line and Culture Conditions
2.4. Cell Viability Assay
2.5. Experimental DM Condition—High-Glusose In Vitro
2.6. mRNA Isolation and RT-qPCR Analysis
2.7. Gelatin Proteolysis-Based Zymography
2.8. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chrcanovic, B.R.; Albrektsson, T.; Wennerberg, A. Diabetes and Oral Implant Failure. J. Dent. Res. 2014, 93, 859–867. [Google Scholar] [CrossRef]
- Oates, T.W.; Huynh-Ba, G.; Vargas, A.; Alexander, P.; Feine, J. A Critical Review of Diabetes, Glycemic Control, and Dental Implant Therapy. Clin. Oral Implants Res. 2013, 24, 117–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al Ansari, Y.; Shahwan, H.; Chrcanovic, B.R. Diabetes Mellitus and Dental Implants: A Systematic Review and Meta-Analysis. Materials 2022, 15, 3227. [Google Scholar] [CrossRef]
- de Oliveira, P.G.F.P.; Bonfante, E.A.; Bergamo, E.T.P.; de Souza, S.L.S.; Riella, L.; Torroni, A.; Benalcazar Jalkh, E.B.; Witek, L.; Lopez, C.D.; Zambuzzi, W.F.; et al. Obesity/Metabolic Syndrome and Diabetes Mellitus on Peri-Implantitis. Trends Endocrinol. Metab. 2020, 31, 596–610. [Google Scholar] [CrossRef] [PubMed]
- Danaei, G.; Finucane, M.M.; Lu, Y.; Singh, G.M.; Cowan, M.J.; Paciorek, C.J.; Lin, J.K.; Farzadfar, F.; Khang, Y.-H.; Stevens, G.A.; et al. National, Regional, and Global Trends in Fasting Plasma Glucose and Diabetes Prevalence since 1980: Systematic Analysis of Health Examination Surveys and Epidemiological Studies with 370 Country-Years and 2·7 Million Participants. Lancet 2011, 378, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Giner, L.; Mercadé, M.; Torrent, S.; Punset, M.; Pérez, R.A.; Delgado, L.M.; Gil, F.J. Double Acid Etching Treatment of Dental Implants for Enhanced Biological Properties. J. Appl. Biomater. Funct. Mater. 2018, 16, 83–89. [Google Scholar] [CrossRef] [Green Version]
- Khang, W.; Feldman, S.; Hawley, C.E.; Gunsolley, J. A Multi-Center Study Comparing Dual Acid-Etched and Machined-Surfaced Implants in Various Bone Qualities. J. Periodontol. 2001, 72, 1384–1390. [Google Scholar] [CrossRef]
- Barkarmo, S.; Andersson, M.; Currie, F.; Kjellin, P.; Jimbo, R.; Johansson, C.; Stenport, V. Enhanced Bone Healing around Nanohydroxyapatite-Coated Polyetheretherketone Implants: An Experimental Study in Rabbit Bone. J. Biomater. Appl. 2014, 29, 737–747. [Google Scholar] [CrossRef]
- Jimbo, R.; Coelho, P.G.; Bryington, M.; Baldassarri, M.; Tovar, N.; Currie, F.; Hayashi, M.; Janal, M.N.; Andersson, M.; Ono, D.; et al. Nano Hydroxyapatite-Coated Implants Improve Bone Nanomechanical Properties. J. Dent. Res. 2012, 91, 1172–1177. [Google Scholar] [CrossRef] [Green Version]
- Bezerra, F.; Ferreira, M.R.; Fontes, G.N.; da Costa Fernandes, C.J.; Andia, D.C.; Cruz, N.C.; da Silva, R.A.; Zambuzzi, W.F. Nano Hydroxyapatite-Blasted Titanium Surface Affects Pre-Osteoblast Morphology by Modulating Critical Intracellular Pathways. Biotechnol. Bioeng. 2017, 114, 1888–1898. [Google Scholar] [CrossRef]
- Gemini-Piperni, S.; Milani, R.; Bertazzo, S.; Peppelenbosch, M.; Takamori, E.R.; Granjeiro, J.M.; Ferreira, C.V.; Teti, A.; Zambuzzi, W. Kinome Profiling of Osteoblasts on Hydroxyapatite Opens New Avenues on Biomaterial Cell Signaling. Biotechnol. Bioeng. 2014, 111, 1900–1905. [Google Scholar] [CrossRef]
- Bertazzo, S.; Zambuzzi, W.F.; Campos, D.D.P.; Ferreira, C.V.; Bertran, C.A. A Simple Method for Enhancing Cell Adhesion to Hydroxyapatite Surface. Clin. Oral Implants Res. 2010, 21, 1411–1413. [Google Scholar] [CrossRef]
- Sartoretto, S.C.; Calasans-Maia, M.D.; Alves, A.T.N.N.; Resende, R.F.B.; da Costa Fernandes, C.J.; de Magalhães Padilha, P.; Rossi, A.M.; Teti, A.; Granjeiro, J.M.; Zambuzzi, W.F. The Role of Apoptosis Associated Speck-like Protein Containing a Caspase-1 Recruitment Domain (ASC) in Response to Bone Substitutes. Mater. Sci. Eng. C 2020, 112, 110965. [Google Scholar] [CrossRef]
- Bian, Q.; Chen, J.; Weng, Y.; Li, S. Endothelialization Strategy of Implant Materials Surface: The Newest Research in Recent 5 Years. J. Appl. Biomater. Funct. Mater. 2022, 20, 228080002211053. [Google Scholar] [CrossRef]
- Genova, T.; Petrillo, S.; Zicola, E.; Roato, I.; Ferracini, R.; Tolosano, E.; Altruda, F.; Carossa, S.; Mussano, F.; Munaron, L. The Crosstalk between Osteodifferentiating Stem Cells and Endothelial Cells Promotes Angiogenesis and Bone Formation. Front. Physiol. 2019, 10, 1291. [Google Scholar] [CrossRef] [Green Version]
- Martins, B.R.; Pinto, T.S.; da Costa Fernandes, C.J.; Bezerra, F.; Zambuzzi, W.F. PI3K/AKT Signaling Drives Titanium-Induced Angiogenic Stimulus. J. Mater. Sci. Mater. Med. 2021, 32, 18. [Google Scholar] [CrossRef]
- Lilao-Garzón, J.; Valverde-Tercedor, C.; Muñoz-Descalzo, S.; Brito-Casillas, Y.; Wägner, A.M. In Vivo and In Vitro Models of Diabetes: A Focus on Pregnancy. Adv. Exp. Med. Biol. 2020, 1307, 553–576. [Google Scholar]
- Madonna, R.; Geng, Y.J.; Shelat, H.; Ferdinandy, P.; De Caterina, R. High Glucose-Induced Hyperosmolarity Impacts Proliferation, Cytoskeleton Remodeling and Migration of Human Induced Pluripotent Stem Cells via Aquaporin-1. Biochim. Biophys. Acta Mol. Basis Dis. 2014, 1842, 2266–2275. [Google Scholar] [CrossRef] [Green Version]
- Madonna, R.; Giovannelli, G.; Confalone, P.; Renna, F.V.; Geng, Y.-J.; De Caterina, R. High Glucose-Induced Hyperosmolarity Contributes to COX-2 Expression and Angiogenesis: Implications for Diabetic Retinopathy. Cardiovasc. Diabetol. 2016, 15, 18. [Google Scholar] [CrossRef] [Green Version]
- Gottlander, M.; Johansson, C.B.; Wennerberg, A.; Albrektsson, T.; Radin, S.; Ducheyne, P. Bone Tissue Reactions to an Electrophoretically Applied Calcium Phosphate Coating. Biomaterials 1997, 18, 551–557. [Google Scholar] [CrossRef]
- Meirelles, L.; Arvidsson, A.; Andersson, M.; Kjellin, P.; Albrektsson, T.; Wennerberg, A. Nano Hydroxyapatite Structures Influence Early Bone Formation. J. Biomed. Mater. Res. Part A 2008, 87A, 299–307. [Google Scholar] [CrossRef] [PubMed]
- Hartree, E.F. Determination of Protein: A Modification of the Lowry Method That Gives a Linear Photometric Response. Anal. Biochem. 1972, 48, 422–427. [Google Scholar] [CrossRef] [PubMed]
- Lefebvre, V.; Peeters-Joris, C.; Vaes, G. Production of Gelatin-Degrading Matrix Metalloproteinases (‘type IV Collagenases’) and Inhibitors by Articular Chondrocytes during Their Dedifferentiation by Serial Subcultures and under Stimulation by Interleukin-1 and Tumor Necrosis Factor Alpha. Biochim. Biophys. Acta 1991, 1094, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Khader, Y.S.; Dauod, A.S.; El-Qaderi, S.S.; Alkafajei, A.; Batayha, W.Q. Periodontal Status of Diabetics Compared with Nondiabetics: A Meta-Analysis. J. Diabetes Complicat. 2006, 20, 59–68. [Google Scholar] [CrossRef]
- Rothwell, B.R.; Richard, E.L. Diabetes Mellitus: Medical and Dental Considerations. Spec. Care Dent. 1984, 4, 58–65. [Google Scholar] [CrossRef]
- Frantzis, T.G.; Reeve, C.M.; Brown, A.L. The Ultrastructure of Capillary Basement Membranes in the Attached Gingiva of Diabetic and Nondiabetic Patients with Periodontal Disease. J. Periodontol. 1971, 42, 406–411. [Google Scholar] [CrossRef]
- McMahon, M.M.; Bistrian, B.R. Host Defenses and Susceptibility to Infection in Patients with Diabetes Mellitus. Infect. Dis. Clin. N. Am. 1995, 9, 1–9. [Google Scholar] [CrossRef]
- Webb, D.J.; Donais, K.; Whitmore, L.A.; Thomas, S.M.; Turner, C.E.; Parsons, J.T.; Horwitz, A.F. FAK-Src Signalling through Paxillin, ERK and MLCK Regulates Adhesion Disassembly. Nat. Cell Biol. 2004, 6, 154–161. [Google Scholar] [CrossRef]
- Chiarugi, P.; Giannoni, E. Anoikis: A Necessary Death Program for Anchorage-Dependent Cells. Biochem. Pharmacol. 2008, 76, 1352–1364. [Google Scholar] [CrossRef]
- Matsuoka, T.; Yashiro, M.; Nishioka, N.; Hirakawa, K.; Olden, K.; Roberts, J.D. PI3K/Akt Signalling Is Required for the Attachment and Spreading, and Growth In Vivo of Metastatic Scirrhous Gastric Carcinoma. Br. J. Cancer 2012, 106, 1535–1542. [Google Scholar] [CrossRef] [Green Version]
- Zeng, D.; Ou, D.-B.; Wei, T.; Ding, L.; Liu, X.-T.; Hu, X.-L.; Li, X.; Zheng, Q.-S. Collagen/Β1 Integrin Interaction Is Required for Embryoid Body Formation during Cardiogenesis from Murine Induced Pluripotent Stem Cells. BMC Cell Biol. 2013, 14, 5. [Google Scholar] [CrossRef] [Green Version]
- Zambuzzi, W.F.; Granjeiro, J.M.; Parikh, K.; Yuvaraj, S.; Peppelenbosch, M.P.; Ferreira, C.V. Modulation of Src Activity by Low Molecular Weight Protein Tyrosine Phosphatase during Osteoblast Differentiation. Cell. Physiol. Biochem. 2008, 22, 497–506. [Google Scholar] [CrossRef]
- Zambuzzi, W.F.; Bruni-Cardoso, A.; Granjeiro, J.M.; Peppelenbosch, M.P.; De Carvalho, H.F.; Aoyama, H.; Ferreira, C.V. On the Road to Understanding of the Osteoblast Adhesion: Cytoskeleton Organization Is Rearranged by Distinct Signaling Pathways. J. Cell. Biochem. 2009, 108, 134–144. [Google Scholar] [CrossRef]
- Zambuzzi, W.F.; Milani, R.; Teti, A. Expanding the Role of Src and Protein-Tyrosine Phosphatases Balance in Modulating Osteoblast Metabolism: Lessons from Mice. Biochimie 2010, 92, 327–332. [Google Scholar] [CrossRef]
- Fernandes, G.V.O.; Cavagis, A.D.M.; Ferreira, C.V.; Olej, B.; de Souza Leão, M.; Yano, C.L.; Peppelenbosch, M.; Granjeiro, J.M.; Zambuzzi, W.F. Osteoblast Adhesion Dynamics: A Possible Role for ROS and LMW-PTP. J. Cell. Biochem. 2014, 115, 1063–1069. [Google Scholar] [CrossRef]
- Hu, G.; Place, A.T.; Minshall, R.D. Regulation of Endothelial Permeability by Src Kinase Signaling: Vascular Leakage versus Transcellular Transport of Drugs and Macromolecules. Chem. Biol. Interact. 2008, 171, 177–189. [Google Scholar] [CrossRef] [Green Version]
- da Silva, R.A.; da Fernandes, C.J.; Feltran, G.d.S.; Gomes, A.M.; de Camargo Andrade, A.F.; Andia, D.C.; Peppelenbosch, M.P.; Zambuzzi, W.F. Laminar Shear Stress-Provoked Cytoskeletal Changes Are Mediated by Epigenetic Reprogramming of TIMP1 in Human Primary Smooth Muscle Cells. J. Cell. Physiol. 2018, 234, 6382–6396. [Google Scholar] [CrossRef]
- Chen, D.; Walsh, K.; Wang, J. Regulation of Cdk2 Activity in Endothelial Cells That Are Inhibited from Growth by Cell Contact. Arterioscler. Thromb. Vasc. Biol. 2000, 20, 629–635. [Google Scholar] [CrossRef] [Green Version]
- Hunter, T.; Pines, J. Cyclins and Cancer II: Cyclin D and CDK Inhibitors Come of Age. Cell 1994, 79, 573–582. [Google Scholar] [CrossRef]
Gene | Primer | 5′-3′ Sequence | Reaction’s Conditions |
---|---|---|---|
INTEGRIN-β1 | Forward | GCCGCGCGGAAAAGATGAA | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TGCTGTTCCTTTGCTACGGT | ||
SRC | Forward | CAACACAGAGGGAGACTGGT | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | AGCTTCTTCATGACCTGGGC | ||
COFILIN | Forward | TGTGCGGCTCCTACTAAACG | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TCCTTGACCTCCTCGTAGCA | ||
ERK | Forward | ACCAGGCTCTGGCCCACCCAT | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | GCAGCGCCTCCCTTGCTAGA | ||
P38 | Forward | GAGAACTGCGGTTACTTA | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | ATGGGTCACCAGATACACAT | ||
JNK | Forward | AAAGGTGGTGTTTTGTTCCCAGGT | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TGATGATGGATGCTGAGAGCCATT | ||
AKT | Forward | CCAGCCTGGGTCAAAGAAGT | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TCTCCTCCTCCTCCTGCTTC | ||
CDK2 | Forward | CTTTGCTGAGATGGTGACTCG | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | GCCTCCCAGATTCCTCATGC | ||
P15 | Forward | GGGACTAGTGGAGAAGGTGC | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | CATCATCATGACCTGGATCGC | ||
MMP2 | Forward | AGCTCCCGGAAAAGATTGATG | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | CAGGGTGCTGGCTGAGTAGAT | ||
MMP9 | Forward | CACGCACGACGTCTTCCA | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | AAGCGGTCCTGGCAGAAAT | ||
FAK | Forward | TCAGCTCAGCACAATCCTGG | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | CTGAAGCTTGACACCCTCGT | ||
RECK | Forward | TGCAAGCAGGCATCTTCAAA | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | ACCGAGCCCATTTCATTTCTG | ||
PI3K | Forward | ACTCTCAGCAGGCAAAGACC | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | ATTCAGTTCAATTGCAGAAGGAG | ||
ß-ACTIN | Forward | ACAGAGCCTCGCCTTTGC | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | GCGGCGATATCATCATCC | ||
GAPDH | Forward | AGGCCGGTGCTGAGTATGTC | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TGCCTGCTTC ACCACCTTCT | ||
18S | Forward | CGGACAGGATTGACAGATTGATAGC | 95 °C—15 s; 60 °C—30 s; 72 °C—30 s |
Reverse | TGCCAGAGTCTCGTTCGTTATCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gomes, A.M.; da Silva, D.F.; Bezerra, F.J.; Zambuzzi, W.F. Nanohydroxyapatite-Coated Titanium Surface Increases Vascular Endothelial Cells Distinct Signaling Responding to High Glucose Concentration. J. Funct. Biomater. 2023, 14, 188. https://0-doi-org.brum.beds.ac.uk/10.3390/jfb14040188
Gomes AM, da Silva DF, Bezerra FJ, Zambuzzi WF. Nanohydroxyapatite-Coated Titanium Surface Increases Vascular Endothelial Cells Distinct Signaling Responding to High Glucose Concentration. Journal of Functional Biomaterials. 2023; 14(4):188. https://0-doi-org.brum.beds.ac.uk/10.3390/jfb14040188
Chicago/Turabian StyleGomes, Anderson M., Danielle F. da Silva, Fábio J. Bezerra, and Willian F. Zambuzzi. 2023. "Nanohydroxyapatite-Coated Titanium Surface Increases Vascular Endothelial Cells Distinct Signaling Responding to High Glucose Concentration" Journal of Functional Biomaterials 14, no. 4: 188. https://0-doi-org.brum.beds.ac.uk/10.3390/jfb14040188