Next Article in Journal
A Method to Locally Irradiate Specific Organ in Model Organisms Using a Focused Heavy-Ion Microbeam
Next Article in Special Issue
Basement Membranes, Brittlestar Tendons, and Their Mechanical Adaptability
Previous Article in Journal
Benefits of Harmonicity for Hearing in Noise Are Limited to Detection and Pitch-Related Discrimination Tasks
Previous Article in Special Issue
Morphology and Chemical Messenger Regulation of Echinoderm Muscles
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 12
Issue 12
10.3390/biology12121523
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Investigation on the Effects of Dietary Vitamin E on Juvenile Sea Urchin (Strongylocentrotus intermedius): Growth, Intestinal Microbiota, Immune Response, and Related Gene Expression

by
Min Li
1,2,†,
Dan Gou
1,†,
Panke Gong
1,
Weixiao Di
1,
Lina Wang
1,
Jun Ding
1,
Yaqing Chang
1 and
Rantao Zuo
1,*
1
Key Laboratory of Mariculture and Stock Enhancement in North China’s Sea (Ministry of Agriculture and Rural Affairs), Dalian Ocean University, Dalian 116023, China
2
Department of Marine Biology, Weihai Ocean Vocational College, Weihai 264300, China
*
Author to whom correspondence should be addressed.
†
These authors contribute equally to this work.
Biology 2023, 12(12), 1523; https://0-doi-org.brum.beds.ac.uk/10.3390/biology12121523
Submission received: 4 October 2023 / Revised: 7 December 2023 / Accepted: 12 December 2023 / Published: 14 December 2023
(This article belongs to the Special Issue Current Advances in Echinoderm Research)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Sea urchin is rare but valuable and considered luxurious sea food due to the gonads with bright color, delicate taste, and abundant nutrition. Since macroalgae have several defects, such as unstable supply, low feed conversion efficiency, and incomplete nutrition, it is essential to formulate feeds suitable for producing sea urchin seeds with higher efficiency. Vitamin E (VE) is an essential nutrient and a lipid-soluble antioxidant for animals. However, no relevant information is available about the requirement of VE and its physiological role in sea urchins. Therefore, this experiment was performed to assess the impacts of dietary VE on growth, intestinal microbiota, immune response, and related gene expression in juvenile S. intermedius. It was found that a moderate level of VE (172.5–262.4) can achieve ideal digestive enzyme activities and growth performance, but a relatively higher level of VE (235–302 mg/kg) was beneficial for maintaining the immune and antioxidant capacity of juvenile S. intermedius by regulating the expression of inflammation- and immune-related genes and abundance of some bacteria to a healthy state.

Abstract

A 90 d feeding experiment was conducted to investigate the effects of vitamin E (VE) on growth, intestinal microbiota, immune response, and related gene expression of juvenile sea urchin (Strongylocentrotus intermedius). Six dry feeds were made to contain graded levels of VE (78, 105, 152, 235, 302, and 390 mg/kg); these were named E78, E105, E152, E235, E302, and E390, respectively. Dry feed E50 and fresh kelp (HD) were used as the control diets. There were six replicates of cages in each dietary group, and each cage held 20 sea urchins with an initial body weight of approximately 1.50 g. Results exhibited that weight gain rate and gonadosomatic index (GSI) of the sea urchins were not significantly affected by dietary VE ranging from 78 to 390 mg/kg. Sea urchins in the dry feed groups showed poorer growth performance, but significantly higher GSI than those in the fresh kelp groups. The pepsin and lipase activities were not significantly promoted by low or moderate VE, but were inhibited by a high level of VE (302–390 mg/kg), while amylase and cellulase activities were significantly increased by low or moderate VE, with the highest values observed in the E105 and E235 groups, respectively. VE addition at a low dosage (105–152 mg/kg) showed inhibitory effects on immune and antioxidant enzyme activities and expression of inflammation-related genes, but showed no beneficial effects at moderate or high dosage (235–390 mg/kg), while a moderate or relatively higher level of VE (235–302 mg/kg) significantly increased the expression of several immune-related genes. The relative abundance of Proteobacteria, Actinobacteria, Ruegeria, and Maliponia in the intestine of the sea urchins increased with the increase in VE in the dry feeds. On the contrary, the relative abundance of the Firmicutes, Bacteroidetes, Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 gradually decreased as VE content increased. These results indicated that a moderate level of VE (172.5–262.4) can achieve ideal digestive enzyme activities and growth performance, but a relatively higher level of VE (235–302 mg/kg) was beneficial for maintaining the immune and antioxidant capacity of juvenile S. intermedius by regulating the expression of inflammation- and immune-related genes and abundance of some bacteria to a healthy state.

1. Introduction

Sea urchin is rare but valuable and considered a luxurious sea food due to the gonads, characterized by bright color, delicate taste, and abundant nutrition [1]. In recent years, aquaculture has proved to be an effective solution to reduce reliance on wild sea urchins [2]. Strongylocentrotus intermedius was imported from Japan to China in 1989 [3]. Since then, a series of studies was conducted on this species, including larval and juvenile production, farming technology, feed manufacture, and disease prevention and control [4,5,6,7,8]. Nowadays, S. intermedius has become one of the most important farming species, especially in the coastal areas of northern China [9,10]. Sea urchin seeds are the foundation of massive culture. Saccharina japonica and Undaria pinnatifida are the natural food during the large-scale larval and juvenile production of S. intermedius [10]. However, there are several defects of macroalgae, such as unstable supply, low feed conversion efficiency, and incomplete nutrition. Thus, it is essential to formulate feeds suitable for producing sea urchin seeds with higher efficiency [9,11,12].
Vitamin E (VE) is an essential nutrient and a lipid-soluble antioxidant for animals [13]. Previous studies have shown that diets supplemented with VE increased the immune and antioxidant capacity of aquatic animals, such as rohu (Labeo rohita) [14], Epinephelus Malabaricus [15], guppy (Poecilia reticulata) [16], angel fish (Pterophyllum scalare) [17], turbot (Scophthalmus maximus) [18], and sea cucumber (Apostichopus japonicus) [19]. There have been some studies that aimed to elucidate the beneficial effects of VE on the immune system and antioxidation in a variety of aquatic animals. VE acts as a quencher for reactive oxygen species (ROS) to prevent lipid peroxidation [20]. VE can reduce the activity of cyclooxygenase (COX)-2 and inhibit prostaglandin E2 (PGE2) synthesis, preventing the occurrence of inflammation and oxidative stress [21,22,23,24]. The intestine not only undertakes the functions of food digestion and nutrient metabolism [25,26,27], but also affects the immune regulation of animals [28]. The role of the intestine in regulating immune response has been accepted and is attracting more and more attention [29]. Huang et al. [30] has found that oxidized fish oil could destroy the intestinal barrier structure of Ctenopharyngodon Idella and increase intestinal permeability. Studies on humans and male rats have shown that oxidative stress could destroy the intestinal structure and cause disorders of intestinal microbiota [31,32]. However, no relevant information is available about the requirement of vitamin E and its physiological role in sea urchins.
Therefore, this experiment was performed to assess the impacts of dietary VE on growth, intestinal microbiota, immune response, and related gene expression in juvenile S. intermedius. It was expected to quantify the specific VE requirement for juvenile S. intermedius based on multiple parameters and improve the understanding of the physiological role of VE in sea urchins.

2. Materials and Methods

2.1. Feeds and Feeding Procedures

Six dry feeds were formulated by adding graded levels (50, 150, 250, 350, 450, and 550 mg/kg) of VE acetate (purity ≥ 97%, Duly Biotech Co., Ltd., Nanjing, China) according to the estimated VE requirement for aquatic animals [33,34,35]. The final VE contents in the dry feeds were 78, 105, 152, 235, 302, and 390 mg/kg; these were named E78, E105, E152, E235, E302, and E390, respectively. Fresh kelp (S. japonica) (HD), the natural food for S. intermedius, was used as the control diet. Feed formulation and approximate composition were described in Table 1.
Solid ingredients were crushed to a fine powder, which was passed through a 320 μm mesh. Then, solid ingredients were mixed well by strictly following the feed formulation. Subsequently, fish oil and SL were added and blended evenly again. Finally, water (appropriately 30%) was blended with the mixture, which was used for making pellets. A pellet-making machine (DES-TS1280, Dingrun, China) was used to produce feeds, which were dried at 40 °C. To reduce the oxidation, the dried feeds were packed in sealed bags and stored in a freezer (−20 °C).
The experimental sea urchins were bought from a local farm in Dalian. They were acclimated for 14 days when they arrived at the experimental base. Then, sea urchins of similar size (1.50 ± 0.20 g) were assigned at random to 42 rectangular cages (15×15×35 cm), which were placed in flow-through reinforced plastic tanks (180×100×80 cm). The water flow speed was fixed at appropriately 2.0 L/min. Each cage (replicate) was stocked with 20 individuals. There were six replicates for each dietary treatment. Glass Petri dishes were put at the bottom of all cages to maximally reduce the feed waste. Sea urchins were fed to apparent satiation twice daily (07:00 and 17:00). The residual feeds and feces were removed promptly after each feeding. The following water condition was maintained: water temperature, 14.2–21.8 °C; salinity, 30; pH, 8.0 ± 0.1; and dissolved oxygen, >7.0 mg/L. The whole feeding experiment lasted for 60 days.

2.2. Sampling

When the experiment ended, sea urchins in each cage were counted and weighed following 24 h starvation. Subsequently, coelomic fluid was taken from six individuals and then was centrifugated at 4 °C for five minutes (3000 r/min) [35]. After that, the upper fluid was separated and stored at –80 °C. The upper fluid of the coelomic fluid was used for determining related enzyme activities and malondialdehyde content. Finally, all the intestines of the sea urchins were aseptically dissected from each cage. The intestines were divided into three tubes and flash frozen before they were stored at –80 °C. The first tube, with nine intestines, was used for the microbial diversity analysis. The second tube, with six intestines, was used for determining the activities of digestive enzymes. The third tube, with five intestines, was used for the detection of related gene expression.

2.3. VE Content Analysis

The VE content was assayed by using the method of Sau et al. [14]. The analysis method can be briefly described as follows. First, samples were saponified to extract VE. After evaporation, the residue was dissolved in methanol. Finally, VE in the dissolved residue was quantified by using reversed-phase high-performance liquid chromatography (Scientific U3000 HPLC, USA). Results were expressed as mg/kg of sample.

2.4. Digestive Enzyme and Immune Enzyme Analysis

Crude enzymes were made according to the method of Li et al. [35] First, intestines were homogenized on ice after they were mixed with phosphorate buffer solution (1:9). Then, the homogenate was centrifuged (10,000 g) at 4 °C for 15 min. After that, the crude enzyme extracts at the upper layer were carefully drawn out. Protein contents were assayed according to the method of Bradford [36]. Relevant commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were used to determine the activities of digestive enzymes and immune enzymes.

2.5. RNA Extraction and Real-Time Quantitative PCR

The expression of related genes in the intestine was detected with qPCR. The intestines were ground with a tissue grinder (Wuhan Xavier Biotechnology Co., Ltd., Wuhan, China). Trizol universal reagent (DP424, Tiangen, Beijing, China) was used for extracting total RNA. Then, the integrity and the concentration were measured by microspectrophotometer with the Agilent2100 bioanalyzer. After that, cDNA was obtained by using the Prime ScriptTM Real-time PCR Kit (TaKaRa, Beijing, China). Finally, the cDNA templates were diluted by five times before they were used for qPCR. The qPCR was performed by following the instructions of TaKaRa (Dalian, China). LightCycler®96 (Roche Group, Basel, Switzerland) was used to perform the qPCR, with primer information displayed in Table 2. The following reaction conditions were used: 95 °C (30 s), 95 °C (5 s) for 40 cycles, 60 °C (32 s). The primer information can be found in Table 3. The relative expression was calculated by using the method of 2−ΔΔCT [9].

2.6. Microbial Diversity Analysis

The method of microbial diversity analysis has been described in a previous study by our lab [35]. The related methods can be briefly described as follows.
Total bacterial community DNA was extracted according to the appended protocols of a commercial kit (Omega Bio-tek, Norcross, GA, USA). After that, the V3-V4 region of the bacteria 16S ribosomal RNA gene was amplified by using primer pairs (338F 5’-ACTCCTACGGGAGGCAGCAG-3’ and 806R 5’-GGACTACHVGGGTWTCTAAT-3’). The following PCR reaction regime was used: 95 °C (3 min), 95 °C (30 s) for 27 cycles, 55 °C (30 s), 72 °C (45 s), and a final extension at 72 °C (10 min).
After purified amplicons were obtained, they were sequenced on an Illumina MiSeq platform (Majorbio Biopharm Techonology Co., Ltd., Shanghai, China). Raw fast files were demultiplexed and quality-filtered using QIIME (version 1.17) with the following criteria. UPARSE was used to cluster Operational Taxonomic Units (OTUs) with 97% similarity cutoff. UCHIME was used to identify and remove chimeric sequences.

2.7. Data Analysis

Weight growth rate (WGR, %) = (Wf − Wi) × 100/Wi
Gonadosomatic index (GSI, %) = GM × 100/W
Digestive tract index (DTI, %) = DM × 100/W
where Wi and Wf are the wet weight of the initial body weight and final body weight of sea urchins; DM, GM, and W are the wet mass of the digestive tract, gonads, and whole body of the selected individuals, respectively.
Data analysis was performed with one-way analysis of variance (ANOVA) following a normal distribution test. If there was significance, Duncan’s multiple range test was used for comparing means between different dietary treatments. p < 0.05 was interpreted as the level of significance.

3. Results

3.1. Growth Performance

WGR increased from 335.1% to 419.9% as dietary VE increased from 78 mg/kg to 235 mg/kg, and then decreased with further increase in VE (p > 0.05). WGR of sea urchins in the HD group was higher than that in the dry feed groups, but the significance was only detected between the HD group and E78 group (p < 0.05). GSI of sea urchins was not significantly affected by dietary VE in the formulated feed groups (p > 0.05). DTI in the E105 was significantly higher than that in the other feed groups (p < 0.05). GSI in all dry feed groups was significantly higher than that in the HD (p <0.05). On the contrary, DTI in the HD was significantly higher than that in the dry feed groups except for the E105 group (p <0.05) (Table 3).
Based on WGR, the optimal VE requirement was estimated to be 262.4 mg/kg dry feed (Figure 1).

3.2. Digestive Enzyme Activities

As dietary VE increased, the activities of pepsin, lipase, amylase, and cellulase first increased and then decreased. The pepsin activity in the HD was significantly higher than that in the E390 (p < 0.05), but was comparable to that in the other dry feed groups (p > 0.05). Pepsin activity in the E390 was significantly lower than in the other dry feed groups (p < 0.05). Sea urchins fed diets with a relatively higher level of VE (302-390 mg/kg) had markedly lower lipase activity than those with a moderate level of VE (152–235 mg/kg) (p < 0.05). The lipase activity in the E235 was highest, comparable to that in the low-VE (78–152 mg/kg) groups, but it was significantly higher than that in the other dietary groups (p < 0.05). The lipase activity in the HD was significantly lower than that in the E235 (p < 0.05), but was comparable to that in the other dry feed groups (p > 0.05). The amylase activity in the E235 was highest, comparable to that in the low-VE (105–152 mg/kg) groups, but it was significantly higher than that in the other groups (p < 0.05). The cellulase activity in the E105 was highest, comparable to that in the E78 and HD groups (p > 0.05), but it was significantly higher than that in the other groups (p < 0.05) (Table 4).
Based on pepsin activity, lipase activity, and amylase activity, the optimal VE requirement was estimated to be 220.0 mg/kg, 172.5 mg/kg, and 226.4 mg/kg, respectively (Figure 2).

3.3. Immune- and Antioxidation-Related Parameters

The activities of immune enzymes, lysozyme (LYZ), alkaline phosphatase (AKP), and acid phosphatase (ACP), in the HD were significantly lower than those in the dry feed groups (p < 0.05). The activities of selected immune enzymes and superoxide dismutase (SOD) were decreased by the supplementation of VE (105–390 mg/kg) to different extents. However, no significant differences were detected in the activities of immune enzymes and SOD among the VE supplementation groups (p > 0.05). The activities of antioxidant enzymes, catalase (CAT), glutathione peroxidase (GPX), and glutathione S-transferase (GST), first decreased significantly as dietary VE increased from 78 mg/kg to 152 mg/kg, and then increased significantly as dietary VE further increased (p < 0.05). The MDA content in HD was significantly lower than that in the dry feed groups except for E105 (p < 0.05). Among dry feed groups, MDA content in the E235 was markedly higher than that in the other groups (p < 0.05) (Table 5).

3.4. Immune-Related Gene Expression

The expression of COX-2 and TNF-α first decreased as dietary VE increased from 78 mg/kg to 152 mg/kg, and then significantly increased with VE further increasing to 390 mg/kg (p < 0.05). The expression of TLR, LYZ, NLR6, and 185/333-1 showed no significant differences with VE ranging from 78 mg/kg to 152 mg/kg (p > 0.05), and then significantly increased as VE increased to 235 mg/kg or 302 mg/kg (p < 0.05). Sea urchins in the group with the highest VE (390 mg/kg) showed markedly lower expression of TLR, LYZ, HSP70, and NLR6 than those with a moderate or relatively higher level of VE (235–302 mg/kg). The expression of COX-2, TNF-α, TLR, LYZ, HSP70, and NLR6 in HD was comparable to that in E78 (p > 0.05). The expression of 185/333-1 and AIF-1 in HD was significantly higher than that in the dry feed groups (p < 0.05) (Figure 3).

3.5. Intestinal Microbiota

Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes were the main phyla, with their abundance exceeding 90% of the intestinal microbiota in all dietary groups (Figure 4). The relative abundance of Proteobacteria significantly increased with increasing dietary VE (p < 0.05). The Proteobacteria abundance in E78 was significantly lower than that in the other groups (p < 0.05). On the contrary, the relative abundance of Firmicutes and Bacteroidetes significantly decreased as dietary VE increased (p < 0.05). Firmicutes and Bacteroidetes in E78 showed significantly higher abundance than those in the other groups (p < 0.05). No significant differences were detected in the relative abundance of Actinobacteria among dry feed groups (p > 0.05). The relative abundance of Actinobacteria in E390 was significantly higher than that in HD (p < 0.05) (Table 6).
As for genus, Ruegeria, Phaeobacter, Rhodococcus, Maliponia, Escherichia-Shigella, and Bacteroides were the main intestinal bacteria in all dietary groups (Figure 5). Ruegeria, Phaeobacter, Rhodococcus, Maliponia, Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 were significantly affected by VE in the diets. The relative abundance of Ruegeria and Maliponia significantly increased with increasing dietary VE. The relative abundance of Ruegeria in the E390 group was comparable to that in HD (p > 0.05), but was significantly higher than that in E78 and E152 (p < 0.05). The Maliponia in E390 showed slightly higher abundance than that in E152 (p > 0.05), but was significantly higher than that in the E78 and HD groups (p < 0.05). The relative abundance of Phaeobacter increased first and then decreased with increasing dietary VE. The highest abundance of Phaeobacter was observed in the E152 group, significantly higher than that in the other groups (p < 0.05). The relative abundance of Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 significantly decreased with increasing dietary VE. Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 in E78 showed significantly higher abundance than those in other groups (p < 0.05) (Table 7).

4. Discussion

In this study, the WGR of sea urchins fed kelp was significantly higher than that in the dry feed groups. This was in accordance with the findings on this and other sea urchin species [9,14,44]. Kelp is rich in cellulose and mucus, which may be beneficial for protecting the fragile intestine and improving the digestibility of juvenile sea urchins [9,44]. Furthermore, the absolute digestive tract weight of sea urchins fed fresh kelp was significantly higher than that in the other dietary groups. This further proved that fresh kelp was beneficial for the intestinal development of sea urchins. It was previously proved that the addition of VE within a certain dose range can significantly increase the intestinal villi height and mucosal thickness of catfish (Silurus asotus), thereby improving intestinal function [45]. Compared to the low-VE groups (78–105 mg/kg), the WGR of sea urchins in the moderate or relatively higher VE groups (152–302 mg/kg) showed an obvious increase, but declined in the highest VE group (390 mg/kg). The estimated VE requirement (262.4 mg/kg) based on the WGR regression model was higher than that for sea cucumber (Apostichopus japonicus) (165.2–187.2 mg/kg) [8], that for medaka (Oryzias latipes) (121.3 mg/kg) in both the juvenile and adult stages [46], that for Caspian trout (Squaliobarbus ourriculus) (78.73–82.16 mg/kg) [47], and that for spotted bass (Pomoxis nigromacufatus) (48.2–55.7 mg/kg) [48], respectively. Excessive vitamin E leads to decreased growth performance of grass shrimp (Penaeus monodon) [49], and poor growth, hepatotoxicity, and death of keeling (Tor tambra) fingerlings [50]. Digestive enzymes are critical for maintaining nutrient digestion and controlling growth performance of aquatic animals [51]. In this study, the activities of digestive enzymes were increased by the appropriate amount of VE (235 mg/kg), but these beneficial effects were removed by an overdose of VE. This was consistent with the findings on channel catfish (Ictalurus punctatus) [44] and sea cucumber [52], which suggests that moderate amounts of VE can promote digestive enzyme activity, while excessive VE may inhibit its activity [53].
In this study, the sea urchins fed kelp had significantly lower GSI than those fed dry feeds. This was consistent with the results of some previous studies [9,10,54,55]. Compared to dry feeds, kelp had relatively lower contents of proteins and lipids. It was found that the GSI of juvenile S. intermedius increased with the increasing dietary protein concentration [55]. Furthermore, insufficient lipid intake decreased gonad production of sea urchin Lytechinus variegatus [56]. Dietary lipid at a level of 90 g/kg achieved the maximum GSI in both male and female Onychostoma macrolepis broodstock [57]. A relatively higher lipid level (180 g/kg) in the diets significantly promoted gonad development of female Chinese sturgeon (Acipenser sinensis) [58]). There have been many studies that have reported the beneficial effects of VE on the growth and development of red crayfish (Cherax quadricarinatus) [59], Nile tilapia (Oreochromis niloticus) [60], and pandani (Pseudotropheus socolofi) [40].
SOD, CAT, and GPX can be used as “guards” protecting the organisms from the destruction of free radicals [61,62,63,64]. In the present study, the antioxidant enzyme activities were reduced by a low or moderate content of VE (105–152 mg/kg), but were increased as VE content reached levels equal to or above 235 mg/kg. This indicated that VE could preferentially react with free radicals [65], which resulted in a low state of “guards”. However, excessive VE can be subject to lipid peroxidation and caused oxidative stress, reflected by induced inflammation and elevated antioxidant enzyme activities [66,67]. Oxidative stress can induce an inflammation reaction or be induced by inflammation [68,69]. Cyclooxygenase 2 (COX-2) can catalyze ARA to prostaglandin E2 (PGE2). PGE2 participates in the activation of downstream inflammatory cytokines [70,71,72]. Song et al. [73] found that oxidative stress can induce inflammation through the hepatic inflammatory signaling pathway. In this study, the expression of inflammation-related genes, such as COX-2, TLR, TNF-α, and AIF-1, in the intestine of S. intermedius showed a parallel changing tendency to the activities of antioxidant enzymes as dietary VE increased. In this study, the MDA content in the HD group was lower than that in the dry feed groups. The antioxidant substances present in the fresh kelp can resist oxidative stress and protect cells from the hazards of free radicals and other harmful substances. It was previously found that low-molecular-weight fucoidan from the kelp Laminaria japonica exerted antioxidant and anticoagulant effects [74]. Fucoidan and kelp sulfated polysaccharide are both polysaccharides with antioxidant properties. Compared with fucoidan, kelp sulfated polysaccharide has much stronger antioxidant activity [75]. Furthermore, the natural fucoxanthin from kelp has high antioxidant and functional properties, and can be used as an alternative raw material for commercial fucoxanthin production [76]. Polyphenolic extracts from marine brown macroalgae were shown to effectively remove oxidants from cells and cellular systems [77].
In the present study, the relative abundance of Proteobacteria, Actinobacteria, Ruegeria, Phaeobacter, and Maliponia in the intestine of the sea urchins increased as dietary vitamin E increased. Porsby et al. [78] found that some bacteria in the genus of Ruegeria showed certain antibacterial properties in turbot (Scophthalmus maximus). Phaeobacter contains some bacteria with obvious bacteriostatic effects [78]. Therefore, it could be the relatively higher abundance of Ruegeria and Phaeobacter in the intestine that accounted for the beneficial effects of VE and fresh kelp on nonspecific immunity of S. intermedius. In this study, the relative abundance of the Firmicutes, Bacteroidetes, Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 gradually decreased with increasing VE content. Firmicutes is involved in the absorption of lipids [79]. VE has been found to sooth the abnormal deposition of lipids in the liver by decreasing lipid absorption and increasing lipid oxidation in several fish species. Since Bacteroides has a strong capacity of digesting fibers [80], it was postulated that sea urchins are prone to use less fibers for energy substances with the increase in VE in the formulated feeds. Consistently, the cellulase activities decreased significantly as dietary VE increased. Bacteroides is abundant in organisms with digestive tract diseases [81]. And Clostridium sensu stricto 1 also causes intestinal diseases [82]. Therefore, increasing VE could exert its beneficial effects on immune response by decreasing the abundance of some bad bacteria.

5. Conclusions

In conclusion, the optimal VE requirement was estimated to be 262.4 mg/kg based on WGR, and 172.5–226.4 mg/kg based on digestive enzyme activities. VE addition at a low dosage (105–152 mg/kg) showed inhibitory effects on immune and antioxidant enzyme activities and expression of inflammation-related genes (COX-2 and TNF-α), but showed no beneficial effects at moderate or high dosage (235–390 mg/kg), while a moderate or relatively higher level of VE (235–302 mg/kg) significantly increased the expression of several immune-related genes, such as TLR, LYZ, NLR6, and 185/333-1. The relative abundance of Proteobacteria, Actinobacteria, Ruegeria, and Maliponia in the intestine of the sea urchins increased with the increase in VE in the dry feeds. On the contrary, the relative abundance of the Firmicutes, Bacteroidetes, Escherichia-Shigella, Bacteroides, and Clostridium sensu stricto 1 gradually decreased as VE content increased. These results indicated that a moderate level of VE (172.5–262.4) can achieve ideal digestive enzyme activities and growth performance, but a relatively higher level of VE (235–302 mg/kg) was beneficial for maintaining the immune and antioxidant capacity of juvenile S. intermedius by regulating the expression of inflammation- and immune-related genes and abundance of some bacteria to a healthy state.

Author Contributions

Conceptualization: R.Z. and M.L. Experimental analysis: M.L. and D.G. Data curation: P.G. and W.D. Funding acquisition and administration: R.Z., Y.C. and J.D. Writing—original draft: M.L. and R.Z. Writing—review and editing: L.W. and R.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by grants from the High-Level Talent Support Grant for Innovation in Dalian (2022RJ14), Natural foundation of Liaoning Province (LJKMZ20221096), National Natural Science Foundation of China (41606180) and Young Elite Scientists Sponsorship of China (YESS20150157).

Institutional Review Board Statement

Ethical review and approval were waived for this study due to sea urchins belonging to invertebrates.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to privacy.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rubilar, T.; Epherra, L.; Deias-Spreng, J. Ingestion, absorption and assimilation efficiencies, and production in the sea urchin Arbacia dufresnii fed a formulated feed. J. Shellfish Res. 2016, 35, 1083–1094. [Google Scholar] [CrossRef]
  2. Lourenço, S.; Valente, L.; Andrade, C. Meta-analysis on nutrition studies modulating sea urchin roe growth, colour and taste. Rev. Aquac. 2019, 11, 766–781. [Google Scholar] [CrossRef]
  3. Chang, Y.; Zhang, W.; Zhao, C.; Song, J. Estimates of heritabilities and genetic correlations for growth and gonad traits in the sea urchin Strongylocentrotus intermedius. Aquac. Res. 2012, 43, 271–280. [Google Scholar] [CrossRef]
  4. Zhan, Y.; Hu, W.; Zhang, W. The impact of CO2-driven ocean acidification on early development and calcification in the sea urchin Strongylocentrotus intermedius. Mar. Pollut. Bull. 2016, 112, 291–302. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, W.; Zhao, C.; Liu, P. First report on tube feet differential pigmentation in the cultivated sea urchin Strongylocentrotus intermedius (Agassiz, 1863) and its relationship with growth performance: Tube feet differential pigmentation in sea urchins. Aquac. Res. 2010, 41, 706–708. [Google Scholar] [CrossRef]
  6. Zhang, W.; Wang, Z.; Leng, X. Transcriptome sequencing reveals phagocytosis as the main immune response in the pathogen-challenged sea urchin Strongylocentrotus intermedius. Fish. Shellfish Immunol. 2019, 94, 780–791. [Google Scholar] [CrossRef]
  7. Chang, Y.; Ding, J.; Xu, Y.; Li, D.; Zhang, W.; Li, L.; Song, J. SLAF-based high-density genetic map construction and QTL mapping for major economic traits in sea urchin Strongylocentrotus intermedius. Sci. Rep. 2018, 8, 820. [Google Scholar] [CrossRef]
  8. Lv, D.; Zhang, F.; Ding, J. Effects of dietary n-3 LC-PUFA on the growth performance, gonad development, fatty acid profile, transcription of related genes and intestinal microflora in adult sea urchin (Strongylocentrotus intermedius). Aquac. Res. 2020, 52, 1431–1441. [Google Scholar] [CrossRef]
  9. Li, B.; Wang, L.; Wang, J.; Sun, Y. Requirement of vitamin E of growing sea cucumber Apostichopus japonicus Selenka. Aquac. Res. 2020, 51, 1284–1292. [Google Scholar] [CrossRef]
  10. Ning, Y.; Zhang, F.; Tang, L. Effects of dietary lipid sources on the growth, gonad development, nutritional and organoleptic quality, transcription of fatty acid synthesis related genes and antioxidant capacity during cold storage in adult sea urchin (Strongylocentrotus intermedius). Aquaculture 2022, 548, 737688. [Google Scholar] [CrossRef]
  11. Zuo, R.T.; Li, M.; Ding, J. Higher dietary arachidonic acid levels improved the growth performance, gonad development, nutritional value, and antioxidant enzyme activities of adult sea srchin (Strongylocentrotus intermedius). J. Ocean. Univ. China 2018, 17, 932–940. [Google Scholar] [CrossRef]
  12. Raposo, A.; Ferreira, S.; Ramos, R. Effect of three diets on the gametogenic development and fatty acid profile of Paracentrotus lividus (Lamarck, 1816) gonads. Aquac. Res. 2019, 50, 2023–2038. [Google Scholar] [CrossRef]
  13. Li, X.; Sun, J.; Wang, L. Effects of dietary vitamin E levels on growth, antioxidant capacity and immune response of spotted seabass (Lateolabrax maculatus) reared at different water temperatures. Aquaculture 2023, 565, 739141. [Google Scholar] [CrossRef]
  14. Sau, S.K.; Paul, B.N.; Mohanta, K.N. Dietary vitamin E requirement, fish performance and carcass composition of rohu (Labeo rohita) fry. Aquaculture 2004, 240, 359–368. [Google Scholar] [CrossRef]
  15. Lin, Y.H.; Shiau, S.Y. Dietary vitamin E requirement of grouper, Epinephelus malabaricus, at two lipid levels, and their effects on immune responses. Aquaculture 2005, 248, 235–244. [Google Scholar] [CrossRef]
  16. Mehrad, B.; Sudagar, M. Dietary vitamin E requirement, fish performance and reproduction of guppy (Poecilia reticulata). Aquac. Aquar. Conserv. Legis. 2010, 3, 239–246. [Google Scholar]
  17. Faramarzi, M. Assessment study about effect of vitamin E (a-tocopheryl) on feeding performance, survival rate and reproductive performance of angel fish (Pterophyllum scalare). World J. Fish Mar. Sci. 2012, 4, 254–257. [Google Scholar]
  18. Niu, H.; Jia, Y.; Hu, P. Effect of dietary vitamin E on the growth performance and nonspecific immunity in sub-adult turbot (Scophthalmus maximus). Fish. Shellfish Immunol. 2014, 41, 501–506. [Google Scholar] [CrossRef]
  19. Wang, J.; Xu, Y.; Li, X. Vitamin E requirement of sea cucumber (Apostichopus japonicus) and its’ effects on nonspecific immune responses. Aquac. Res. 2015, 46, 1628–1637. [Google Scholar] [CrossRef]
  20. Boglino, A.; Darias, M.J.; Estévez, A. The effect of dietary oxidized lipid levels on growth performance, antioxidant enzyme activities, intestinal lipid deposition and skeletogenesis in Senegalese sole (Solea senegalensis) larvae. Aquac. Nut. 2014, 20, 692–711. [Google Scholar] [CrossRef]
  21. Calder, P.C. n-3 polyunsaturated fatty acids, inflammation, and inflammatory disease. Am. J. Clin. Nutr. 2006, 83, 1505S–1519S. [Google Scholar] [CrossRef]
  22. Yang, C.S.; Lee, H.M.; Lee, J.Y. Reactive oxygen species and p47 phox activation are essential for the Mycobacterium tuberculosis-induced pro-inflammatory response in murine microglia. J. Neuroinflammation 2007, 4, 27–42. [Google Scholar] [CrossRef] [PubMed]
  23. Alanazi, W.A.; Fakhruddin, S.; Jackson, K. Angiotensin II induces prostaglandin E2 production and oxidative stress in the renal cortex. FASEB J. 2016, 30, 1198.6. [Google Scholar] [CrossRef]
  24. Zhang, P.; Gan, Y.H. Prostaglandin E2 pregulated trigeminal ganglionic sodium channel 1.7 involving temporomandibular joint inflammatory pain in rats. Inflammation 2017, 40, 1102–1109. [Google Scholar] [CrossRef] [PubMed]
  25. Sabyasachi, M.; Tanami, R.; Arunkumar, R. Characterization and identification of enzyme-producing bacteria isolated from the digestive tract of bata, Labeo bata. J. World Aouaculture Soc. 2010, 41, 369–377. [Google Scholar]
  26. Li, X.; Chi, Z.; Liu, Z. Phytase production by a marine yeast Kodamea ohmeri BG3. Appl. Biochem. Biotechnol. 2008, 149, 183–193. [Google Scholar] [CrossRef]
  27. Roy, T.; Mondal, S.; Ray, A.K. Phytase-producing bacteria in the digestive tracts of some freshwater fish. Aquac. Res. 2009, 40, 344–353. [Google Scholar] [CrossRef]
  28. Vigors, S.; John, V.D.; Kelly, A.K. The Effect of divergence in feed efficiency on the intestinal microbiota and the intestinal immune response in both unchallenged and lipopolysaccharide challenged ileal and colonic explants. PLoS ONE 2016, 11, e014814. [Google Scholar] [CrossRef]
  29. Attaya, A.; Wang, T.; Zou, J. Gene expression analysis of isolated salmonid GALT leucocytes in response to PAMPs and recombinant cytokines. Fish. Shellfish Immunol. 2018, 80, 426–436. [Google Scholar] [CrossRef]
  30. Huang, Y.W.; Ye, Y.T.; Cai, C.F. The study on damage of intestinal mucosa barrier structure with oxidized fish oil diets in Ctenopharyngodn idella. J. Fish. China 2015, 39, 1511–1520. [Google Scholar]
  31. Saada, H.N.; Renée, G.R.; Eltahawy, N.A. Lycopene protects the structure of the small intestine against gamma-radiation-induced oxidative stress. Phytother. Res. 2010, 24, S204–S208. [Google Scholar] [CrossRef] [PubMed]
  32. Heberling, C.A.; Dhurjati, P.S.; Sasser, M. Hypothesis for a systems connectivity model of autism spectrum disorder pathogenesis Links to gut bacteria, oxidative stress, and intestinal permeability. Med. Hypothesis 2013, 80, 264–270. [Google Scholar] [CrossRef]
  33. Zhang, X.; Wang, H.; Yin, P. Flaxseed oil ameliorates alcoholic liver disease via anti-inflammation and modulating gut microbiota in mice. Lipids. Health Dis. 2017, 16, 44–54. [Google Scholar] [CrossRef]
  34. Arshadi, A.; Gharaei, A.; Mirdar Harijani, J. Effect of dietary vitamin E on reproductive performance and vitellogenin gene expression in broodstock of Litopenaeus vannamei. Iran. J. Fish. Sci. 2020, 19, 2475–2492. [Google Scholar]
  35. Li, M.; Zhang, F.; Ding, J. Effects of lipid sources on the growth performance, gonad development, fatty acid profile and transcription of related genes in juvenile sea urchin (Strongylocentrotus intermedius). Aquac. Nutr. 2020, 27, 28–38. [Google Scholar] [CrossRef]
  36. Bradford, M.M. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
  37. Zhou, Z.C.; Bao, Z.M.; Dong, Y. MYP gene expressions at transcription level in different stages of gonad of sea urchin Strongylocentrotus intermedius and hybrids. Hereditas 2008, 30, 1453–1458. [Google Scholar]
  38. Chen, Y.D.; Liu, X.F.; Chang, Y.Q. Cloning of partial sequence and expression of NLR family in sea urchin Strongylocentrotus intermedius. J. Ocean Univ. China 2014, 29, 336–341. [Google Scholar]
  39. Wang, Y.N.; Yu, Z.; Liu, Y. cDNA cloning and expression analysis of the TLR gene in the shrimp and horse feces sea urchin. J. Ocean Univ. China 2014, 29, 329–335. [Google Scholar]
  40. Ding, J.; Chang, Y.Q.; Sun, W. Cloning and expression of immune-related genes from Strongylocentrotus intermedius. Progr. Mari. Sci. 2011, 29, 67–79. [Google Scholar]
  41. Bai, X.Q.; Pang, Z.G.; Zhang, W.J. Study on the expression of hsp70 and hsp90 genes in intermediate sea urchins induced by high temperature. Ocean Lake. Mar. 2015, 46, 1034–1039. [Google Scholar]
  42. Wang, Y.; Ding, J.; Liu, Y. Isolation of immune-relating 185/333-1 gene from sea urchin (Strongylocentrotus intermedius) and its expression analysis. J. Ocean Univ. China 2016, 15, 163–170. [Google Scholar] [CrossRef]
  43. Ji, N.J.; Yang, Y.F.; Ding, J. Cloning and expression analysis of the full length cDNA of the lysozyme gene from the sea urchin, Pseudomonas aeruginosa. J. Fish. Sci. China 2013, 20, 950–957. [Google Scholar]
  44. Di, W.; Heqiu, Y.; Gou, D.; Gong, P.; Ding, J.; Chang, Y.; Zuo, R. Effects of Supplementary Kelp Feeding on the Growth, Gonad Yield, and Nutritional and Organoleptic Quality of Subadult Sea Urchin (Strongylocentrotus intermedius) with Soya Lecithin Intake History. Aquac. Nutr. 2023, 16, 8894923. [Google Scholar] [CrossRef] [PubMed]
  45. He, M.; Wang, K.; Liang, X. Effects of dietary vitamin E on growth performance as well as intestinal structure and function of channel catfish (Ictalurus punctatus, Rafinesque1818). Exp. Ther. Med. 2017, 14, 5703–5710. [Google Scholar]
  46. Erdogan, M.; Arslan, T. Effects of vitamin E on growth and reproductive performance of pindani (Pseudotropheus socolofi Johnson, 1974). Aquaculture 2019, 509, 59–66. [Google Scholar] [CrossRef]
  47. Saheli, M.; Rajabi Islami, H.; Mohseni, M. Effects of dietary vitamin E on growth performance, body composition, antioxidant capacity, and some immune responses in Caspian trout (Salmo caspius). Aquac. Rep. 2021, 21, 100857. [Google Scholar] [CrossRef]
  48. Ahmed, S.A.A.; Ibrahim, R.E.; Farroh, K.Y. Chitosan vitamin E nanocomposite ameliorates the growth, redox, and immune status of Nile tilapia (Oreochromis niloticus) reared under different stocking densities. Aquaculture 2021, 541, 736804. [Google Scholar] [CrossRef]
  49. Bae, J.Y.; Park, G.H.; Yoo, K.Y. Evaluation of optimum dietary vitamin E requirements using DL-α-tocopheryl acetate in the juvenile eel, Anguilla japonica. J. Appl. Ichthyol. 2013, 29, 213–217. [Google Scholar] [CrossRef]
  50. Muchlisin, Z.A.; Arisa, A.A.; Muhammadar, A.A. Growth performance and feed utilization of keureling (Tor tambra) fingerlings fed a formulated diet with different doses of vitamin E (alpha-tocopherol). Arch. Polish. Fish. 2016, 24, 47–52. [Google Scholar] [CrossRef]
  51. Yu, L.J.; Wen, H.; Jiang, M. Effects of ferulic acid on growth performance, immunity and antioxidant status in genetically improved farmed tilapia (Oreochromis niloticus) fed oxidized fish oil. Aquac. Nut. 2020, 26, 1431–1442. [Google Scholar] [CrossRef]
  52. Xu, Y.; Gao, Q.; Dong, S. Effects of supplementary selenium and vitamin E on the growth performance, antioxidant anzyme activity, and gene expression of sea ucumber Apostichopus japonicus. Biol. Trace Elem. Res. 2021, 199, 4820–4831. [Google Scholar] [CrossRef]
  53. Wang, W.; Ishikawa, M.; Koshio, S. Effects of dietary astaxanthin and vitamin E and their interactions on the growth performance, pigmentation, digestive enzyme activity of kuruma shrimp (Marsupenaeus japonicus). Aquac. Res. 2019, 50, 1186–1197. [Google Scholar] [CrossRef]
  54. Schlosser, S.C.; Lupatsch, I.; Lawrence, J.M. Protein and energy digestibility and gonad development of the European sea urchin Paracentrotus lividus (Lamarck) fed algal and prepared diets during spring and fall. Aquac. Res. 2005, 36, 972–982. [Google Scholar] [CrossRef]
  55. Zuo, R.; Hou, S.; Wu, F.; Song, J. Higher dietary protein increases growth performance, anti-oxidative enzymes activity and transcription of heat shock protein 70 in the juvenile sea urchin (Strongylocentrotus intermedius) under a heat stress. Aquac. Fish. 2017, 2, 18–23. [Google Scholar] [CrossRef]
  56. Gibbs, V.K.; Powell, M.L.; Hammer, H.S.; Jones, W.T.; Watts, S.A.; Lawrence, A.L. Dietary phospholipids affect growth and production of juvenile sea urchin Lytechinus variegatus. Aquaculture 2009, 292, 95–103. [Google Scholar] [CrossRef]
  57. Zhou, J.; Feng, P.; Li, Y. Effects of dietary lipid levels on growth and gonad development of Onychostoma macrolepis broodfish. Fishes 2022, 7, 291. [Google Scholar] [CrossRef]
  58. Leng, X.; Zhou, H.; Tan, Q. Integrated metabolomic and transcriptomic analyses suggest that high dietary lipid levels facilitate ovary development through the enhanced arachidonic acid metabolism, cholesterol biosynthesis and steroid hormone synthesis in Chinese sturgeon (Acipenser sinensis). Br. J. Nutr. 2019, 122, 1230–1241. [Google Scholar]
  59. Tao, Y.; Pan, Y.; Wang, Q. Vitamin E ameliorates impaired ovarian development, oxidative stress, and disrupted lipid metabolism in Oreochromis niloticus fed with a diet containing olive oil instead of fish oil. Antioxidants 2023, 12, 1524. [Google Scholar] [CrossRef] [PubMed]
  60. Shehata, A.I.; Wang, T.; Jibril Habib, Y.; Wang, J.; Fayed, W.M.; Zhang, Z. The combined effect of vitamin E, arachidonic acid, Haemtococcus pluvialis, nucleotides and yeast extract on growth and ovarian development of crayfish ( Cherax quadricarinatus) by the orthogonal array design. Aquac. Nutr. 2020, 26, 2007–2022. [Google Scholar] [CrossRef]
  61. Hermes-Lima, M. Oxygen in biology and biochemistry: Role of free radicals. Funct. Metab. Regul. Adapt. 2004, 30, 319–368. [Google Scholar]
  62. Palomero, T.; Lim, W.K.; Odom, D.T.; Sulis, M.L.; Real, P.J.; Margolin, A.; Ferrando, A.A. Notch1 directly regulates c-myc and activates a feed-forward-loop transcriptional network promoting leukemic cell growth. Proc. Natl. Acad. Sci. USA 2006, 103, 18261–18266. [Google Scholar] [CrossRef]
  63. Luschka, V.I. Contaminant-induced oxidative stress in fish: A mechanistic approach. Fish Physiol. Biochem. 2016, 42, 711–747. [Google Scholar]
  64. Salazar-Coria, L.; Rocha-Gomez, M.A.; Matadamas-Martinez, F.; Yepez-Mulia, L.; Vega-Lopez, A. Proteomic analysis of oxidized proteins in the brain and liver of the nile tilapia (Oreochromis niloticus) exposed to a water-accommodated fraction of maya crude oil. Ecotoxicol. Environ. Saf. 2019, 171, 609–620. [Google Scholar] [CrossRef] [PubMed]
  65. Mourente, G.; Bell, J.G.; Tocher, D.R. Does dietary tocopherol level affect fatty acid metabolism in fish. Fish. Physiol. Biochem. 2007, 33, 269–280. [Google Scholar] [CrossRef]
  66. Wang, L.; Ma, B.; Chen, D. Effect of dietary level of vitamin E on growth performance, antioxidant ability, and resistance to Vibrio alginolyticus challenge in yellow drum Nibea albiflora. Aquaculture 2019, 507, 119–125. [Google Scholar] [CrossRef]
  67. Huang, Q.C.; Zhang, S.; Du, T. Effects of dietary vitamin E on growth, immunity and oxidation resistance related to the Nrf2/Keap1 signalling pathway in juvenile Sillago sihama. Anim. Feed Sci. Technol. 2020, 262, 114403. [Google Scholar] [CrossRef]
  68. Abd El-Gawad, E.A.; Abd El-latif, A.M.; Amin, A.A.; Abd-El-Azem, M.A. Effect of dietary fructooligosaccharide on bacterial Infection, oxidative stress and histopathological alterations in Nile tilapia (Oreochromis niloticus). Glob. Vet. 2015, 15, 339–350. [Google Scholar]
  69. Zuo, R.; Mai, K.; Xu, W. Dietary ALA, but not LNA, increase growth, reduce inflammatory processes, and increase anti-oxidant capacity in the marine finfish larimichthys crocea: Dietary ALA, but not LNA, increase growth, reduce inflammatory processes, and increase anti-oxidant capacity in the large yellow croaker. Lipids 2015, 50, 149–163. [Google Scholar]
  70. Garófolo, A.; Petrilli, A.S. Omega-3 and 6 fatty acids balance in inflammatory response in patients with cancer and cachexia. Rev. Nutr. Camp. 2006, 19, 611–621. [Google Scholar] [CrossRef]
  71. Ruan, K.H.; Cervantes, V.; So, S.P. Engineering of a novel hybrid enzyme: An anti-inflammatory drug target with triple catalytic activities directly converting arachidonic acid into the inflammatory prostaglandin E2. Protein Eng. Des. Sel. 2009, 22, 733–740. [Google Scholar] [CrossRef] [PubMed]
  72. Du, Z.Y.; Ma, T.; Winterthun, S. β-oxidation modulates metabolic competition between eicosapentaenoic acid and arachidonic acid regulating prostaglandin E2 synthesis in rat hepatocytes—Kupffer cells. BBA-Mol. Cell. Biol. Liplids 2010, 1801, 526–536. [Google Scholar] [CrossRef]
  73. Song, C.Y.; Liu, B.; Xu, P. Oxidized fish oil injury stress in Megalobrama amblycephala: Evaluated by growth, intestinal physiology, and transcriptome-based PI3K-Akt/NF-κB/TCR inflammatory signaling. Fish. Shellfish Immunol. 2018, 81, 446–455. [Google Scholar] [CrossRef] [PubMed]
  74. Wang, J.; Zhang, Q.; Zhang, Z. Potential antioxidant and anticoagulant capacity of low molecular weight fucoidan fractions extracted from Laminaria japonica. Int. J. Biol. Macromol. 2010, 46, 6–12. [Google Scholar] [CrossRef] [PubMed]
  75. Xue, C.H.; Fang, Y.; Lin, H. Chemical characters and antioxidative properties of sulfated polysaccharides from laminaria japonica. J. Appl. Phycol. 2001, 13, 67–70. [Google Scholar] [CrossRef]
  76. Mei, C.H.; Zhou, S.C.; Zhu, L. Antitumor effects of laminaria extract fucoxanthin on lung cancer. Mar. Drugs 2017, 15, 39. [Google Scholar] [CrossRef] [PubMed]
  77. Shen, C.H.; Gu, Y.; Zhang, C.X. Metabolomic approach for characterization of polyphenolic compounds in laminaria japonica, undaria pinnatifida, sargassum fusiforme and ascophyllum nodosum. Foods 2021, 10, 192. [Google Scholar] [CrossRef] [PubMed]
  78. Porsby, C.H.; Nielsen, K.F.; Gram, L. Phaeobacter and Ruegeria species of the Roseobacter clade colonize separate niches in a danish turbot (Scophthalmus maximus)-rearing farm and antagonize Vibrio anguillarum under different growth conditions. Appl. Environ. Microbiol. 2008, 74, 7356–7364. [Google Scholar] [CrossRef]
  79. Hoyles LM Cartney, A.L. What do we mean when we refer to Bacteroidetes populations in the human gastrointestinal microbiota? FEMS Microbiol. Lett. 2009, 299, 175–183. [Google Scholar] [CrossRef]
  80. Liu, G.; Luo, X.; Zhao, X. Gut microbiota correlates with fiber and apparent nutrients digestion in goose. Poult. Sci. 2018, 97, 3899–3909. [Google Scholar] [CrossRef]
  81. Nardone, G.; Compare, D.; Rocco, A. A microbiota-centric view of diseases of the upper gastrointestinal tract. Lancet Gastroenterol. Hepatol. 2017, 2, 298–312. [Google Scholar] [CrossRef] [PubMed]
  82. Olivares, M.; Neef, A.; Castillejo, G. The HLA-DQ2 genotype selects for early intestinal microbiota composition in infants at high risk of developing coeliac disease. Gut 2014, 64, 406–417. [Google Scholar] [CrossRef] [PubMed]
Biology 12 01523 g001
Figure 1. Regression analysis based on WGR.
Figure 1. Regression analysis based on WGR.
Biology 12 01523 g001
Biology 12 01523 g002
Figure 2. Regression analysis based on digestive enzyme activities.
Figure 2. Regression analysis based on digestive enzyme activities.
Biology 12 01523 g002
Biology 12 01523 g003aBiology 12 01523 g003b
Figure 3. Effects of dietary vitamin E on the intestinal immune-related gene expression of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 6). Bars with different letters indicate that the means are significantly different at p < 0.05. HD: fresh kelp.
Figure 3. Effects of dietary vitamin E on the intestinal immune-related gene expression of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 6). Bars with different letters indicate that the means are significantly different at p < 0.05. HD: fresh kelp.
Biology 12 01523 g003aBiology 12 01523 g003b
Biology 12 01523 g004
Figure 4. Relative abundance of the intestinal microbiota at the phylum level of sea urchin (Strongylocentrotus intermedius) fed different diets (standardized to 18S rRNA) (mean ± SEM, n = 6). HD: fresh kelp.
Figure 4. Relative abundance of the intestinal microbiota at the phylum level of sea urchin (Strongylocentrotus intermedius) fed different diets (standardized to 18S rRNA) (mean ± SEM, n = 6). HD: fresh kelp.
Biology 12 01523 g004
Biology 12 01523 g005
Figure 5. Relative abundance of the intestinal microbiota at the genus level of sea urchin (Strongylocentrotus intermedius) fed different diets (standardized to 18S rRNA) (mean ± SEM, n = 6). HD: fresh kelp.
Figure 5. Relative abundance of the intestinal microbiota at the genus level of sea urchin (Strongylocentrotus intermedius) fed different diets (standardized to 18S rRNA) (mean ± SEM, n = 6). HD: fresh kelp.
Biology 12 01523 g005
Table 1. Formulation and approximate composition of the experimental feeds (% dry diet).
Table 1. Formulation and approximate composition of the experimental feeds (% dry diet).
Ingredients (%)Experimental Feeds
E78E105E152E235E302E390
Fish meal9.009.009.009.009.009.00
Soybean meal a17.0017.0017.0017.0017.0017.00
Seaweed meal2.002.002.002.002.002.00
Ruppiaceae8.008.008.008.008.008.00
Wheat bran b11.2011.2011.2011.2011.2011.20
Wheat meal c29.5029.4929.4829.4729.4629.45
Shell powder6.006.006.006.006.006.00
Gelatin5.005.005.005.005.005.00
Vitamin E acetate0.000.010.020.030.040.05
Mineral premix d2.002.002.002.002.002.00
Calcium propionate0.100.100.100.100.100.10
Betaine0.100.100.100.100.100.10
Glycine0.100.100.100.100.100.10
Fish oil8.008.008.008.008.008.00
Soybean lecithin2.002.002.002.002.002.00
Approximate analysis
Crude lipid12.2412.2212.2212.2112.2012.23
Crude protein25.7925.8425.8725.8425.8525.82
Vitamin E (mg/kg)77.86105.27151.55235.01302.43390.67
a Soybean meal: crude protein 49.4%, crude lipid 0.9%; b Wheat bran: crude protein 15.8%, crude lipid 4.0%; c Wheat meal: crude protein 16.4%, crude lipid 1.0%. d Mineral premix (mg or g kg−1 diet): CuSO4·5H2O, 10 mg; Na2SeO3 (1%), 25 mg; ZnSO4·H2O, 50 mg; CoCl2·6H2O (1%), 50 mg; MnSO4·H2O, 60 mg; FeSO4·H2O, 80 mg; Ca (IO3)2, 180 mg; MgSO4·7H2O, 1200 mg; zeolite, 18.35 g.
Table 2. Real-time quantitative PCR primers used in the present study 1.
Table 2. Real-time quantitative PCR primers used in the present study 1.
GeneSequence (5′–3′)Reference
18SF: GTTCGAAGGCGATCAGATAC
R: CTGTCAATCCTCACTGTGTC		Zhou et al. [37].
COX-2F: GAGGTGGATAACCGATTGA
R: AGCATTGCCCATAGAACAG		MH516324
NLR-6F: GTTCAGGGAGAGGCAGG
R: CATGGGCGAGTGGTCAC		Chen et al. [38]
TLRF: TCAAATGGAGCCCGTATGTAGAG
R: CTAATGTCCCCTGCTCTGCCA		Wang et al. [39]
GPXF: CGAGTTTGAGAAGCGTGGTG
R: GGATCAGCTATGATTGGGTATGG		Ding et al. [40]
GSTF: CTCGGAGATTCGCTCACCA
R: GCTGGCTGGAGAAATGAACAA		Ding et al. [41]
HSP70F: ACACTCATCTCGGAGGAG
R: CTTTCTTATGCTTTCGCTTGA		Bai et al. [41]
185/333-1F: GCTCTTGCTATCTCGGCTCAC
R: AAGCGACCTTGTCCTCTCTCTCT		Wang et al. [42]
LYZF: GAGACGGTACAGGGCTACA
R: CGGGCAAAATCCTCACAAG		Ji et al. [43]
AIF-1F: TCGAACGTGCAAGGTGGCAAG
R: CGTCATTGTCATCGAGGTCTCCAC		MH516330
TNF-αF: GCTGTAACGGCGTTCGTCTCC
R: TGGTGTACTTGTGCTGGTTGTTGG		MH516331
1 Cyclooxygenase-2 (COX-2), nucleotide-binding domain leucine-rich repeat 6 (NLR6), toll-like receptor (TLR), glutathione peroxidase (GPX), glutathione S transferase (GST), heat shock protein 70 (HSP70), lysozyme (LYZ), allograft inflammatory factor-1 (AIF-1), tumor necrosis factor α (TNF-α).
Table 3. Growth performance of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 6) 1.
Table 3. Growth performance of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 6) 1.
IndexDietary Treatments
E78E105E152E235E302E390HD
Wi (g)3.66 ± 0.093.66 ± 0.253.97 ± 0.183.56 ± 0.153.90 ± 0.603.53 ± 0.093.98 ± 0.27
Wf (g)19.83 ± 0.80 b20.86 ± 1.35 ab21.57 ± 1.22 ab20.10 ± 1.27 ab21.78 ± 1.21 ab22.18 ± 1.10 ab24.17 ± 1.87 a
WGR (%)335.1 ± 26.7 b380.1 ± 38.6 ab408.8 ± 38.0 ab409.1 ± 35.7 ab419.9 ± 34.0 ab395.6 ± 14.6 ab475.1 ± 54.9 a
GM (g)2.97 ± 0.11 ab3.17 ± 0.37 a3.28 ± 0.20 a3.02 ± 0.25 ab3.26 ± 0.36 a2.64 ± 0.72 ab2.24 ± 0.25 b
GSI (%)15.21 ± 0.36 a14.42 ± 0.90 a14.61 ± 0.61 a15.36 ± 0.37 a15.83 ± 0.56 a14.41 ± 0.26 a8.67 ± 0.56 b
DM (g)1.15 ± 0.08 b1.39 ± 0.12 b1.21 ± 0.13 b1.11 ± 0.12 b1.32 ± 0.17 b1.12 ± 0.09 b1.81 ± 0.22 a
DTI (%)5.80 ± 0.34 bc6.70 ± 0.18 a6.31 ± 0.33 bc6.04 ± 0.44 bc5.91 ± 0.30 bc5.55 ± 0.71 c7.62 ± 0.44 a
1 Mean values with different superscript letters within the same row are significantly different at p < 0.05. Fresh kelp (HD), initial body weight (Wi), final body weight (Wf), weight growth rate (WGR), gonad mass (GM), gonadosomatic index (GSI), digestive tract mass (DM), digestive tract index (DTI).
Table 4. Digestive enzymes in the digestive tract of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 6) 1.
Table 4. Digestive enzymes in the digestive tract of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 6) 1.
IndexDietary Treatments
E78E105E152E235E302E390HD
Pepsin (U/mg prot)6.42 ± 0.33 a6.75 ± 0.20 a5.90 ± 0.21 a7.00 ± 0.33 a7.42 ± 0.91 a3.91 ± 0.55 b7.13 ± 0.57 a
Lipase (U/g prot)5.99 ± 0.34 abc6.12 ± 0.19 abc6.23 ± 0.37 ab6.82 ± 0.20 a5.01 ± 0.44 cd4.63 ± 0.64 d5.58 ± 0.25 bcd
Amylase (U/mg prot)3.61 ± 0.50 bc4.54 ± 0.97 ab5.04 ± 0.59 ab5.87 ± 0.52 a3.77 ± 0.49 bc3.28 ± 0.23 bc2.72 ± 0.60 c
Cellulase (U/mg prot)18.83 ± 2.78 ab23.31 ± 0.48 a15.74 ± 0.96 bc15.79 ± 2.46 bc15.23 ± 1.84 bc11.35 ± 1.33 c22.13 ± 2.47 a
1 Mean values with different superscript letters within the same row are significantly different at p < 0.05. Fresh kelp (HD).
Table 5. Immune- and antioxidation-related parameters in the coelomic fluid of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 5) 1.
Table 5. Immune- and antioxidation-related parameters in the coelomic fluid of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 5) 1.
IndexDietary Treatments
E78E105E152E235E302E390HD
LYZ (U/mL)168.54 ± 29.00 a129.59 ± 16.93 a112.35 ± 1.98 ab163.29 ± 23.94 a154.49 ± 9.05 a155.06 ± 31.19 a57.98 ± 7.96 c
AKP (U/100 mL)1.27 ± 0.24 a0.81 ± 0.12 bc0.64 ± 0.12 bc0.99 ± 0.11 ab0.65 ± 0.31 bc0.66 ± 0.08 bc0.41 ± 0.03 c
ACP (U/100 mL)3.06 ± 0.36 a1.52 ± 0.18 bc1.07 ± 0.02 bc2.29 ± 0.13 ab1.96 ± 0.44 ab1.99 ± 0.62 ab0.64 ± 0.05 d
SOD (U/mL)57.27 ± 2.81 a47.96 ± 2.50 b47.46 ± 2.16 b53.85 ± 1.79 ab48.27 ± 1.11 b48.40 ± 2.11 b53.45 ± 0.50 ab
CAT (U/mL)0.80 ± 0.03 a0.51 ± 0.08 bc0.36 ± 0.00 d0.39 ± 0.05 cd0.62 ± 0.03 b0.55 ± 0.02 b0.63 ± 0.05 ab
GST (U/mL)12.70 ± 0.28 a8.61 ± 1.72 b3.12 ± 0.18 c7.33 ± 0.64 b7.64 ± 0.37 b8.85 ± 0.58 b11.92 ± 0.38 a
GPX (U/mL)24.74 ± 1.47 a19.71 ± 1.23 b14.89 ± 1.15 c21.60 ± 0.76 ab21.71 ± 0.39 ab22.79 ± 0.58 ab23.79 ± 0.52 a
MDA (nmol/mL)0.64 ± 0.09 b0.47 ± 0.02 bc0.61 ± 0.04 b0.90 ± 0.06 a0.53 ± 0.03 b0.55 ± 0.03 b0.33 ± 0.07 c
1 Mean values with different superscript letters within the same row are significantly different at p < 0.05. Fresh kelp (HD), lysozyme (LYZ), alkaline phosphatase (AKP), acid phosphatase (ACP), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX), glutathione S-transferase (GST), and the content of malondialdehyde (MDA).
Table 6. Relative abundance of the intestinal microbiota at the phylum level of sea urchin (Strongylocentrotus intermedius) in response to different dietary treatments (mean ± SEM, n = 3) 1.
Table 6. Relative abundance of the intestinal microbiota at the phylum level of sea urchin (Strongylocentrotus intermedius) in response to different dietary treatments (mean ± SEM, n = 3) 1.
PhylumDietary Treatments
E78E152E390HD
Proteobacteria0.31 ± 0.01 b0.71 ± 0.03 a0.71 ± 0.05 a0.75 ± 0.01 a
Firmicutes0.32 ± 0.01 a0.08 ± 0.02 b0.07 ± 0.00 b0.09 ± 0.02 b
Actinobacteria0.10 ± 0.03 ab0.08 ± 0.02 ab0.12 ± 0.03 a0.06 ± 0.00 b
Bacteroidetes0.18 ± 0.01 a0.03 ± 0.01 b0.02 ± 0.00 b0.04 ± 0.00 b
Firmicutes/Bacteroidetes1.88 ± 0.18 b3.37 ± 0.20 ab4.14 ± 0.81 a2.48 ± 0.51 ab
1 Mean values with different superscript letters within the same row are significantly different at p < 0.05. HD: fresh kelp.
Table 7. Relative abundance of the intestinal microbiota at the genus level of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 3) 1.
Table 7. Relative abundance of the intestinal microbiota at the genus level of sea urchin (Strongylocentrotus intermedius) fed different diets (mean ± SEM, n = 3) 1.
GenusDietary Treatments
E78E152E390HD
Ruegeria0.02 ± 0.00 c0.35 ± 0.03 b0.42 ± 0.01 a0.47 ± 0.01 a
Phaeobacter0.01 ± 0.00 c0.14 ± 0.03 a0.08 ± 0.01 b0.09 ± 0.01 b
Rhodococcus0.07 ± 0.01 a0.05 ± 0.00 b0.07 ± 0.00 a0.04 ± 0.00 b
Maliponia0.00 ± 0.00 b0.08 ± 0.02 a0.12 ± 0.01 a0.02 ± 0.01 b
Escherichia-Shigella0.17 ± 0.01 a0.01 ± 0.00 b0.01 ± 0.00 b0.01 ± 0.00 b
Bacteroides0.12 ± 0.01 a0.01 ± 0.00 b0.01 ± 0.00 b0.01 ± 0.00 b
Clostridium sensu stricto10.06 ± 0.00 a0.01 ± 0.00 b0.00 ± 0.00 b0.00 ± 0.00 b
1 Mean values with different superscript letters within the same row are significantly different at p < 0.05. HD: fresh kelp.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, M.; Gou, D.; Gong, P.; Di, W.; Wang, L.; Ding, J.; Chang, Y.; Zuo, R. An Investigation on the Effects of Dietary Vitamin E on Juvenile Sea Urchin (Strongylocentrotus intermedius): Growth, Intestinal Microbiota, Immune Response, and Related Gene Expression. Biology 2023, 12, 1523. https://0-doi-org.brum.beds.ac.uk/10.3390/biology12121523

AMA Style

Li M, Gou D, Gong P, Di W, Wang L, Ding J, Chang Y, Zuo R. An Investigation on the Effects of Dietary Vitamin E on Juvenile Sea Urchin (Strongylocentrotus intermedius): Growth, Intestinal Microbiota, Immune Response, and Related Gene Expression. Biology. 2023; 12(12):1523. https://0-doi-org.brum.beds.ac.uk/10.3390/biology12121523

Chicago/Turabian Style

Li, Min, Dan Gou, Panke Gong, Weixiao Di, Lina Wang, Jun Ding, Yaqing Chang, and Rantao Zuo. 2023. "An Investigation on the Effects of Dietary Vitamin E on Juvenile Sea Urchin (Strongylocentrotus intermedius): Growth, Intestinal Microbiota, Immune Response, and Related Gene Expression" Biology 12, no. 12: 1523. https://0-doi-org.brum.beds.ac.uk/10.3390/biology12121523

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop