Phylogenetic Analysis of Rare and Endangered Tulipa Species (Liliaceae) of Kazakhstan Based on Universal Barcoding Markers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Single-Nucleotide Polymorphisms of the ITS, rbcL, and matK DNA Sequences in Tulipa
2.2. Nuclear rDNA Phylogeny
2.3. Chloroplast Genome Phylogeny
2.4. Combined, rbcL, psbA-trnH, matK, and ITS Data Set of 8 Species of Kazakhstan Tulips
3. Discussion
3.1. Incongruent Placement of T. patens in nrDNA and cpDNA Phylogenies
3.2. Placement of T. kaufmanniana in Section Vinistriatae (Raamsd.) Zonn
3.3. Using a Combined Data Set to Optimize Phylogenetic Analysis
4. Materials and Methods
4.1. Sample Collection and Data Acquisition
4.2. DNA Isolation, Amplification, and Sequencing
4.3. Data Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Christenhusz, M.; Govaerts, R.; David, J.; Hall, T.; Borland, K.; Roberts, P.; Tuomisto, A.; Buerki, S.; Chase, M.; Fay, M. Tiptoe through the tulips—Cultural history, molecular phylogenetics and classification of Tulipa (Liliaceae). Bot. J. Linn. Soc. 2013, 172, 280–328. [Google Scholar] [CrossRef]
- Zonneveld, B.J.M.; de Groot, J.J. Tulipa kolbintsevii Zonn., a new species from Eastern Kazakhstan. Plant Syst. Evol. 2012, 298, 1293–1296. [Google Scholar] [CrossRef]
- Botschantzeva, Z.P. Tulips: Taxonomy, Morphology, Cytology, Phytogeography and Physiology; A.A. Balkema: Rotterdam, The Netherlands, 1982. [Google Scholar]
- Wilson, B.; Dolotbakov, A.; Burgess, B.J.; Clubbe, C.; Lazkov, G.; Shalpykov, K.; Ganybaeva, M.; Sultangaziev, O.; Brockington, S.F. Central Asian wild tulip conservation requires a regional approach, especially in the face of climate change. Biodivers. Conserv. 2021, 30, 1705–1730. [Google Scholar] [CrossRef]
- Nikitina, E.V.; Karimov, I.; Savina, N.V.; Kubrak, S.V.; Kilchevsky, A.V. Inventory of some Tulipa species from Uzbekistan using DNA barcoding. BIO Web Conf. 2021, 38, 00086. [Google Scholar] [CrossRef]
- Kiran, Y.; Dogan, G.; Demirkan, Z. Karyotype Analysis of Tulipa pulchella (Liliaceae) (Fenzl ex Regel) Baker. Nat. Sci. Discov. 2016, 2, 62–67. [Google Scholar] [CrossRef]
- Vvedensky, A.I.; Kovalevskaja, S.S. Tulipa L. In Conspectus Florae Asiae Mediae; Academy of Sciences Press: Tashkent, Uzbekistan, 1971; Volume 2, pp. 94–109. [Google Scholar]
- Baitulin, I.O. The Red Data Book of Kazakhstan: Plants; Institute of Botany and Phytointroduction: Astana, Kazakhstan, 2014; Volume 2. [Google Scholar]
- Silkadv. “Silk Road Adventures” Information Resource. Available online: https://silkadv.com/en/content/tulipa-greigii (accessed on 26 February 2024).
- Davron, D.; Temur, A.; Umida, T.; Sari, I.; Komiljon, T.S. Suitable habitat prediction with a huge set of variables on some Central Asian tulips. J. Asia-Pac. Biodivers. 2023, 16, 75–82. [Google Scholar] [CrossRef]
- Kress, W.J.; Erickson, D.L. DNA barcodes: Genes, genomics, and bioinformatics. Proc. Natl. Acad. Sci. USA 2008, 105, 2761–2762. [Google Scholar] [CrossRef]
- Gill, B.A.; Musili, P.M.; Kurukura, S.; Hassan, A.A.; Goheen, J.R.; Kress, W.J.; Kuzmina, M.; Pringle, R.M.; Kartzinel, T.R. Plant DNA-barcode library and community phylogeny for a semi-arid East African savanna. Mol. Ecol. Resour. 2019, 19, 838–846. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xiao, W.; Tong, T.; Li, Y.; Zhang, M.; Lin, X.; Zou, X.; Wu, Q.; Guo, X. The specific DNA barcodes based on chloroplast genes for species identification of Orchidaceae plants. Sci. Rep. 2021, 11, 1424. [Google Scholar] [CrossRef] [PubMed]
- Sarwat, M.; Yamdagni, M.M. DNA barcoding, microarrays and next generation sequencing: Recent tools for genetic diversity estimation and authentication of medicinal plants. Crit. Rev. Biotechnol. 2016, 36, 191–203. [Google Scholar] [CrossRef] [PubMed]
- Yue, H.; Yan, C.; Tu, F.; Yang, C.; Ma, W.; Fan, Z.; Song, Z.; Owens, J.; Liu, S.; Zhang, X. Two novel mitogenomes of Dipodidae species and phylogeny of Rodentia inferred from the complete mitogenomes. Biochem. Syst. Ecol. 2015, 60, 123–130. [Google Scholar] [CrossRef]
- Bezeng, B.S.; Davies, T.J.; Daru, B.H.; Kabongo, R.M.; Maurin, O.; Yessoufou, K.; van der Bank, H.; van der Bank, M. Ten years of barcoding at the African Centre for DNA Barcoding. Genome 2017, 60, 629–638. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in the use of DNA barcodes in the identification and classification of medicinal plants. Ecotoxicol. Environ. Saf. 2021, 208, 111691. [Google Scholar] [CrossRef] [PubMed]
- CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.Z.; Li, Z.Y.; Jin, X.H. DNA barcoding of invasive plants in China: A resource for identifying invasive plants. Mol. Ecol. Resour. 2018, 18, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Thakur, V.V.; Tripathi, N.; Tiwari, S. DNA barcoding of some medicinally important plant species of Lamiaceae family in India. Mol. Biol. Rep. 2021, 48, 3097–3106. [Google Scholar] [CrossRef] [PubMed]
- Hashim, A.M.; Alatawi, A.; Altaf, F.M.; Qari, S.H.; Elhady, M.E.; Osman, G.H.; Abouseadaa, H.H. Phylogenetic relationships and DNA barcoding of nine endangered medicinal plant species endemic to Saint Katherine protectorate. Saudi J. Biol. Sci. 2021, 28, 1919–1930. [Google Scholar] [CrossRef] [PubMed]
- Raskoti, B.B.; Ale, R. DNA barcoding of medicinal orchids in Asia. Sci. Rep. 2021, 11, 23651. [Google Scholar] [CrossRef] [PubMed]
- Veldman, S.; Ju, Y.; Otieno, J.N.; Abihudi, S.; Posthouwer, C.; Gravendeel, B.; van Andel, T.R.; de Boer, H.J. DNA barcoding augments conventional methods for identification of medicinal plant species traded at Tanzanian markets. J. Ethnopharmacol. 2020, 250, 112495. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Li, X.W.; Liao, B.S.; Luo, L.; Ren, Y.Y. Species identification of poisonous medicinal plant using DNA barcoding. Chin. J. Nat. Med. 2019, 17, 585–590. [Google Scholar] [CrossRef] [PubMed]
- Kress, W.J. Plant DNA barcodes: Applications today and in the future. J. Syst. Evol. 2017, 55, 291–307. [Google Scholar] [CrossRef]
- Chen, S.; Yin, X.; Han, J.; Sun, W.; Yao, H.; Song, J.; Li, X. DNA barcoding in herbal medicine: Retrospective and prospective. J. Pharm. Anal. 2023, 13, 431–441. [Google Scholar] [CrossRef]
- Vasconcelos, S.; Nunes, G.L.; Dias, M.C.; Lorena, J.; Oliveira, R.R.M.; Lima, T.G.L.; Pires, E.S.; Valadares, R.B.S.; Alves, R.; Watanabe, M.T.C.; et al. Unraveling the plant diversity of the Amazonian canga through DNA barcoding. Ecol. Evol. 2021, 11, 13348–13362. [Google Scholar] [CrossRef]
- Jones, L.; Twyford, A.D.; Ford, C.R.; Rich, T.C.G.; Davies, H.; Forrest, L.L.; Hart, M.L.; McHaffie, H.; Brown, M.R.; Hollingsworth, P.M.; et al. Barcode UK: A complete DNA barcoding resource for the flowering plants and conifers of the United Kingdom. Mol. Ecol. Resour. 2021, 21, 2050–2062. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, M.; Chen, X.; Chen, X.; Hu, Y.; Gao, J.; Pan, W.; Xin, Y.; Wu, J.; Du, Y.; et al. Developing an efficient DNA barcoding system to differentiate between Lilium species. BMC Plant Biol. 2021, 21, 465. [Google Scholar] [CrossRef]
- Ju, X.; Shi, G.; Hou, Z.; Wu, C.; Liu, G.; Cao, C.; Tang, N. Characterization of the complete chloroplast genome of Tulipa iliensis (Liliaceae). Mitochondrial DNA 2020, 5, 2362–2363. [Google Scholar] [CrossRef]
- Ju, X.; Shi, G.; Chen, S.; Dai, W.; He, T. Characterization and phylogenetic analysis of the complete chloroplast genome of Tulipa patens (Liliaceae). Mitochondrial DNA 2021, 6, 2750–2751. [Google Scholar] [CrossRef]
- Sarsen, A.; Saginova, M.; Akishev, Z.; Aktayeva, S.; Manabayeva, S.; Khassenov, B. Molecular phylogenetic analysis of Tulipa (Liliaceae) from Aksu-Zhabagly Nature Reserve. Plant Sci. Today 2023, 10, 302–309. [Google Scholar] [CrossRef]
- Ma, H.-L.; Zhu, Z.-B.; Zhang, X.-M.; Miao, Y.-Y.; Guo, Q.-S. Species identification of the medicinal plant Tulipa edulis (Liliaceae) by DNA barcode marker. Biochem. Syst. Ecol. 2014, 55, 362–368. [Google Scholar] [CrossRef]
- Turktas, M.; Metin, Ö.K.; Baştuğ, B.; Ertuğrul, F.; Saraç, Y.I.; Kaya, E. Molecular phylogenetic analysis of Tulipa (Liliaceae) based on noncoding plastid and nuclear DNA sequences with an emphasis on Turkey. Bot. J. Linn. Soc. 2013, 172, 270–279. [Google Scholar] [CrossRef]
- Shahin, A.; van Kaauwen, M.; Esselink, D.; Bargsten, J.W.; van Tuyl, J.M.; Visser, R.G.; Arens, P. Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa. BMC Genom. 2012, 13, 640. [Google Scholar] [CrossRef] [PubMed]
- Hajdari, A.; Pulaj, B.; Schmiderer, C.; Mala, X.; Wilson, B.; Lluga-Rizani, K.; Mustafa, B. A phylogenetic analysis of the wild Tulipa species (Liliaceae) of Kosovo based on plastid and nuclear DNA sequence. Adv. Genet. 2021, 2, e202100016. [Google Scholar] [CrossRef] [PubMed]
- Dekhkonov, D.; Tojibaev, K.S.; Makhmudjanov, D.; Na, N.-R.; Baasanmunkh, S.; Yusupov, Z.; Choi, H.J.; Jang, C.-G. Mapping and analyzing the distribution of the species in the genus Tulipa (Liliaceae) in the Ferghana Valley of Central Asia. Korean J. Plant Taxon. 2021, 51, 181–191. [Google Scholar] [CrossRef]
- Barrett, R.A.; Bayly, M.J.; Duretto, M.F.; Forster, P.I.; Ladiges, P.Y.; Cantrill, D.J. Phylogenetic analysis of Zieria (Rutaceae) in Australia and New Caledonia based on nuclear ribosomal DNA shows species polyphyly, divergent paralogues and incongruence with chloroplast DNA. Aust. Syst. Bot. 2018, 31, 16–47. [Google Scholar] [CrossRef]
- Bayly, M.J.; Ladiges, P.Y. Divergent paralogues of ribosomal DNA in eucalypts (Myrtaceae). Mol. Phylogenetics Evol. 2007, 44, 346–356. [Google Scholar] [CrossRef] [PubMed]
- Bailey, C.D.; Carr, T.G.; Harris, S.A.; Hughes, C.E. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Mol. Phylogenetics Evol. 2003, 29, 435–455. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, I.; Wendel, J.F. Ribosomal ITS sequences and plant phylogenetic inference. Mol. Phylogenetics Evol. 2003, 29, 417–434. [Google Scholar] [CrossRef] [PubMed]
- Baldwin, B.G.; Sanderson, M.J.; Porter, J.M.; Wojciechowski, M.F.; Campbell, C.S.; Donoghue, M.J. The its Region of Nuclear Ribosomal DNA: A Valuable Source of Evidence on Angiosperm Phylogeny. Ann. Mo. Bot. Gard. 1995, 82, 247–277. [Google Scholar] [CrossRef]
- Guy, D.; Hanane, D.; Junnan, X. Relative rates of synonymous substitutions in the mitochondrial, chloroplast and nuclear genomes of seed plants. Mol. Phylogenetics Evol. 2008, 49, 827–831. [Google Scholar] [CrossRef]
- Schultz, J.; Müller, T.; Achtziger, M.; Seibel, P.N.; Dandekar, T.; Wolf, M. The internal transcribed spacer 2 database—A web server for (not only) low level phylogenetic analyses. Nucleic Acids Res. 2006, 34, W704–W707. [Google Scholar] [CrossRef] [PubMed]
- Feliner, G.N.; Rosselló, J.A. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mol. Phylogenetics Evol. 2007, 44, 911–919. [Google Scholar] [CrossRef] [PubMed]
- PlantNet. Plant Identification and Information Website. Available online: https://plantnet.org/en/ (accessed on 26 February 2024).
- Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Zhang, C.Y.; Wang, F.Y.; Yan, H.F.; Hao, G.; Hu, C.M.; Ge, X.J. Testing DNA barcoding in closely related groups of Lysimachia L. (Myrsinaceae). Mol. Ecol. Resour. 2012, 12, 98–108. [Google Scholar] [CrossRef]
- Kuzmina, M.L.; Johnson, K.L.; Barron, H.R.; Hebert, P.D. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library. BMC Ecol. 2012, 12, 25. [Google Scholar] [CrossRef]
- Parmentier, I.; Duminil, J.; Kuzmina, M.; Philippe, M.; Thomas, D.W.; Kenfack, D.; Chuyong, G.B.; Cruaud, C.; Hardy, O.J. How effective are DNA barcodes in the identification of African rainforest trees? PLoS ONE 2013, 8, e54921. [Google Scholar] [CrossRef]
- Khan, A.M.; Bhadauria, S. Molecular characterization of keratin degrading fungi isolated from semi-arid soil by PCR using ITS4 and ITS5 primers. J. King Saud Univ. -Sci. 2019, 31, 1418–1423. [Google Scholar] [CrossRef]
- Lu, G.; Moriyama, E.; Lu, G.; Moriyama, E.N. Vector NTI, a balanced all-in-one sequence analysis suite. Brief. Bioinform. 2005, 5, 378–388. [Google Scholar] [CrossRef] [PubMed]
- BLAST (Basic Local Alignment Search Tool) is a Bioinformatics Tool Provided by the National Center for Biotechnology Information (NCBI) for Comparing a Query Sequence against a Database to Find Regions of Similarity. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 26 February 2024).
- GenBank is the NIH Genetic Sequence Database, an Annotated Collection of All Publicly Available DNA Sequences. Available online: https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/genbank/ (accessed on 26 February 2024).
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Alzohairy, A. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
- Nylander, J. MrModeltest, version 2. Program Distributed by the Author. Bioinformatics 2004, 24, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Clowes, C.; Fowler, R.; Fahey, P.; Kellermann, J.; Brown, G.; Bayly, M. Phylogeography and classification of Dusty Miller (Spyridium parvifolium; Rhamnaceae): A morphologically variable shrub from south-east Australia. Plant Syst. Evol. 2023, 309, 15. [Google Scholar] [CrossRef]
- Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef] [PubMed]
Species | Sequence ID | Coordinates | Altitude | Source | Collection Date | rbcL | trnH-psbA | matK | ITS |
---|---|---|---|---|---|---|---|---|---|
Subg. Tulipa T. greigii | T. greigii A-Zh KZ* | 42.2039 N, 70.2529 E | 1830 m. | Aksu-Zhabagly Nature State Reserve | 14-May-2021 | ON010708 (583 bp) | ON423208 (464 bp) | ON423211 (732 bp) | OP279724 (727 bp) |
Subg. Tulipa, T. kaufmanniana | T. kaufmanniana A-Zh KZ* | 42.205 N, 70.289 E | 2050 m. | Aksu-Zhabagly Nature State Reserve | 14-May-2021 | ON186589 (582 bp) | ON423207 (481 bp) | ON952472 (693 bp) | OP279725 (725 bp) |
Subg. Eriostemones T. turkestanica | T. turkestanica A-Zh KZ* | 42.2550 N, 70.2247 E | 1340 m. | Aksu-Zhabagly Nature State Reserve | 14-May-2021 | ON186590 (577 bp) | ON423209 (449 bp) | ON952473 (678 bp) | OP279723 (744 bp) |
Subg. Eriostemones T. bifloriformis | T. bifloriformis A-Zh KZ* | 42.2334 N, 70.3713 E | 1960 m. | Aksu-Zhabagly Nature State Reserve | 15-May-2021 | ON186591 (582 bp) | ON423210 (492 bp) | ON952474 (598 bp) | OQ733258 (607 bp) |
Subg. Eriostemones T. patens | T. patens AKM KZ* | 51.1112 N, 66.4362 E | 272 m. | Akmola Region | 28-Apr-2021 | OP261551 (574 bp) | OQ718219 (520 bp) | OP261547 (865 bp) | OP279727 (725 bp) |
Subg. Tulipa, T. dubia | T. dubia A-Zh KZ* | 42.247 N, 70.3543 E | 1910 m. | Aksu-Zhabagly Nature State Reserve | 18-May-2021 | OP261549 (585 bp) | ON983982 (487 bp) | OQ718220 (818 bp) | OQ733267 (681 bp) |
Subg. Tulipa, T. alberti | T. alberti Karatau KZ* | 43.3816 N, 68.3746 E | 710 m. | Karatau Nature State Reserve | 16-May-2022 | OP261548 (564 bp) | ON983980 (528 bp) | OQ718218 (861 bp) | OP279728 (715 bp) |
Subg. Tulipa, T. schrenkii | T. schrenkii KOS KZ* | 50.2949 N, 65.5801 E | 660 m. | Kostanay region | 18-Aug-2022 | OP261550 (590 bp) | ON983981 (487 bp) | OP261546 (863 bp) | OP279726 (737 bp) |
Parameters | rbcL | matK | ITS |
---|---|---|---|
No. of taxa | 60 | 52 | 65 |
Alignment length (bp) | 471 | 564 | 485 |
Conserved sites | 461 | 542 | 397 |
Variable sites | 10 | 16 | 80 |
Parsimony informative sites | 5 | 6 | 64 |
Singleton sites | 5 | 10 | 16 |
Overall nucleotide divergence (Pi) | 0.002 | 0.007 | 0.05 |
G + C contents (%) | 44.6 | 34.0 | 60.0 |
Species | ITS | rbcL | matK | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
28 | 34 | 53 | 260 | 339 | 350 | 362 | 399 | 405 | 426 | 435 | 441 | 117 | 212 | 255 | 174 | 302 | 314 | |
T. greigii | T | C | A | C | T | C | - | G | T | G | T | A | C | G | A | G | A | A |
T. kaufmanniana | T | T | A | C | T | C | - | G | T | G | T | A | C | G | A | G | A | A |
T. turkestanica | C | T | G | C | T | A | G | G | T | G | A | G | T | A | A | G | G | A |
T. bifloriformis | C | T | G | C | C | A | G | G | T | G | A | G | T | A | G | G | G | A |
T. patens | T | T | A | T | T | C | - | G | T | A | T | A | C | G | A | G | A | A |
T. dubia | T | T | A | C | T | C | - | A | C | G | T | A | T | A | A | A | A | A |
T. alberti | T | T | A | T | T | C | - | G | T | A | T | A | C | G | A | G | A | A |
T. schrenkii | T | T | A | C | T | C | - | A | C | G | T | A | T | A | A | A | A | T |
Primer Name | Nucleotide Sequence of Primer (5′-3′) | Barcoding Locus | Tm (°C) |
---|---|---|---|
3F_KIMf [48] | CGTACAGTACTTTTGTGTTTACGAG | matK | 50 |
1R_KIMr [48] | ACCCCATTCATCTGGAAATCTTGGTTC | matK | 50 |
rbcLa_F [49] | ATGTCACCAACAAACAGAGACTAAAGC | rbcL | 58 |
rbcLa_R [49] | GTAAAATCAAGTCCACCRCG | rbcL | 58 |
psbA3f [50] | GTTATGCATGGTGGATTCACAATCC | trnH-psbA | 53 |
trnHf_05 [50] | CGCGCATGGTGGATTCACAATCC | trnH-psbA | 53 |
ITS4 [51] | TCCTCCGCTTATTGATATGC | ITS1 and ITS2 | 55 |
ITS5 [51] | GGAAGTAAAAGTCGTAACAAG | ITS1 and ITS2 | 55 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sutula, M.; Kakanay, A.; Tussipkan, D.; Dzhumanov, S.; Manabayeva, S. Phylogenetic Analysis of Rare and Endangered Tulipa Species (Liliaceae) of Kazakhstan Based on Universal Barcoding Markers. Biology 2024, 13, 365. https://0-doi-org.brum.beds.ac.uk/10.3390/biology13060365
Sutula M, Kakanay A, Tussipkan D, Dzhumanov S, Manabayeva S. Phylogenetic Analysis of Rare and Endangered Tulipa Species (Liliaceae) of Kazakhstan Based on Universal Barcoding Markers. Biology. 2024; 13(6):365. https://0-doi-org.brum.beds.ac.uk/10.3390/biology13060365
Chicago/Turabian StyleSutula, Maxim, Ayan Kakanay, Dilnur Tussipkan, Samatulla Dzhumanov, and Shuga Manabayeva. 2024. "Phylogenetic Analysis of Rare and Endangered Tulipa Species (Liliaceae) of Kazakhstan Based on Universal Barcoding Markers" Biology 13, no. 6: 365. https://0-doi-org.brum.beds.ac.uk/10.3390/biology13060365