Next Article in Journal
Antibodies against Phosphorylcholine—Implications for Chronic Inflammatory Diseases
Next Article in Special Issue
Maternal and Cord Blood Serum Metabolite Associations with Childhood Adiposity and Body Composition Outcomes
Previous Article in Journal
Novel Expression of GLUT3, GLUT6 and GLUT10 in Equine Gluteal Muscle Following Glycogen-Depleting Exercise: Impact of Dietary Starch and Fat
Previous Article in Special Issue
Development of a Urine Metabolomics Biomarker-Based Prediction Model for Preeclampsia during Early Pregnancy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Metabolites
Volume 13
Issue 6
10.3390/metabo13060719
metabolites-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Genetically Reduced Maternal Myostatin on Late Gestation Maternal, Fetal, and Placental Metabolomes in Mice

by
Ruth Opoku
1,
Jenna DeCata
1,
Charlotte L. Phillips
2 and
Laura C. Schulz
3,*
1
Division of Biological Sciences, University of Missouri, Columbia, MO 65211, USA
2
Department of Biochemistry, University of Missouri, Columbia, MO 65211, USA
3
Department of Obstetrics, Gynecology and Women’s Health, University of Missouri, Columbia, MO 65212, USA
*
Author to whom correspondence should be addressed.
Metabolites 2023, 13(6), 719; https://0-doi-org.brum.beds.ac.uk/10.3390/metabo13060719
Submission received: 30 April 2023 / Revised: 26 May 2023 / Accepted: 28 May 2023 / Published: 1 June 2023
(This article belongs to the Special Issue Fetal–Maternal–Neonatal Metabolomics)
Browse Figures
Versions Notes

Abstract

:
Myostatin (gene symbol: Mstn) is an autocrine and paracrine inhibitor of muscle growth. Pregnant mice with genetically reduced levels of myostatin give birth to offspring with greater adult muscle mass and bone biomechanical strength. However, maternal myostatin is not detectable in fetal circulations. Fetal growth is dependent on the maternal environment, and the provisioning of nutrients and growth factors by the placenta. Thus, this study examined the effect of reduced maternal myostatin on maternal and fetal serum metabolomes, as well as the placental metabolome. Fetal and maternal serum metabolomes were highly distinct, which is consistent with the role of the placenta in creating a specific fetal nutrient environment. There was no effect from myostatin on maternal glucose tolerance or fasting insulin. In comparisons between pregnant control and Mstn+/− mice, there were more significantly different metabolite concentrations in fetal serum, at 50, than in the mother’s serum at 33, confirming the effect of maternal myostatin reduction on the fetal metabolic milieu. Polyamines, lysophospholipids, fatty acid oxidation, and vitamin C, in fetal serum, were all affected by maternal myostatin reduction.

1. Introduction

Intrauterine growth restriction (IUGR) is a pathological state where fetal growth is not able to meet its full potential. In clinical practice, IUGR may be diagnosed on the basis of fetal size < 10th percentile for gestational age, or by reduced or absent umbilical blood flow by Doppler ultrasound [1]. Pregnancy complications, such as preterm labor and stillbirth, and neonatal complications, including respiratory distress, hypoglycemia, and neurological impairment, are more common when IUGR is present [2]. The adult health of affected fetuses is also impaired by IUGR, with reductions in height, lean muscle mass, and bone strength, as well as increases in relative fat mass and insulin resistance [1,3]. Fetal genetic mutations can cause IUGR, which occurs in severe osteogenesis imperfecta [4], as can maternal undernutrition, although placental insufficiency is thought to be the most common cause [1,5,6,7].
Myostatin (gene symbol Mstn), or GDF8, is a member of the transforming growth factor beta (TGF-β) superfamily that acts in a paracrine fashion to reduce muscle growth [8]. Fetal musculoskeletal growth is inhibited, both by myostatin made by the developing fetus, and myostatin within the maternal circulation [9,10,11]. Lee [9] found that weights of the pectoralis, triceps, quadriceps, and gastrocnemius muscles in 10-week-old male Mstn+/− offspring correlated with their mothers’ myostatin genotypes, with offspring of Mstn−/− mothers having the largest muscle weights, and offspring of Mstn+/+ mothers having the smallest, while offspring of Mstn+/− mothers were in-between [9]. Cross-fostering at birth did not alter the relationship between maternal myostatin genotype and offspring muscle weights, suggesting that it is maternal myostatin in the intrauterine environment rather than the postnatal lactational environment that regulates offspring muscle development [9]. Similarly, we have previously found that wildtype (WT) fetuses are larger when born to mouse mothers with genetically reduced myostatin (Mstn+/−) than when born to control mothers [12]. WT offspring from Mstn+/− mothers also have enhanced bone biomechanical strength in adulthood, suggesting that maternal myostatin may be an important regulator of fetal bone, as well as muscle, development [12]. Increased bone biomechanical strength was also observed in Col1a2+/− (osteogenesis imperfecta) fetuses, which have inherent bone fragility when born to Mstn+/− mothers compared to control mothers [12]. The effect of reducing myostatin on adult bone biomechanics was recapitulated by transferring embryos at the morula stage into control or Mstn+/− recipient mothers, showing that it is the intrauterine environment that confers greater bone strength [12]. Maternal myostatin influences fetal musculoskeletal phenotype without directly entering the fetal circulation. While Mstn+/− mothers have approximately 30% lower serum myostatin concentrations than wildtype mothers, fetuses from the two maternal genotypes have identical serum myostatin concentrations, and myostatin null fetuses have no detectable serum myostatin, even when it is present in their mothers’ circulation [12].
As a result of these observations, we hypothesized that maternal myostatin may influence fetal musculoskeletal development by altering the metabolic environment that supports fetal growth. Maternal myostatin reduction may change the metabolism of the mother, and thus, the nutrients that are available for transport to the fetus. Alternatively, it may affect placental transport functions, meaning that nutrients from the maternal circulation reach the fetal circulation at different levels, or it may affect both transport and maternal metabolism. The goal of this study was to broadly characterize the metabolites present in the maternal and fetal serums, as well as placental tissue, from wildtype and Mstn+/− mothers, using a metabolomics approach. Maternal metabolism was additionally characterized in myostatin deficient mothers by glucose tolerance testing and measurement of fasting insulin and serum triglyceride concentrations.

2. Materials and Methods

2.1. Animals

Mstntm1Sj1 mice, provided by S.J. Lee, contain a neo cassette instead of the C-terminal region of the Mstn gene and do not produce myostatin [13]. These mice were previously backcrossed into a C57Bl/6J background (Jackson Laboratories) [14]. For this study, both Mstn+/− and WT control females were obtained from Mstn+/− x Mstn+/+ crosses. Genotypes were determined by PCR amplification using Terra PCR Direct Kit (Takara), with the following primer sets (Integrated DNA Technologies): (Mstn allele (forward: 5′GGATCGGCCATTGAACAAGATG3′ and reverse: 5′GAGCAAGGTGAGATGACAGGAG3′); wildtype allele (forward: 5′AGTCAAGGTGACAGACACACCCAA3′ and reverse: 5′TGGTGCACAAAGATGAGTATGCGGA3′)), generating 500 bp and 225 bp amplicons, respectively [15]. For both the glucose tolerance testing and metabolomics experiments, WT mothers were paired with Mstn+/− sires (control cross) and WT sires were paired with Mstn+/− mothers (experimental cross). The morning that a copulation plug was detected was considered gestation d0.5.

2.2. Intraperitoneal Glucose Tolerance Testing (IPGTT)

Virgin non-pregnant WT (n = 8) and Mstn+/− (n = 7) females and gestation d17.5 WT (n = 11) and Mstn+/− (n = 8) females were not provided food from 07:00 to 12:00, with ad libitum access to water. Glucose tolerance testing was performed, according to the National Institutes of Health animal models of diabetic complications consortium protocol [16]. After 5 h fasting, mice were weighed, and a tail blood sample was taken for measurement of glucose and insulin. Then, 1 mg/mL glucose solution was injected intraperitoneally, and blood glucose concentrations were measured again by taking the mean from two ReliOn Prime glucometer readings (Walmart) at 15-, 30-, 60-, and 120-min post-injection. At the conclusion of testing, mice were euthanized by CO2 asphyxiation and cervical dislocation, and maternal blood was collected by cardiac puncture to determine serum triglyceride concentrations. Fetuses and placentas were weighed, and then, trunk blood was collected and pooled for each litter, to measure serum triglycerides.

2.3. Insulin and Triglyceride Assays

Fasting insulin was measured with the Rat/Mouse Insulin ELISA kit (Millipore Sigma EZRMI13K) in 10 µL serum samples in duplicate, according to the manufacturer’s protocol, but with primary antibody incubation times extended to overnight. Briefly, 10 µL of matrix solution was added to blank, standard, and control wells, and all standards and samples were added in duplicate to the coated test plates and incubated with the detection antibody overnight at 4 °C. Wells were washed three times, incubated with enzyme solution, and then, washed again before addition of substrate solution. The stop solution was added, and absorbance was measured at both 450 nm and 590 nm in a Biotek plate spectrophotometer. A four-point standard curve was used to calculate sample concentrations by using Gen5 software. The mean intra-assay coefficient of variation was 6.7%. According to the manufacturer, the assay sensitivity was 0.2 ng/mL, and the range of the standard curve was 0.2–10 ng/mL.
Serum triglyceride concentrations were measured using the Triglyceride Assay Kit (Abcam ab65336), according to the manufacturer’s protocol for colorimetric (absorbance) assay. Briefly, glycerol standards or 2–5 µL of each serum sample were adjusted to a total volume of 50 µL in assay buffer. For each sample or standard, duplicate wells were incubated with Lipase or Triglyceride Assay buffer for 20 min to determine the total and free glycerol, respectively. Then, all wells were incubated in triglyceride enzyme mix and probe for 60 min before the absorbance was measured at 570 nm. Sample glycerol concentrations were determined from the standard curve. Triglyceride concentrations were determined by subtracting free glycerol from total glycerol, and then, adjusting for sample volume. The mean intra-assay coefficient of variation was 7.1%. According to the manufacturer, the assay sensitivity was 2 µM, and the range was 0–10 nmol.

2.4. Metabolomics

WT (n = 14) and Mstn+/− (n = 13) mothers were euthanized on day 17.5 of gestation and maternal serum, fetal serum, and placentas were collected. Fetal tails were collected for genotyping, as described above, and PCR sexing by Rbm31x/y amplification, as described previously [17]. One male, WT placenta was selected from each litter. Serum from all of the fetuses in each litter was combined to create one fetal serum pool for each mother. Eight litters from each maternal genotype provided a serum pool of sufficient volume for analysis. Metabolomic analysis was carried out by Metabolon Inc (Morrisville, NC, USA). Samples were prepared and extraction of metabolites was performed using ultra-high-performance liquid chromatography/tandem high resolution/accurate mass spectrometry in both positive and negative ion modes, using combination reverse phase and HILIC chromatography methods, as described previously [18]. Automated peak detection was used to determine the relative ions concentrations and matching of ion features to compound identities was conducted using Metabolon’s patented platform system software and a 4500+ named and 2750+ un-named compound reference library [19].

2.5. Statistical Analysis

All analyses, other than metabolomic profiles, were carried out using GraphPad Prism software. Maternal weights were compared between WT and Mstn+/− mothers by Student’s t-test, with F-test to ensure equal variances. Maternal and fetal serum triglyceride concentrations and fetal and placental weights were analyzed by one-way ANOVA, with Bartlett’s test for equal variance. Glucose tolerance was compared by repeated measures ANOVA, with group and time as factors. Insulin concentrations showed significantly different variances between WT and Mstn+/− mothers by F test, and therefore, medians were compared by Mann–Whitney test. For metabolomics, comparisons were made on log-transformed data using ArrayStudio/Jupyter Notebook software, while R. Welch’s two-sample t-tests were performed to identify biochemicals that differed between maternal and fetal serum and differed between WT and Mstn+/− mothers within placentas, maternal serum, or fetal serum. Two-way ANOVA was used to identify significant interations between serum source (maternal vs. fetal) and maternal genotype. False discovery rate was estimated using q-value [20].

3. Results

3.1. Growth and Maternal Metabolic Assessment

Maternal body weights in late pregnancy were not different between wildtype and Mstn+/− females (Figure 1a). Maternal triglyceride concentrations were not significantly different between maternal genotypes in terminal blood samples taken from pregnant mothers or their fetuses. However, there was some indication of an interaction between maternal genotype and serum source, with maternal triglycerides tending to be lower, and fetal triglycerides tending to be higher in the Mstn+/− pregnancies compared to controls (WT) (p = 0.15) (Figure 1b). Intraperitoneal glucose tolerance testing (IPGTT) was carried out in wildtype and Mstn+/− females, both in the non-pregnant state and on gestation d17.5. Myostatin genotype had no effect overall on glucose tolerance (Figure 1c). However, there was a significant interaction between group and time, such that WT pregnant females had lower glucose than Mstn+/− virgins at the 15 min time point. Fasting insulin measured in serum collected from pregnant mothers prior to the IPGTT did not differ according to maternal genotype, though there was significantly more variability (F test, p = 0.01) among WT mothers than among Mstn+/− mothers (Figure 2d).
Maternal, fetal, and placental weights were assessed in all pregnancies studied in both glucose tolerance testing and metabolomics analyses described below. There were no significant differences in fetal weight based on either maternal or fetal myostatin genotype (Figure 2). Litter sizes varied from 5 to 10 and did not differ significantly between WT (7.9 + 0.3) and Mstn+/− (7.4 + 0.3) mothers.

3.2. Global Metabolomic Assessment

Metabolomic analysis was conducted on maternal serum from pregnant WT and Mstn+/− females, and in the pooled fetal serum from each of their litters. In order to control for fetal sex and fetal genotype, one WT male placenta from each litter was selected for tissue metabolic analysis. Overall, 917 metabolites were detected and identified in serum and 815 metabolites were identified and detected in placental tissue. The metabolomic analysis revealed a strong separation between the maternal and fetal serum metabolomes, which were easily distinguished by the Principal Components Analysis (Figure 3a). Accordingly, there were approximately 700 metabolites with statistically significant concentration differences between maternal and fetal sera, in both WT and Mstn+/− pregnancies (Table 1) and a clear separation between maternal and fetal samples in the Principal Component Analysis (Figure 3). Metabolite profiles did not differ as much by genotype as they did by maternal vs. fetal origin, with dozens rather than hundreds of differences. Maternal serum samples from WT mothers mostly clustered tightly, with Mstn+/− mothers (and one WT sample) distributing broadly in PCA component 2. There was no clear separation between the genotypes in the Principal Component Analysis of either fetal serum or placental samples (Table 1 and Figure 3). Nonetheless, there were statistically significant differences between WT and Mstn+/− metabolites in both the serum and placenta (Table 1).

3.3. Maternal Sera Metabolite Differences Based on Maternal Myostatin Genotype

There were a total of 33 metabolites significantly up- or downregulated in the serum of pregnant Mstn+/− mothers compared to WT mothers, though none were significant after false discovery rate correction (q-value) (Table 2, Supplemental Table S1). Two of the three most significantly downregulated metabolites were oxidized forms of glutathione, a key cellular antioxidant, with the other most significantly downregulated metabolite being N-acetylated proline, which is found in acetylated peptides. The most significantly upregulated metabolite, 3-bromo-5-chloro-2,6-dihydroxybenzoic acid, is a salicylic acid compound.

3.4. Fetal Sera Metabolite Differences Based on Maternal Myostatin Genotype

There were more metabolite differences in fetal serum from WT and Mstn+/− mothers at 50 metabolites, than in the serum of the mothers themselves (Table 3, Supplemental Table S1). The most significantly upregulated metabolite, remaining significant after false discovery rate correction, was the polyamine metabolite N-acetylputrescine. It was 2.6-fold higher in fetal serum from Mstn+/− mothers. N-acetylputrescine was overall the second-ranked biochemical for its ability to distinguish amongst the serum types in a random forest analysis (Supplemental Figure S1).

3.5. Placental Metabolite Differences Based on Maternal Myostatin Genotype

Twenty-three metabolites were downregulated in placental tissue from Mstn+/− mothers compared to WT mothers, whereas only four metabolites were upregulated (Table 4, Supplemental Table S2). The most significantly downregulated of these metabolites was alpha-tocopherol (vitamin E), reduced by 1.4-fold and the most significantly upregulated was 2-deoxyinosine, which was 1.5-fold higher in placentas from Mstn+/− mothers.

3.6. Lipid Metabolism

Of the 30 top-ranking biochemicals identified in the Biochemical Importance Plot, nearly half (14) were lipid metabolites (Supplemental Figure S1). Among the lipids that were found at different concentrations in WT and Mstn+/− sera, species related to fatty acid oxidation and lysophospholipids were particularly well represented. A number of medium and long-chain acylcarnitine species were differentially concentrated in either maternal or fetal serum, independent of maternal genotype, with acylcarnitine medium chain and monounsaturated fatty acids being higher in maternal serum and acylcarnitine polyunsaturated fatty acids being higher in fetal serum (Table 5). Additionally, several acylcarnitine fatty acids were found at higher concentrations in fetal blood from Mstn+/− mothers than in fetal blood from WT mothers (Table 5). There were no differences between Mstn+/− and WT mothers in maternal serum concentrations or placental concentrations of acylcarnitines (Table 5).
There were also differences in the concentrations of several lysophopholipid types, with significant upregulation in the fetal serum from Mstn+/− mothers compared to fetuses from WT mothers, and some evidence of decreases in their placental tissue (Table 6).

3.7. Purine Metabolism Differences Based on Maternal Myostatin Genotype

Many purine metabolites were upregulated in fetal serum relative to maternal serum (Table 7 and Supplemental Table S1). Additionally, some purine compounds were regulated by maternal genotype. While 2-deoxyinosine, the product of the adenosine deaminase (ADA) enzyme, was upregulated in placentas from Mstn+/− mothers, adenosine, an ADA substrate, was significantly reduced in serum from their fetuses, although the placental concentration of deoxyadenosine (not shown) and adenosine were not significantly affected by maternal genotype. Fetal serum from Mstn+/− mothers also had significantly reduced levels of AMP, and some evidence of a similar reduction in its metabolite, IMP, which is generated by various isoforms of adenosine monophosphate deaminase. AMP can also be converted to adenosine by 5′-nucleotidase (Nt5e) [21]. There was a significant reduction in fetal serum guanine and 5′-GMP and maternal serum guanosine concentrations in Mstn+/− mothers.

3.8. Branched-Chain Amino Acids

Branched-chain amino acid metabolites isoleucine, isovalerate, and methylsuccinate were elevated in fetal serum from Mstn+/− mothers (Table 8).

3.9. Vitamins

In addition to the reduction in tocopherol in placental tissue from Mstn+/− mothers, there were slight reductions in vitamin A and vitamin B6 (Table 4). Vitamin C-related metabolites were found at different concentrations in the sera from Mstn+/− mothers. In WT mothers, ascorbate levels were 23-fold higher in fetal serum than in maternal serum (Table 4). In contrast, ascorbate was only 1.5-fold higher in fetal serum than in maternal serum of Mstn+/− mothers, such that ascorbate was 14-fold higher in the serum of the fetuses carried by the WT mothers compared to the serum of fetuses carried by Mstn+/− mothers. Dehydroascorbate was also significantly lower in fetal serum from Mstn+/− mothers vs. that of WT mothers, but only by 1.7-fold. Thus, the ratio of ascorbate to dehydroascorbate was 3.8 in WT fetuses but only 0.5 in fetuses from Mstn+/− mothers, suggesting that they may be more rapidly utilizing ascorbate. As mentioned above, GSSG was lower in maternal serum from Mstn+/− females (Table 2). One of the many redox reactions involving GSSG is the recycling of dehydroascorbate to ascorbate. Additionally, in maternal serum, though there were no differences in ascorbate or dehydroascorbate, there was a significant reduction in 2-O-methylascorbic acid, which is generated from ascorbate by catechol-O-methyltransfersase (COMT), an enzyme both widely expressed and abundant in the placenta [22,23] (Table 2).

4. Discussion

The largest metabolome differences observed here were those between fetal and maternal serum and were independent of maternal genotype. This reflects the critical role of the placenta in keeping the maternal and fetal circulations separate, acting not merely as a “sieve” or passive conduit for maternal serum components but actively enriching or blocking various components of maternal serum to maintain a unique fetal metabolic environment. Nonetheless, there were significant differences in maternal, fetal, and placental metabolomes based on maternal myostatin genotype. Strikingly, fetal serum metabolomes were more different between WT and Mstn+/− mothers than the maternal serum metabolomes. This was true even though the fetal genotypes were the same in WT and Mstn+/− mothers. WT females were mated to Mstn+/− sires, and vice versa, and fetal sera were pooled within each litter. Additionally, maternal myostatin does not enter the fetal circulation [12]. Thus, a slight reduction in maternal myostatin, acting in the maternal circulation, actually affects fetal metabolism more than it affects maternal metabolism. This is reinforced by our other assessments of maternal glucose metabolism; there were no differences in maternal glucose tolerance or fasting insulin concentrations.
The metabolite that most distinguished fetal serum from WT and Mstn+/− mothers was the polyamine N-acetylputrescine, while another polyamine metabolite, N-acetyl-cadaverine was elevated in placental tissue from Mstn+/− mothers. N-acetylarginine, a precursor of ornithine, which is subsequently converted to putrescine by ornithine decarboxylase (ODC1), was slightly, although significantly reduced in the maternal serum of Mstn+/− females (Table 2). Individuals with gain of function mutations in ODC1 have elevated N-acetylputrescine accompanied by N-acetylarginine deficiency, suggesting that myostatin reduction may be stimulating ODC1 activity in the uterus or placenta [24]. Putrescine promotes cell proliferation, protein synthesis, and mTOR phosphorylation in porcine placental cells [25]. ODC-null murine embryos die shortly after embryo implantation, with loss of the inner cell mass [26]. Similarly, pharmacological inhibition of ODC at various times between days 4 and 9, but not 1 and 3 or 10 and 18, resulted in the post-implantation embryonic loss, which could be rescued by putrescine replacement [27,28]. ODC1 expression in the mouse uterus normally peaks at gestation d8, [27,28]. ODC1 activation and putrescine treatment are associated with metabolic activation of blastocysts from embryonic diapause in both the mouse and the mink, [29,30]. Although the relationship between myostatin and ODC1 has not been studied, ODC1 does stimulate muscle growth [31,32]. Thus, ODC1 activity and putrescine production by either the uterus or placenta could plausibly be a mechanism for myostatin reduction to stimulate fetal metabolism and promote fetal growth. Importantly, however, here the polyamine metabolites were only measured near the end of gestation. Assessments of uterine and placental ODC1 activity and polyamine levels earlier across gestation in myostatin-deficient mothers would generate a fuller picture.
Medium and long-chain acylcarnitine fatty acids were increased in fetal serum from Mstn+/− mothers. Acylcarnitine fatty acids are created by the addition of carnitine to acyl-CoA conjugated fatty acids by CPT1, allowing transport into the mitochondrial matrix, and they accumulate when the supply of fatty acids exceeds their beta-oxidation by mitochondria [33]. Although beta-oxidation of fatty acids contributes significantly to placental energy generation [34], the placental content of these species did not differ between WT and Mstn+/− mothers. One possibility is that reduced fetal fatty acid oxidation may account for the higher fetal carnitine fatty acid concentrations. Fatty acids not used by fetuses can accumulate in the maternal circulation, as seen in mothers who carry fetuses with inborn errors in fatty acid oxidation [35]. Here, however, maternal acylcarnitine fatty acids were not different in serum from WT and Mstn+/− mothers. Alternatively, the elevated carnitine fatty acid levels in fetal serum may be a result of the placenta breaking down triglycerides to supply the fetus with higher levels of fatty acids for beta-oxidation in Mstn+/− mothers. This is somewhat supported by the serum triglyceride concentrations in Mstn+/− mothers, which were reduced, although not significantly. An increased supply of fatty acids for beta-oxidation would also be consistent with previous findings that myostatin knockout increased fatty acid oxidation enzyme levels in muscle in cattle [36] and in adipose tissue in mice [37].
Several lysophospholipids were significantly elevated in the fetal serum from Mstn+/− mothers compared to from WT mothers, with some evidence of decreases in the placentas from Mstn+/− mothers. These included glycerophosphatidic acid (GPA), glycerophosphorylcholine (GPC), glycerophosphoethalolamine (GPE), and glycerophosphatidylinositol (GPI) species. Lysophospholipids are small bioactive lipid molecules characterized by a single hydrophobic carbon chain and a polar head group attached to either a sphingoid base backbone, for the lysosphingolipids, or a glycerol backbone, for the lysoglycerophospholipids [38]. The lysolipid structure renders these lipids more hydrophilic, which makes them more versatile than other corresponding phospholipids. They act as extracellular mediators activating specific G-protein-coupled receptors (GPCRs), although some of them can also play a role in intracellular signal transduction [39]. Sphingosine-1-phosphate (S1P) and lysophosphatidic acid (LPA) have been characterized in the greatest detail up to this time, and are important in numerous biological functions, many potentially relevant to the effect of maternal myostatin on fetal growth. LPA receptors are expressed by osteoblasts and osteoclasts, and biomaterials containing LPA can enhance osteogenesis in vitro [40]. S1P is suggested to have numerous roles in the placenta, including regulation of trophoblast invasion and syncytialization [41,42]. Lysophospholipids are also components of the cell membrane and local mediators that regulate development, tissue regeneration, and homeostasis, and are precursors for lipid synthesis. Lysophosphatidylcholine (LPC), the most abundant lysophospholipid in blood, is transported by MFSD2, which also transports acylcarnitines, and serves as the receptor for syncytin-2 during human trophoblast syncytialization [38,43].
Multiple metabolomic differences point to a possible increase in adenosine deaminase activity in the placenta in mothers with reduced myostatin. The most upregulated metabolite in placental tissue from Mstn+/− mothers was 2-deoxyinosine, and a number of adenosine metabolites were downregulated in fetal serum from Mstn+/− mothers. Adenosine deaminase (ADA), which converts adenosine and deoxyadenosine to inosine and 2-deoxyinosine, is highly expressed in the placenta and is a key regulator of fetal adenosine concentrations [44]. Placental ADA is critical for placental development and fetal growth. While Ada knockout mice do not survive until birth, replacing ADA in just the placenta reduces fetal adenosine concentrations, alleviates fetal liver damage, and rescues the fetuses [44]. ADA supplementation also alleviated symptoms in a mouse model of preeclampsia and growth restriction based on angiotensin II overactivation. Combined placental and decidual Ada knockout results in neonatal mortality [45]. In humans, plasma adenosine is elevated in the cord blood of fetuses with pre-eclampsia and reduced uterine artery blood flow [46]. In these studies, reduced fetal serum adenosine is associated with better placental oxygenation and fetal growth. On the other hand, adenosine is also reduced in the plasma of growth-restricted fetal sheep, along with uric acid, suggesting that adenosine levels alone are not a clear indicator of fetal growth rates [47]. Additional studies are needed to test whether ADA is directly regulated by myostatin and whether this mediates any of the effects of reduced maternal myostatin on offspring outcomes.
In addition to adenosine, AMP, which can be metabolized to adenosine, was significantly reduced in fetal serum from Mstn+/− mothers. The ratio of AMP to ATP is critical for regulating the activity of the enzyme AMP kinase (AMPK), a nutrient sensor and master regulator of metabolism. Thus, one would predict lower AMPK activity in fetuses from Mstn+/− mothers, though this remains to be tested. In conditions of high AMP, AMPK is activated, triggering multiple energy-conserving and energy-generating cellular activities, including increased mitochondrial biogenesis, enhanced fatty acid oxidation, and inhibition of fatty acid synthesis [48]. Thus, it is possible that the seemingly reduced fatty acid oxidation observed in fetal serum from Mstn+/− mothers was a result of the lower AMP and AMPK levels. Elevated pAMPK was found in placentas from IUGR and high-altitude pregnancies and in the hypothalamus of rats that had experienced growth restriction [49,50,51]. Myostatin knockout has been shown to inhibit AMPK in mouse skeletal muscle [52] but myostatin treatment inhibited AMPK activity in cultured myoblasts. Whether suppression of AMPK activity might be mediating some of the effects of reduced maternal myostatin on fetal growth and development should be studied further.
Guanine-containing-purines were also reduced in maternal (guanosine) and fetal (guanine, 5′-GMP) sera from Mstn+/− mothers, although the biological significance of these changes is not clear. While 5′GMP can be a metabolite of the signaling molecule cGMP, it is also a building block of nucleic acids. Guanylate cyclase and cGMP have been studied in the context of placental and uterine vasodilation in pregnancy, particularly in preeclamptic models, yet in fetal serum, no differences in cGMP were found in males with intrauterine growth restriction; thus, whether fetal cGMP concentrations play any role in regulating fetal growth is not understood [53,54].
Vitamin C (ascorbate) was significantly reduced in fetal serum from Mstn+/− mothers. This reduction could either result from reduced placental transport of ascorbate or increased consumption by the fetus; however, the reduced ratio of ascorbate to dehydroascorbate in fetuses from Mstn+/− mothers suggests that more ascorbate is being converted to dehydroascorbate. Ascorbate is a necessary cofactor in the synthesis of type I collagen, acting as a reducing agent in the hydroxylation of proline, which stabilizes the collagen triple helix [55]. We have previously shown an increased hydroxyproline content in the calvaria of 1–2-day-old WT neonates born to Mstn+/− mothers [12]. Thus, the improved bone architecture and biomechanical strength in the adult offspring of Mstn+/− mothers may result, at least in part, from increased rates of collagen synthesis beginning prenatally. These observations provide limited insight into the mechanisms through which maternal myostatin reduction stimulates fetal collagen synthesis, though increased placental ascorbate transport seems unlikely. The reduction in Vitamin A in placentas may be indicative of enhanced transport to the fetus. Vitamin E (alpha tocopherol) was reduced in both maternal serum and placental tissue from Mstn+/− mothers, but was not different in fetal serum, suggesting enhanced transport to the fetus. Vitamin A has mixed effects on bone development, with both excess and deficiency associated with reduced bone health [56]. Vitamin A concentrations in serum from pregnant women, but not cord blood, were shown to correlate positively with offspring bone mineral density in adults [57]. Vitamin E also does not appear to be required within the embryo, as embryonic knockout of its binding protein, TTPA, in mice, does not affect fetal growth, nor is it required for placental development after pregnancy at d13.5, meaning the significance of the reduction in vitamin E is unclear [58].
In contrast to our previous observations [12,59], there were no significant differences in fetal weight based on either fetal or maternal myostatin genotype. The lack of effect of fetal myostatin genotype was unexpected due to its well-established role in muscle development. However, the effects of heterozygosity are more subtle than complete knockout, and fine distinctions in the weights of mouse fetuses are difficult to detect. Whether maternal myostatin influences fetal weight and not just the musculoskeletal health of adult offspring is now unclear [9,12]. Body weights were also not larger in pregnant Mstn+/− females. McPherron and Lee found that females heterozygous for the myostatin mutation have larger muscles, but not significantly larger body weights, compared to WT mice at 2 months of age, though they were larger at 5 and 10 months of age [60]. Pregnant females in this study were 8–12 weeks of age.
Overall, metabolomic profiling showed a number of different biochemicals and biochemical classes that differ, particularly in fetal serum, in pregnancies from Mstn+/− mothers, and several of these provide plausible mechanisms for enhancing fetal musculoskeletal growth, either by altering energy supplies (carnitine fatty acids) or signaling molecules (lysophospholipids). Nearly all of the regulated metabolites in the placenta were found at lower concentrations (23 of 27), which is suggestive of nutrients being transferred rather than retained by the placenta. However, a limitation of these studies is an inability to determine whether differences in steady-state metabolite concentrations in maternal or fetal serum reflect differential transport or differential utilization by the mother or fetus. Thus, further experiments are needed to examine nutrient transporters and enzymes in the uterus and placenta, for example, by utilizing labeled tracers to directly assess transfers from mother to fetus.

Supplementary Materials

The following supporting information can be downloaded at: https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/metabo13060719/s1. Figure S1. Random forest classification using named metabolites in mice groups: WT Fetal, WT Maternal, MSTN Fetal, and MSTN Maternal provided a predictive accuracy of 44%; Table S1. Effect of maternal myostatin on placental nutrient transfer (2nd serum); Table S2. Effect of maternal myostatin on placental nutrient transfer–placenta merged set.

Author Contributions

Conceptualization, C.L.P. and L.C.S.; methodology, R.O., J.D., C.L.P. and L.C.S., investigation R.O. and J.D.; analysis R.O. and L.C.S.; writing—original draft preparation, R.O. and L.C.S.; writing—review and editing, C.L.P. and L.C.S.; visualization, R.O. and L.C.S.; funding C.L.P., L.C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research and the APC were funded by Eunice K Shriver National Institute of Child Health and Human Development, grant number R21HD100726.

Institutional Review Board Statement

Procedures involving animals were approved by the University of Missouri Animal Care and Use Committee, protocol #40008 and performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Animals were maintained in an AALAC-accredited facility.

Informed Consent Statement

Not applicable.

Data Availability Statement

Full metabolomics data are openly available in the Metabolights repository at https://www.ebi.ac.uk/metabolights/MTBLS3345 study number MTBLS3345. Other data are contained within the article.

Acknowledgments

The authors thank Catherine Omosule, Tara Crawford, Jami Rance and Ginger Seawel for providing assistance with animal experiments.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Brown, L.D.; Hay, W.W., Jr. Impact of placental insufficiency on fetal skeletal muscle growth. Mol. Cell. Endocrinol. 2016, 435, 69–77. [Google Scholar] [CrossRef] [PubMed]
  2. Salam, R.A.; Das, J.K.; Bhutta, Z.A. Impact of intrauterine growth restriction on long-term health. Curr. Opin. Clin. Nutr. Metab. Care 2014, 17, 249–254. [Google Scholar] [CrossRef] [PubMed]
  3. Romano, T.; Wark, J.D.; Wlodek, M.E. Developmental programming of bone deficits in growth-restricted offspring. Reprod. Fertil. Dev. 2015, 27, 823–833. [Google Scholar] [CrossRef] [PubMed]
  4. Rao, R.; Cuthbertson, D.; Nagamani, S.C.S.; Sutton, V.R.; Lee, B.H.; Krischer, J.; Krakow, D. Pregnancy in women with osteogenesis imperfecta: Pregnancy characteristics, maternal, and neonatal outcomes. Am. J. Obs. Gynecol. MFM 2021, 3, 100362. [Google Scholar] [CrossRef]
  5. Regnault, T.R.; Galan, H.L.; Parker, T.A.; Anthony, R.V. Placental development in normal and compromised pregnancies—A review. Placenta 2002, 23 (Suppl. SA), S119–S129. [Google Scholar] [CrossRef]
  6. Hay, W.W., Jr.; Brown, L.D.; Rozance, P.J.; Wesolowski, S.R.; Limesand, S.W. Challenges in nourishing the intrauterine growth-restricted foetus—Lessons learned from studies in the intrauterine growth-restricted foetal sheep. Acta Paediatr. 2016, 105, 881–889. [Google Scholar] [CrossRef]
  7. Jansson, T.; Powell, T.L. Role of the placenta in fetal programming: Underlying mechanisms and potential interventional approaches. Clin. Sci. 2007, 113, 1–13. [Google Scholar] [CrossRef]
  8. Lee, S.J.; McPherron, A.C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA 2001, 98, 9306–9311. [Google Scholar] [CrossRef]
  9. Lee, S.J. Quadrupling muscle mass in mice by targeting TGF-beta signaling pathways. PLoS ONE 2007, 2, e789. [Google Scholar] [CrossRef]
  10. Salzler, R.R.; Shah, D.; Dore, A.; Bauerlein, R.; Miloscio, L.; Latres, E.; Papadopoulos, N.J.; Olson, W.C.; MacDonald, D.; Duan, X. Myostatin deficiency but not anti-myostatin blockade induces marked proteomic changes in mouse skeletal muscle. Proteomics 2016, 16, 2019–2027. [Google Scholar] [CrossRef]
  11. Girgenrath, S.; Song, K.; Whittemore, L.A. Loss of myostatin expression alters fiber-type distribution and expression of myosin heavy chain isoforms in slow- and fast-type skeletal muscle. Muscle Nerve 2005, 31, 34–40. [Google Scholar] [CrossRef]
  12. Oestreich, A.K.; Kamp, W.M.; McCray, M.G.; Carleton, S.M.; Karasseva, N.; Lenz, K.L.; Jeong, Y.; Daghlas, S.A.; Yao, X.; Wang, Y.; et al. Decreasing maternal myostatin programs adult offspring bone strength in a mouse model of osteogenesis imperfecta. Proc. Natl. Acad. Sci. USA 2016, 113, 13522–13527. [Google Scholar] [CrossRef] [PubMed]
  13. McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef] [PubMed]
  14. Gentry, B.A.; Ferreira, J.A.; Phillips, C.L.; Brown, M. Hindlimb skeletal muscle function in myostatin-deficient mice. Muscle Nerve 2011, 43, 49–57. [Google Scholar] [CrossRef] [PubMed]
  15. Jackson, M.F.; Li, N.; Rodgers, B.D. Myostatin regulates tissue potency and cardiac calcium-handling proteins. Endocrinology 2014, 155, 1771–1785. [Google Scholar] [CrossRef] [PubMed]
  16. AMDCC. Intraperitoneal Glucose Tolerance Testing (IPGTT). Available online: http://www.diacomp.org/shared/showFile.aspx?doctypeid=3&docid=11 (accessed on 27 March 2023).
  17. Tunster, S.J. Genetic sex determination of mice by simplex PCR. Biol. Sex. Differ. 2017, 8, 31. [Google Scholar] [CrossRef]
  18. Guo, L.; Milburn, M.V.; Ryals, J.A.; Lonergan, S.C.; Mitchell, M.W.; Wulff, J.E.; Alexander, D.C.; Evans, A.M.; Bridgewater, B.; Miller, L.; et al. Plasma metabolomic profiles enhance precision medicine for volunteers of normal health. Proc. Natl. Acad. Sci. USA 2015, 112, E4901–E4910. [Google Scholar] [CrossRef]
  19. DeHaven, C.D.; Evans, A.M.; Dai, H.P.; Lawton, K.A. Software Techniques for Enabling High-Throughput Analysis of Metabolomic Datasets. In Metabolomics; Intech: London, UK, 2012; pp. 167–192. [Google Scholar] [CrossRef]
  20. Storey, J.D.; Tibshirani, R. Statistical significance for genomewide studies. Proc. Natl. Acad. Sci. USA 2003, 100, 9440–9445. [Google Scholar] [CrossRef]
  21. Roszkowska, A.; Klimek, J.; Kaletha, K. Expression patterns of AMP-deaminase and cytosolic 5′-nucleotidase genes in human term placenta. Mol. Cell. Biochem. 2008, 311, 249–251. [Google Scholar] [CrossRef]
  22. Bowers-Komro, D.M.; McCormick, D.B.; King, G.A.; Sweeny, J.G.; Iacobucci, G.A. Confirmation of 2-O-methyl ascorbic acid as the product from the enzymatic methylation of L-ascorbic acid by catechol-O-methyltransferase. Int. J. Vitam. Nutr. Res. 1982, 52, 186–193. [Google Scholar]
  23. Barnea, E.R.; MacLusky, N.J.; DeCherney, A.H.; Naftolin, F. Catechol-o-methyl transferase activity in the human term placenta. Am. J. Perinatol. 1988, 5, 121–127. [Google Scholar] [CrossRef] [PubMed]
  24. Rajasekaran, S.; Bupp, C.P.; Leimanis-Laurens, M.; Shukla, A.; Russell, C.; Junewick, J.; Gleason, E.; VanSickle, E.A.; Edgerly, Y.; Wittmann, B.M.; et al. Repurposing eflornithine to treat a patient with a rare ODC1 gain-of-function variant disease. eLife 2021, 10, e67097. [Google Scholar] [CrossRef] [PubMed]
  25. Kong, X.; Wang, X.; Yin, Y.; Li, X.; Gao, H.; Bazer, F.W.; Wu, G. Putrescine stimulates the mTOR signaling pathway and protein synthesis in porcine trophectoderm cells. Biol. Reprod. 2014, 91, 106. [Google Scholar] [CrossRef] [PubMed]
  26. Pendeville, H.; Carpino, N.; Marine, J.C.; Takahashi, Y.; Muller, M.; Martial, J.A.; Cleveland, J.L. The ornithine decarboxylase gene is essential for cell survival during early murine development. Mol. Cell. Biol. 2001, 21, 6549–6558. [Google Scholar] [CrossRef]
  27. Zhao, Y.C.; Chi, Y.J.; Yu, Y.S.; Liu, J.L.; Su, R.W.; Ma, X.H.; Shan, C.H.; Yang, Z.M. Polyamines are essential in embryo implantation: Expression and function of polyamine-related genes in mouse uterus during peri-implantation period. Endocrinology 2008, 149, 2325–2332. [Google Scholar] [CrossRef]
  28. Fozard, J.R.; Part, M.L.; Prakash, N.J.; Grove, J. Inhibition of murine embryonic development by alpha-difluoromethylornithine, an irreversible inhibitor of ornithine decarboxylase. Eur. J. Pharm. 1980, 65, 379–391. [Google Scholar] [CrossRef]
  29. Fenelon, J.C.; Murphy, B.D. Inhibition of polyamine synthesis causes entry of the mouse blastocyst into embryonic diapause. Biol. Reprod. 2017, 97, 119–132. [Google Scholar] [CrossRef]
  30. Fenelon, J.C.; Banerjee, A.; Lefevre, P.; Gratian, F.; Murphy, B.D. Polyamine-Mediated Effects of Prolactin Dictate Emergence from Mink Obligate Embryonic Diapause. Biol. Reprod. 2016, 95, 6. [Google Scholar] [CrossRef]
  31. Hosoi, T.; Yakabe, M.; Sasakawa, H.; Sasako, T.; Ueki, K.; Kato, S.; Tokuoka, S.M.; Oda, Y.; Abe, M.; Matsumoto, T.; et al. Sarcopenia phenotype and impaired muscle function in male mice with fast-twitch muscle-specific knockout of the androgen receptor. Proc. Natl. Acad. Sci. USA 2023, 120, e2218032120. [Google Scholar] [CrossRef]
  32. Lee, N.K.; Skinner, J.P.; Zajac, J.D.; MacLean, H.E. Ornithine decarboxylase is upregulated by the androgen receptor in skeletal muscle and regulates myoblast proliferation. Am. J. Physiol. Endocrinol. Metab. 2011, 301, E172–E179. [Google Scholar] [CrossRef]
  33. McCann, M.R.; George De la Rosa, M.V.; Rosania, G.R.; Stringer, K.A. L-Carnitine and Acylcarnitines: Mitochondrial Biomarkers for Precision Medicine. Metabolites 2021, 11, 51. [Google Scholar] [CrossRef]
  34. Shekhawat, P.; Bennett, M.J.; Sadovsky, Y.; Nelson, D.M.; Rakheja, D.; Strauss, A.W. Human placenta metabolizes fatty acids: Implications for fetal fatty acid oxidation disorders and maternal liver diseases. Am. J. Physiol. Endocrinol. Metab. 2003, 284, E1098–E1105. [Google Scholar] [CrossRef]
  35. Ramanathan, R.; Ibdah, J.A. Mitochondrial Dysfunction and Acute Fatty Liver of Pregnancy. Int. J. Mol. Sci. 2022, 23, 3595. [Google Scholar] [CrossRef]
  36. Xin, X.B.; Yang, S.P.; Li, X.; Liu, X.F.; Zhang, L.L.; Ding, X.B.; Zhang, S.; Li, G.P.; Guo, H. Proteomics insights into the effects of MSTN on muscle glucose and lipid metabolism in genetically edited cattle. Gen. Comp. Endocrinol. 2020, 291, 113237. [Google Scholar] [CrossRef] [PubMed]
  37. Zhang, C.; McFarlane, C.; Lokireddy, S.; Masuda, S.; Ge, X.; Gluckman, P.D.; Sharma, M.; Kambadur, R. Inhibition of myostatin protects against diet-induced obesity by enhancing fatty acid oxidation and promoting a brown adipose phenotype in mice. Diabetologia 2012, 55, 183–193. [Google Scholar] [CrossRef]
  38. Tan, S.T.; Ramesh, T.; Toh, X.R.; Nguyen, L.N. Emerging roles of lysophospholipids in health and disease. Prog. Lipid Res. 2020, 80, 101068. [Google Scholar] [CrossRef] [PubMed]
  39. Shao, Y.; Nanayakkara, G.; Cheng, J.; Cueto, R.; Yang, W.Y.; Park, J.Y.; Wang, H.; Yang, X. Lysophospholipids and Their Receptors Serve as Conditional DAMPs and DAMP Receptors in Tissue Oxidative and Inflammatory Injury. Antioxid. Redox Signal. 2018, 28, 973–986. [Google Scholar] [CrossRef]
  40. Wu, X.; Ma, Y.; Su, N.; Shen, J.; Zhang, H.; Wang, H. Lysophosphatidic acid: Its role in bone cell biology and potential for use in bone regeneration. Prostaglandins Other Lipid Mediat. 2019, 143, 106335. [Google Scholar] [CrossRef] [PubMed]
  41. Liao, J.; Zheng, Y.; Hu, M.; Xu, P.; Lin, L.; Liu, X.; Wu, Y.; Huang, B.; Ye, X.; Li, S.; et al. Impaired Sphingosine-1-Phosphate Synthesis Induces Preeclampsia by Deactivating Trophoblastic YAP (Yes-Associated Protein) Through S1PR2 (Sphingosine-1-Phosphate Receptor-2)-Induced Actin Polymerizations. Hypertension 2022, 79, 399–412. [Google Scholar] [CrossRef]
  42. Nagamatsu, T.; Iwasawa-Kawai, Y.; Ichikawa, M.; Kawana, K.; Yamashita, T.; Osuga, Y.; Fujii, T.; Schust, D.J. Emerging roles for lysophospholipid mediators in pregnancy. Am. J. Reprod. Immunol. 2014, 72, 182–191. [Google Scholar] [CrossRef]
  43. Gil-Sanchez, A.; Demmelmair, H.; Parrilla, J.J.; Koletzko, B.; Larque, E. Mechanisms involved in the selective transfer of long chain polyunsaturated Fatty acids to the fetus. Front. Genet. 2011, 2, 57. [Google Scholar] [CrossRef]
  44. Blackburn, M.R.; Wakamiya, M.; Caskey, C.T.; Kellems, R.E. Tissue-specific rescue suggests that placental adenosine deaminase is important for fetal development in mice. J. Biol. Chem. 1995, 270, 23891–23894. [Google Scholar] [CrossRef]
  45. Blackburn, M.R.; Knudsen, T.B.; Kellems, R.E. Genetically engineered mice demonstrate that adenosine deaminase is essential for early postimplantation development. Development 1997, 124, 3089–3097. [Google Scholar] [CrossRef] [PubMed]
  46. Espinoza, J.; Espinoza, A.F.; Power, G.G. High fetal plasma adenosine concentration: A role for the fetus in preeclampsia? Am. J. Obs. Gynecol. 2011, 205, 485.e24–485.e27. [Google Scholar] [CrossRef] [PubMed]
  47. Chang, E.I.; Wesolowski, S.R.; Gilje, E.A.; Baker, P.R., 2nd; Reisz, J.A.; D’Alessandro, A.; Hay, W.W., Jr.; Rozance, P.J.; Brown, L.D. Skeletal muscle amino acid uptake is lower and alanine production is greater in late gestation intrauterine growth restricted fetal sheep hindlimb. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2019, 317, R615–R629. [Google Scholar] [CrossRef]
  48. Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [PubMed]
  49. Hung, T.H.; Wu, C.P.; Chen, S.F. Differential Changes in Akt and AMPK Phosphorylation Regulating mTOR Activity in the Placentas of Pregnancies Complicated by Fetal Growth Restriction and Gestational Diabetes Mellitus with Large-For-Gestational Age Infants. Front. Med. 2021, 8, 788969. [Google Scholar] [CrossRef] [PubMed]
  50. Lorca, R.A.; Houck, J.A.; Laurent, L.C.; Matarazzo, C.J.; Baker, K.; Horii, M.; Nelson, K.K.; Bales, E.S.; Euser, A.G.; Parast, M.M.; et al. High altitude regulates the expression of AMPK pathways in human placenta. Placenta 2021, 104, 267–276. [Google Scholar] [CrossRef] [PubMed]
  51. Fukami, T.; Sun, X.; Li, T.; Desai, M.; Ross, M.G. Mechanism of programmed obesity in intrauterine fetal growth restricted offspring: Paradoxically enhanced appetite stimulation in fed and fasting states. Reprod. Sci. 2012, 19, 423–430. [Google Scholar] [CrossRef]
  52. Gu, M.; Wei, Z.; Wang, X.; Gao, Y.; Wang, D.; Liu, X.; Bai, C.; Su, G.; Yang, L.; Li, G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1alpha Pathway in Skeletal Muscle. Int. J. Mol. Sci. 2022, 23, 13703. [Google Scholar] [CrossRef]
  53. Coats, L.E.; Bakrania, B.A.; Bamrick-Fernandez, D.R.; Ariatti, A.M.; Rawls, A.Z.; Ojeda, N.B.; Alexander, B.T. Soluble guanylate cyclase stimulation in late gestation does not mitigate asymmetric intrauterine growth restriction or cardiovascular risk induced by placental ischemia in the rat. Am. J. Physiol. Heart Circ. Physiol. 2021, 320, H1923–H1934. [Google Scholar] [CrossRef]
  54. Beaumann, M.; Delhaes, F.; Menetrey, S.; Joye, S.; Vial, Y.; Baud, D.; Magaly, J.G.; Tolsa, J.F.; Peyter, A.C. Intrauterine growth restriction is associated with sex-specific alterations in the nitric oxide/cyclic GMP relaxing pathway in the human umbilical vein. Placenta 2020, 93, 83–93. [Google Scholar] [CrossRef] [PubMed]
  55. Gould, B.S.; Woessner, J.F. Biosynthesis of collagen; the influence of ascorbic acid on the proline, hydroxyproline, glycine, and collagen content of regenerating guinea pig skin. J. Biol. Chem. 1957, 226, 289–300. [Google Scholar] [CrossRef]
  56. Conaway, H.H.; Henning, P.; Lerner, U.H. Vitamin a metabolism, action, and role in skeletal homeostasis. Endocr. Rev. 2013, 34, 766–797. [Google Scholar] [CrossRef] [PubMed]
  57. Balasuriya, C.N.D.; Larose, T.L.; Mosti, M.P.; Evensen, K.A.I.; Jacobsen, G.W.; Thorsby, P.M.; Stunes, A.K.; Syversen, U. Maternal serum retinol, 25(OH)D and 1,25(OH)2D concentrations during pregnancy and peak bone mass and trabecular bone score in adult offspring at 26-year follow-up. PLoS ONE 2019, 14, e0222712. [Google Scholar] [CrossRef] [PubMed]
  58. Jishage, K.; Tachibe, T.; Ito, T.; Shibata, N.; Suzuki, S.; Mori, T.; Hani, T.; Arai, H.; Suzuki, H. Vitamin E is essential for mouse placentation but not for embryonic development itself. Biol. Reprod. 2005, 73, 983–987. [Google Scholar] [CrossRef]
  59. Oestreich, A.K.; Carleton, S.M.; Yao, X.; Gentry, B.A.; Raw, C.E.; Brown, M.; Pfeiffer, F.M.; Wang, Y.; Phillips, C.L. Myostatin deficiency partially rescues the bone phenotype of osteogenesis imperfecta model mice. Osteoporos. Int. 2016, 27, 161–170. [Google Scholar] [CrossRef]
  60. McPherron, A.C.; Lee, S.J. Suppression of body fat accumulation in myostatin-deficient mice. J. Clin. Investig. 2002, 109, 595–601. [Google Scholar] [CrossRef]
Metabolites 13 00719 g001 550
Figure 1. (a) Maternal pregnancy weights in control (WT) and Mstn+/− females. (b) Serum triglyceride concentrations in WT and Mstn+/− mothers and in serum pooled from all the fetuses in each litter, following IPGTT. (c) Intraperitoneal glucose tolerance testing in both pregnant and virgin control and Mstn+/− females. (d) Maternal fasting insulin concentrations in WT and Mstn+/− females prior to IPGTT. * p < 0.05 WT pregnant vs. Mstn+/− virgin at 15 min. (a,b,d) Each symbol represents data from an individual female, and the line represents the group means. (c) Each symbol represents the mean, and the bars represent SEM.
Figure 1. (a) Maternal pregnancy weights in control (WT) and Mstn+/− females. (b) Serum triglyceride concentrations in WT and Mstn+/− mothers and in serum pooled from all the fetuses in each litter, following IPGTT. (c) Intraperitoneal glucose tolerance testing in both pregnant and virgin control and Mstn+/− females. (d) Maternal fasting insulin concentrations in WT and Mstn+/− females prior to IPGTT. * p < 0.05 WT pregnant vs. Mstn+/− virgin at 15 min. (a,b,d) Each symbol represents data from an individual female, and the line represents the group means. (c) Each symbol represents the mean, and the bars represent SEM.
Metabolites 13 00719 g001
Metabolites 13 00719 g002 550
Figure 2. (a) Female and (b) male fetal weights on gestation d17.5, separated by maternal and fetal genotype. (c) Female and (d) male placental weights on gestation d17.5, separated by maternal and fetal genotype. There were no significant differences. Litters from females used in both the IPGTT and metabolomics experiments were used. Each symbol represents the mean weight of all fetuses of the same sex x fetal genotype combination within a single litter and the line represents the mean of all litters.
Figure 2. (a) Female and (b) male fetal weights on gestation d17.5, separated by maternal and fetal genotype. (c) Female and (d) male placental weights on gestation d17.5, separated by maternal and fetal genotype. There were no significant differences. Litters from females used in both the IPGTT and metabolomics experiments were used. Each symbol represents the mean weight of all fetuses of the same sex x fetal genotype combination within a single litter and the line represents the mean of all litters.
Metabolites 13 00719 g002
Metabolites 13 00719 g003 550
Figure 3. (a) Principal Component Analysis of metabolomic profiles of maternal and fetal sera in late pregnancy. (b) Principal Component Analysis of metabolomics profiles of wildtype, male placental tissue carried by WT and Mstn+/− mothers on gestation d17.5. Each symbol represents an individual serum or placental sample.
Figure 3. (a) Principal Component Analysis of metabolomic profiles of maternal and fetal sera in late pregnancy. (b) Principal Component Analysis of metabolomics profiles of wildtype, male placental tissue carried by WT and Mstn+/− mothers on gestation d17.5. Each symbol represents an individual serum or placental sample.
Metabolites 13 00719 g003
Table
Table 1. Summary of statistical comparisons of metabolites.
Table 1. Summary of statistical comparisons of metabolites.
ANOVA ContrastWT Fetal
WT Maternal		MSTN+/− Fetal MSTN+/− MaternalMSTN+/− Maternal WT MaternalMSTN+/− Fetal WT FetalMSTN+/− Placenta WT Placenta
Total biochemicals
p < 0.05		704682335027
Biochemicals
↑|↓		393|311412|27017|1640|104|23
↑ indicates upregulation and ↓ indicates downregulation.
Table
Table 2. Metabolites altered in maternal plasma of pregnant Mstn+/− female compared to wildtype controls. N = 8 per group.
Table 2. Metabolites altered in maternal plasma of pregnant Mstn+/− female compared to wildtype controls. N = 8 per group.
MSTN+/− vs. WT
Biochemical NameRatiop-Valueq-Value
cysteine sulfinic acid6.260.03670.9906
glu-gly-asn-val **2.280.04560.9906
Erythronate *2.160.04220.9906
3-bromo-5-chloro-2,6-dihydroxybenzoic acid *2.090.00680.9906
2,3-dihydroxyisovalerate1.900.04690.9906
heptanoate (7:0)1.820.02830.9906
N,N,N-trimethyl-alanylproline betaine (TMAP)1.680.01750.9906
lactosyl-N-palmitoyl-sphingosine (d18:1/16:0)1.620.02160.9906
dodecanedioate (C12-DC)1.500.04640.9906
3-acetylphenol sulfate1.470.01040.9906
quinolinate1.450.01030.9906
N-acetylkynurenine (2)1.350.03550.9906
N-acetylthreonine1.280.02250.9906
3,4-dihydroxybutyrate1.280.03320.9906
2-O-methylascorbic acid1.260.01130.9906
arabitol/xylitol1.260.04790.9906
2-ketogulonate1.240.04940.9906
N-acetylarginine0.780.02940.9906
1-stearoyl-2-linoleoyl-GPE (18:0/18:2) *0.710.01730.9906
alpha-tocopherol0.620.03760.9906
1-myristoyl-2-arachidonoyl-GPC (14:0/20:4) *0.610.04210.9906
1-(1-enyl-stearoyl)-2-oleoyl-GPE (P-18:0/18:1)0.600.00580.9906
4-vinylcatechol sulfate0.590.03340.9906
1-stearoyl-2-oleoyl-GPE (18:0/18:1)0.570.03170.9906
N-acetylproline0.530.00110.9853
N-(2-furoyl)glycine0.500.01100.9906
pyrraline0.480.01310.9906
N-acetylpyrraline0.400.01550.9906
glutathione, oxidized (GSSG)0.370.00910.9906
thromboxane B20.370.03130.9906
cysteine-glutathione disulfide0.350.00740.9906
ribose 1-phosphate0.330.04520.9906
cysteinylglycine disulfide *0.150.01400.9906
* Identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1) but confidence in identity is high. ** identity not confirmed and confidence is moderate
Table
Table 3. Metabolites altered in pooled plasma of fetuses carried by Mstn+/− mothers compared to wildtype controls at pregnancy d16.5. N = 8 L per group.
Table 3. Metabolites altered in pooled plasma of fetuses carried by Mstn+/− mothers compared to wildtype controls at pregnancy d16.5. N = 8 L per group.
MSTN+/− vs. WT
Biochemical NameRatiop-Valueq-Value
glycylleucine3.850.02750.7158
1-arachidonoyl-GPA (20:4)3.760.04790.8504
palmitoyl-arachidonoyl-glycerol (16:0/20:4) [1] *3.150.02190.7158
oleoylcholine2.710.04320.8504
N-acetylputrescine2.631.9 × 10−60.0017
nicotinate ribonucleoside2.290.00290.7158
1-arachidonylglycerol (20:4)2.250.00030.1153
biopterin2.200.01610.7158
caproate (6:0)2.130.00500.7158
N-acetyl-3-methylhistidine *1.970.01750.7158
2-docosahexaenoylglycerol (22:6) *1.920.01630.7158
dihomo-linolenoylcarnitine (C20:3n3 or 6) *1.780.02620.7158
isovalerate (i5:0)1.730.04630.8504
cis-3,4-methyleneheptanoylcarnitine1.670.01120.7158
N-acetyltyrosine1.660.02360.7158
linolenoylcarnitine (C18:3) *1.640.01470.7158
butyrate/isobutyrate (4:0)1.640.01950.7158
N-acetylphenylalanine1.610.00790.7158
methylsuccinate1.590.02300.7158
S-(3-hydroxypropyl)mercapturic acid (HPMA)1.570.01880.7158
N2,N5-diacetylornithine1.560.00750.7158
3-acetylphenol sulfate1.530.04180.8503
N-acetyltryptophan1.510.04000.8503
mevalonate1.480.01990.7158
succinoyltaurine1.480.02550.7158
1-methyl-5-imidazolelactate1.470.03490.7994
1-linoleoyl-GPC (18:2)1.420.02590.7158
1-arachidonoyl-GPI (20:4) *1.420.02630.7158
myristoyl dihydrosphingomyelin (d18:0/14:0) *1.420.04100.8503
1-oleoyl-GPC (18:1)1.410.00910.7158
N-acetylkynurenine (2)1.410.01460.7158
1-stearoyl-GPC (18:0)1.340.02810.7158
N2-acetyllysine1.340.03150.7409
N-myristoyltaurine *1.330.01460.7158
2-palmitoyl-GPC (16:0) *1.320.02150.7158
N-acetylisoleucine1.320.02990.7202
1-palmitoyl-GPC (16:0)1.310.01050.7158
1-palmitoleoyl-GPC (16:1) *1.290.04570.8504
3-methylhistidine1.280.02970.7202
N6-acetyllysine1.190.01470.7158
N1-methyladenosine0.770.02760.7158
guanine0.660.01390.7158
cytidine 5′-diphosphocholine0.640.03880.8503
glycerol 3-phosphate0.640.04060.8503
dehydroascorbate0.580.02090.7158
gamma-glutamyl-2-aminobutyrate0.470.00690.7158
guanosine 5′-monophosphate (5′-GMP)0.330.01440.7158
adenosine0.290.01270.7158
adenosine 5′-monophosphate (AMP)0.120.01870.7158
ascorbate (vitamin C)0.070.04820.8504
* Identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1).
Table
Table 4. Metabolites altered in placental tissue of male fetuses carried by Mstn+/− mothers (N = 13) compared to wildtype (N = 14) at pregnancy d16.5.
Table 4. Metabolites altered in placental tissue of male fetuses carried by Mstn+/− mothers (N = 13) compared to wildtype (N = 14) at pregnancy d16.5.
MSTN+/− vs. WT
Biochemical NameRatiop-Valueq-Value
4-acetamidobutanoate1.530.01120.7972
2′-deoxyinosine1.500.00110.7753
dihydroxyacetone phosphate (DHAP)1.460.01530.7972
N-acetyl-cadaverine1.420.01120.7972
1-palmitoyl-2-linoleoyl-GPC (16:0/18:2)0.930.04340.7972
N2-acetyllysine0.920.04720.7972
sphingomyelin (d18:1/20:1, d18:2/20:0) *0.910.04680.7972
isoleucine0.900.03000.7972
1-palmitoleoyl-2-linoleoyl-GPC (16:1/18:2) *0.900.03310.7972
alanine0.900.04190.7972
myo-inositol0.890.02670.7972
fumarate0.890.03490.7972
1-palmitoyl-2-palmitoleoyl-GPC (16:0/16:1) *0.880.04640.7972
S-adenosylhomocysteine (SAH)0.870.02670.7972
alpha-ketoglutarate0.860.01940.7972
retinol (vitamin A)0.850.02710.7972
glycerophosphorylcholine (GPC)0.830.04900.7972
3-methylcytidine0.800.01700.7972
pyridoxamine phosphate (vitamin B6)0.790.00480.7972
3-aminoisobutyrate0.770.01970.7972
1-palmitoyl-2-oleoyl-GPS (16:0/18:1)0.740.01100.7972
alpha-tocopherol0.730.00210.7866
gluconate0.710.04430.7972
pyrraline0.690.00480.7972
phytosphingosine0.660.04770.7972
genistein0.640.03140.7972
taurocholate0.610.04370.7972
* Identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1).
Table
Table 5. Maternal genotype-based differences in fatty acid beta-oxidation metabolites.
Table 5. Maternal genotype-based differences in fatty acid beta-oxidation metabolites.
PathwayBiochemical NameRatio
WT Fetal
WT Maternal		MSTN+/− Fetal MSTN+/− MaternalMSTN+/− Maternal WT MaternalMSTN+/− Fetal WT FetalMSTN+/− Placenta WT Placenta
Acylcarnitine Medium Chaincis-3,4-methylene heptanoylcarnitine0.39 *0.66 *0.991.67 *1.10
Acylcarnitine Monounsaturatedcis-4-decenoyl carnitine (C10:1)0.21 *0.26 *1.071.36 †1.02
Myristoleoyl carnitine (C14:1) *0.30 *0.35 *1.141.33 †1.09
Acylcarnitine PolyunsaturatedLinolenoyl carnitine (C18:3) *0.43 *0.65 *1.081.64 *1.05
dihomo-linoleoyl carnitine (C20:2) *1.311.76 *1.181.58 †1.0
Arachidonoyl carnitine (C20:4)0.791.061.021.38 †0.98
dihomo-linolenoyl carnitine (C20:3n3 or 6) *1.001.76 *1.021.78 *1.07
docosapentaenoylcarnitine (C22:5n3) *1.94 *2.90 *1.091.62 †1.00
docosahexaenoylcarnitine (C22:6) *0.63 *0.931.021.51 †1.00
CarnitineCarnitine1.021.120.971.061.01
Ratios in bold are significant. *: p < 0.05, †: p > 0.05, <0.1, * identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1).
Table
Table 6. Maternal genotype-based differences in lysophospholipid compounds.
Table 6. Maternal genotype-based differences in lysophospholipid compounds.
PathwayBiochemical NameRatio
WT Fetal
WT Maternal		MSTN+/− Fetal MSTN+/− MaternalMSTN+/− Maternal WT MaternalMSTN+/− Fetal WT FetalMSTN+/− Placenta WT Placenta
Lysophospholipids1-linoleoyl-GPA (18:2) *0.28 *0.591.473.11 †ND
1-arachidonoyl-GPA (20:4)0.571.191.803.76 *ND
1-palmitoyl-GPC (16:0)0.39 *0.5 *1.021.31 *0.98
2-palmitoyl-GPC (16:0) *0.24 *0.33 *0.981.32 *0.94
1-palmitoleoyl-GPC (16:1) *1.74 *2.31 *0.971.29 *0.88
1-stearoyl-GPC (18:0)0.27 *0.38 *0.981.34 *1.01
1-oleoyl-GPC (18:1)1.111.51 *1.041.41 *0.95
1-linoleoyl-GPC (18:2)0.38 *0.54 *0.981.42 *0.92
1-arachidonoyl-GPC (20:4n6) *0.831.081.011.33 †0.83
2-stearoyl-GPE (18:0) *0.28 *0.38 *0.79 †1.040.84
1-oleoyl-GPE (18:1)0.941.63 *0.641.110.98
1-linoleoyl-GPE (18:2) *0.34 *0.5 *0.851.270.82 †
1-arachidonoyl-GPE (20:4n6) *0.65 *0.750.991.160.86 †
1-oleoyl-GPS (18:1)NDNDNDND0.76 †
1-linoleoyl-GPS (18:2) *NDNDNDND0.78 †
1-oleoyl-GPG (18:1) *12.93 *9.59 *1.611.190.82 †
1-linoleoyl-GPG (18:2) *0.981.041.231.3 †0.84
1-arachidonoyl-GPI (20:4) *0.22 *0.26 *1.191.42 *0.88
Ratios in bold are significant. *: p < 0.05, †: p > 0.05, <0.1, * identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1). ND: not different.
Table
Table 7. Maternal genotype-based differences in purine metabolites.
Table 7. Maternal genotype-based differences in purine metabolites.
PathwayBiochemical NameRatio
WT Fetal
WT Maternal		MSTN+/− Fetal MSTN+/− MaternalMSTN+/− Maternal WT MaternalMSTN+/− Fetal WT FetalMSTN+/− Placenta WT Placenta
Purine Metabolism, (Hypo)Xanthine/Inosine containing2′-deoxyinosineNDNDNDND1.5 *
inosine 5′-monophosphate (IMP)15.16 *2.001.000.13 †ND
N1-methylinosine8.01 *7.15 *1.26 †1.121.10
allantoic acid0.41 *0.59 *1.111.61 †ND
Purine Metabolism, Adenine containingadenosine 5′-monophosphate (AMP)68.59 *8.83 *0.930.12 *1.47
adenosine 3′-monophosphate (3′-AMP)6.95 †5.8 *0.780.661.47 †
adenosine 2′-monophosphate (2′-AMP)8.2718.52 *0.220.501.85 †
adenosine11.27 *4.38 *0.750.29 *0.84
N1-methyladenosine3.04 *2.32 *1.000.77 *0.78 †
N6-succinyladenosine30.3516.6 *1.220.67 †0.92
Purine Metabolism, Guanine containingguanosine 5′-monophosphate (5′-GMP)57.36 *36.38 *0.520.33 *0.96
guanosine53.73 *132.89 *0.38 †0.950.95
guanine22.04 *14.46 *1.000.66 *0.89
Ratios in bold are significant. *: p < 0.05, †: p > 0.05, <0.1, * identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1). ND: not different.
Table
Table 8. Differences in branched-chain amino acid metabolites.
Table 8. Differences in branched-chain amino acid metabolites.
PathwayBiochemical NameRatio
WT Fetal
WT Maternal		MSTN+/− Fetal MSTN+/− MaternalMSTN+/− Maternal WT MaternalMSTN+/− Fetal WT FetalMSTN+/− Placenta
WT Placenta
Leucine, isoleucine, and valine metabolisms
N-acetylleucine0.63 *0.890.911.281.08
isovalerate (i5:0)0.831.011.421.73 *ND
isovalerylcarnitine (C5)2.58 *3.96 *0.851.300.91 †
isoleucine1.171.150.990.970.9 *
N-acetylisoleucine0.78 *1.110.921.32 *0.96
2-methylbutyrylglycine0.29 *0.27 *1.571.461.68 †
methylsuccinate0.69 *0.811.361.59 *1.08
Ratios in bold are significant. *: p < 0.05, †: p > 0.05, <0.1, * identification not confirmed by an authentic chemical standard (not Metabolomic Standard Initiative Tier 1). ND: not different.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Opoku, R.; DeCata, J.; Phillips, C.L.; Schulz, L.C. Effect of Genetically Reduced Maternal Myostatin on Late Gestation Maternal, Fetal, and Placental Metabolomes in Mice. Metabolites 2023, 13, 719. https://0-doi-org.brum.beds.ac.uk/10.3390/metabo13060719

AMA Style

Opoku R, DeCata J, Phillips CL, Schulz LC. Effect of Genetically Reduced Maternal Myostatin on Late Gestation Maternal, Fetal, and Placental Metabolomes in Mice. Metabolites. 2023; 13(6):719. https://0-doi-org.brum.beds.ac.uk/10.3390/metabo13060719

Chicago/Turabian Style

Opoku, Ruth, Jenna DeCata, Charlotte L. Phillips, and Laura C. Schulz. 2023. "Effect of Genetically Reduced Maternal Myostatin on Late Gestation Maternal, Fetal, and Placental Metabolomes in Mice" Metabolites 13, no. 6: 719. https://0-doi-org.brum.beds.ac.uk/10.3390/metabo13060719

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop