Glucose-Induced Expression of DAPIT in Pancreatic β-Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Model Cells
2.1.1. Cell Culturing
2.1.2. Silencing
2.2. qRT-PCR
2.2.1. qRT-PCR Protocol
2.2.2. Estimation of mtDNA Copy Number
2.3. Protein Separation Methods and Western Blotting
2.3.1. SDS-Electrophoresis and Western Blotting
2.3.2. Isolation of Mitochondria from INS-1E Cells
2.3.3. Blue-Native and Clear-Native Electrophoresis
2.4. ATP Assay
2.5. High Resolution Respirometry
2.6. Transmission Electron Microscopy
2.7. Experiment with Mice
2.7.1. Mice
2.7.2. Experiments with Hyaluronic Acid Implants
2.8. Statistical Analysis
3. Results
3.1. Expression of DAPIT and Other FO Subunits Varies according to Metabolic State in INS-1E Cells
3.2. Upregulation of DAPIT in Pancreatic β-Cells in Mice
3.3. Glucose Independent but DAPIT-Dependent Mitochondrial Biogenesis in INS-1E Cells
3.4. ATP Levels Correlate with DAPIT Expression Induced by Glucose in INS-1E Cells
3.5. Phosphorylating Respiration of INS-1E Cells at High Glucose Partially Depends on DAPIT
3.6. Insulin Release Is Insignificantly Affected by the Profoundly Decreased DAPIT Expression in INS-1E Cells
3.7. Morphology of Mitochondrial Cristae Does Not Change with DAPIT Deficiency
3.8. Rough Estimation of Stoichiometry for the DAPIT Relatively to the ATP synthase F1α
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ashcroft, F.M.; Rorsman, P. Diabetes Mellitus and the β Cell: The Last Ten Years. Cell 2012, 148, 1160–1171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prentki, M.; Matschinsky, F.M.; Madiraju, S.R.M. Metabolic Signaling in Fuel-Induced Insulin Secretion. Cell Metab. 2013, 18, 162–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maechler, P. Mitochondrial function and insulin secretion. Mol. Cell. Endocrinol. 2013. [Google Scholar] [CrossRef] [PubMed]
- Rutter, G.A.; Pullen, T.J.; Hodson, D.J.; Martinez-Sanchez, A. Pancreatic β-cell identity, glucose sensing and the control of insulin secretion. Biochem. J. 2015, 466, 203–218. [Google Scholar] [CrossRef] [Green Version]
- Ježek, P.; Jabůrek, M.; Holendová, B.; Plecitá-Hlavatá, L. Fatty Acid-Stimulated Insulin Secretion vs. Lipotoxicity. Molecules 2018, 23, 1483. [Google Scholar] [CrossRef] [Green Version]
- Ježek, P.; Jabůrek, M.; Plecitá-Hlavatá, L. Contribution of Oxidative Stress and Impaired Biogenesis of Pancreatic β-Cells to Type 2 Diabetes. Antioxid. Redox Signal. 2019. [Google Scholar] [CrossRef] [Green Version]
- Fex, M.; Nicholas, L.M.; Vishnu, N.; Medina, A.; Sharoyko, V.V.; Nicholls, D.G.; Spégel, P.; Mulder, H. The pathogenetic role of β-cell mitochondria in type 2 diabetes. J. Endocrinol. 2018, 236, R145–r159. [Google Scholar] [CrossRef] [Green Version]
- Plecita-Hlavata, L.; Jaburek, M.; Holendova, B.; Tauber, J.; Pavluch, V.; Berkova, Z.; Cahova, M.; Schroeder, K.; Brandes, R.P.; Siemen, D.; et al. Glucose-Stimulated Insulin Secretion Fundamentally Requires H2O2 Signaling by NADPH Oxidase 4. Diabetes 2020. [Google Scholar] [CrossRef]
- Leturque, A.; Brot-Laroche, E.; Le Gall, M. GLUT2 mutations, translocation, and receptor function in diet sugar managing. Am. J. Physiology. Endocrinol. Metab. 2009, 296, E985–E992. [Google Scholar] [CrossRef]
- Park, J.H.; Kim, S.J.; Park, S.H.; Son, D.G.; Bae, J.H.; Kim, H.K.; Han, J.; Song, D.K. Glucagon-like peptide-1 enhances glucokinase activity in pancreatic beta-cells through the association of Epac2 with Rim2 and Rab3A. Endocrinology 2012, 153, 574–582. [Google Scholar] [CrossRef] [Green Version]
- Kahancová, A.; Sklenář, F.; Ježek, P.; Dlasková, A. Regulation of glucose-stimulated insulin secretion by ATPase Inhibitory Factor 1 (IF1). FEBS Lett. 2018, 592, 999–1009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Špaček, T.; Šantorová, J.; Zacharovová, K.; Berková, Z.; Hlavatá, L.; Saudek, F.; Ježek, P. Glucose-stimulated insulin secretion of insulinoma INS-1E cells is associated with elevation of both respiration and mitochondrial membrane potential. Int. J. Biochem. Cell Biol. 2008, 40, 1522–1535. [Google Scholar] [CrossRef] [PubMed]
- Kahancová, A.; Sklenář, F.; Ježek, P.; Dlasková, A. Overexpression of native IF1 downregulates glucose-stimulated insulin secretion by pancreatic INS-1E cells. Sci. Rep. 2020, 10, 1551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Affourtit, C.; Alberts, B.; Barlow, J.; Carré, J.E.; Wynne, A.G. Control of pancreatic β-cell bioenergetics. Biochem. Soc. Trans. 2018, 46, 555–564. [Google Scholar] [CrossRef] [PubMed]
- Bartley, C.; Brun, T.; Oberhauser, L.; Grimaldi, M.; Molica, F.; Kwak, B.R.; Bosco, D.; Chanson, M.; Maechler, P. Chronic fructose renders pancreatic β-cells hyper-responsive to glucose-stimulated insulin secretion through extracellular ATP signaling. Am. J. Physiol. Endocrinol. Metab. 2019, 317, E25–e41. [Google Scholar] [CrossRef] [Green Version]
- Gerencser, A.A. Metabolic activation-driven mitochondrial hyperpolarization predicts insulin secretion in human pancreatic beta-cells. Biochim. Et Biophys. Acta (Bba) - Bioenerg. 2018, 1859, 817–828. [Google Scholar] [CrossRef]
- Dlasková, A.; Engstová, H.; Špaček, T.; Kahancová, A.; Pavluch, V.; Smolková, K.; Špačková, J.; Bartoš, M.; Hlavatá, L.P.; Ježek, P. 3D super-resolution microscopy reflects mitochondrial cristae alternations and mtDNA nucleoid size and distribution. Biochim. Et Biophys. Acta. Bioenerg. 2018, 1859, 829–844. [Google Scholar] [CrossRef]
- Dlaskova, A.; Spacek, T.; Engstova, H.; Spackova, J.; Schrofel, A.; Holendova, B.; Smolkova, K.; Plecita-Hlavata, L.; Jezek, P. Mitochondrial cristae narrowing upon higher 2-oxoglutarate load. Biochim. Et Biophys. Acta. Bioenerg. 2019, 1860, 659–678. [Google Scholar] [CrossRef]
- Klusch, N.; Murphy, B.J.; Mills, D.J.; Yildiz, O.; Kuhlbrandt, W. Structural basis of proton translocation and force generation in mitochondrial ATP synthase. eLife 2017, 6. [Google Scholar] [CrossRef]
- Gu, J.; Zhang, L.; Zong, S.; Guo, R.; Liu, T.; Yi, J.; Wang, P.; Zhuo, W.; Yang, M. Cryo-EM structure of the mammalian ATP synthase tetramer bound with inhibitory protein IF1. Science 2019, 364, 1068–1075. [Google Scholar] [CrossRef]
- Davies, K.M.; Anselmi, C.; Wittig, I.; Faraldo-Gomez, J.D.; Kuhlbrandt, W. Structure of the yeast F1Fo-ATP synthase dimer and its role in shaping the mitochondrial cristae. Proc. Natl. Acad. Sci. USA 2012, 109, 13602–13607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daum, B.; Walter, A.; Horst, A.; Osiewacz, H.D.; Kuhlbrandt, W. Age-dependent dissociation of ATP synthase dimers and loss of inner-membrane cristae in mitochondria. Proc. Natl. Acad. Sci. USA 2013, 110, 15301–15306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davies, K.M.; Strauss, M.; Daum, B.; Kief, J.H.; Osiewacz, H.D.; Rycovska, A.; Zickermann, V.; Kuhlbrandt, W. Macromolecular organization of ATP synthase and complex I in whole mitochondria. Proc. Natl. Acad. Sci. USA 2011, 108, 14121–14126. [Google Scholar] [CrossRef] [Green Version]
- Strauss, M.; Hofhaus, G.; Schroder, R.R.; Kuhlbrandt, W. Dimer ribbons of ATP synthase shape the inner mitochondrial membrane. EMBO J. 2008, 27, 1154–1160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiko, C.; Davies, K.M.; Shinzawa-Itoh, K.; Tani, K.; Maeda, S.; Mills, D.J.; Tsukihara, T.; Fujiyoshi, Y.; Kuhlbrandt, W.; Gerle, C. Bovine F1Fo ATP synthase monomers bend the lipid bilayer in 2D membrane crystals. eLife 2015, 4, e06119. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Ford, H.C.; Carroll, J.; Douglas, C.; Gonzales, E.; Ding, S.; Fearnley, I.M.; Walker, J.E. Assembly of the membrane domain of ATP synthase in human mitochondria. Proc. Natl. Acad. Sci. USA 2018, 115, 2988–2993. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kontro, H.; Hulmi, J.J.; Rahkila, P.; Kainulainen, H. Cellular and tissue expression of DAPIT, a phylogenetically conserved peptide. Eur. J. Histochem. EJH 2012, 56, e18. [Google Scholar] [CrossRef] [Green Version]
- Kontro, H.; Cannino, G.; Rustin, P.; Dufour, E.; Kainulainen, H. DAPIT Over-Expression Modulates Glucose Metabolism and Cell Behaviour in HEK293T Cells. PLoS ONE 2015, 10, e0131990. [Google Scholar] [CrossRef] [Green Version]
- Ohsakaya, S.; Fujikawa, M.; Hisabori, T.; Yoshida, M. Knockdown of DAPIT (diabetes-associated protein in insulin-sensitive tissue) results in loss of ATP synthase in mitochondria. J. Biol. Chem. 2011, 286, 20292–20296. [Google Scholar] [CrossRef] [Green Version]
- Paivarinne, H.; Kainulainen, H. DAPIT, a novel protein down-regulated in insulin-sensitive tissues in streptozotocin-induced diabetes. Acta Diabetol. 2001, 38, 83–86. [Google Scholar] [CrossRef]
- Nagata, Y.; Yamagishi, M.; Konno, T.; Nakanishi, C.; Asano, Y.; Ito, S.; Nakajima, Y.; Seguchi, O.; Fujino, N.; Kawashiri, M.A.; et al. Heat Failure Phenotypes Induced by Knockdown of DAPIT in Zebrafish: A New Insight into Mechanism of Dilated Cardiomyopathy. Sci. Rep. 2017, 7, 17417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eydt, K.; Davies, K.M.; Behrendt, C.; Wittig, I.; Reichert, A.S. Cristae architecture is determined by an interplay of the MICOS complex and the F1FO ATP synthase via Mic27 and Mic10. Microb. Cell (Grazaustria) 2017, 4, 259–272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rampelt, H.; Bohnert, M.; Zerbes, R.M.; Horvath, S.E.; Warscheid, B.; Pfanner, N.; van der Laan, M. Mic10, a Core Subunit of the Mitochondrial Contact Site and Cristae Organizing System, Interacts with the Dimeric F1Fo-ATP Synthase. J. Mol. Biol. 2017, 429, 1162–1170. [Google Scholar] [CrossRef] [PubMed]
- Barca, E.; Ganetzky, R.D.; Potluri, P.; Juanola-Falgarona, M.; Gai, X.; Li, D.; Jalas, C.; Hirsch, Y.; Emmanuele, V.; Tadesse, S.; et al. USMG5 Ashkenazi Jewish founder mutation impairs mitochondrial complex V dimerization and ATP synthesis. Hum. Mol. Genet. 2018, 27, 3305–3312. [Google Scholar] [CrossRef] [Green Version]
- Siegmund, S.E.; Grassucci, R.; Carter, S.D.; Barca, E.; Farino, Z.J.; Juanola-Falgarona, M.; Zhang, P.; Tanji, K.; Hirano, M.; Schon, E.A.; et al. Three-Dimensional Analysis of Mitochondrial Crista Ultrastructure in a Patient with Leigh Syndrome by In Situ Cryoelectron Tomography. iScience 2018, 6, 83–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.; Zhang, Z.; Zhang, Z.M.; Hao, P.; Ding, K.; Li, Z. Integrated phenotypic screening and activity-based protein profiling to reveal potential therapy targets of pancreatic cancer. Chem. Commun. (Camb. Engl. ) 2019, 55, 1596–1599. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Bueler, S.A.; Rubinstein, J.L. Atomic model for the dimeric F(O) region of mitochondrial ATP synthase. Science 2017, 358, 936–940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ježek, J.; Dlasková, A.; Zelenka, J.; Jabůrek, M.; Ježek, P. H2O2-Activated Mitochondrial Phospholipase iPLA2γ Prevents Lipotoxic Oxidative Stress in Synergy with UCP2, Amplifies Signaling via G-Protein–Coupled Receptor GPR40, and Regulates Insulin Secretion in Pancreatic β-Cells. Antioxid. Redox Signal. 2015, 23, 958–972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merglen, A.; Theander, S.; Rubi, B.; Chaffard, G.; Wollheim, C.B.; Maechler, P. Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 2004, 145, 667–678. [Google Scholar] [CrossRef]
- Alán, L.; Olejár, T.; Cahová, M.; Zelenka, J.; Berková, Z.; Smětáková, M.; Saudek, F.; Matěj, R.; Ježek, P. Delta Cell Hyperplasia in Adult Goto-Kakizaki (GK/MolTac) Diabetic Rats. J. Diabetes Res. 2015, 2015, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Vaghy, P.L.; Matlib, M.A.; Schwartz, A. Phosphate induced swelling, inhibition and partial uncoupling of oxidative phosphorylation in heart mitochondria in the absence of external calcium and the presence of EGTA. Biochem. Biophys. Res. Commun. 1981, 100, 37–44. [Google Scholar] [CrossRef]
- Praveen, S.S.; Hanumantha, R.; Belovich, J.M.; Davis, B.L. Novel hyaluronic acid coating for potential use in glucose sensor design. Diabetes Technol. Ther. 2003, 5, 393–399. [Google Scholar] [CrossRef] [PubMed]
- Hadler, N.M. Enhanced diffusivity of glucose in a matrix of hyaluronic acid. J. Biol. Chem. 1980, 255, 3532–3535. [Google Scholar] [PubMed]
- Plecitá-Hlavatá, L.; Engstová, H.; Alán, L.; Špaček, T.; Dlasková, A.; Smolková, K.; Špačková, J.; Tauber, J.; Strádalová, V.; Malínský, J.; et al. Hypoxic HepG2 cell adaptation decreases ATP synthase dimers and ATP production in inflated cristae by mitofilin down-regulation concomitant to MICOS clustering. FASEB J. 2016, 30, 1941–1957. [Google Scholar] [CrossRef] [Green Version]
- Morgan, D.; Rebelato, E.; Abdulkader, F.; Graciano, M.F.R.; Oliveira-Emilio, H.R.; Hirata, A.E.; Rocha, M.S.; Bordin, S.; Curi, R.; Carpinelli, A.R. Association of NAD(P)H Oxidase with Glucose-Induced Insulin Secretion by Pancreatic β-Cells. Endocrinology 2009, 150, 2197–2201. [Google Scholar] [CrossRef]
- Newsholme, P.; Morgan, D.; Rebelato, E.; Oliveira-Emilio, H.C.; Procopio, J.; Curi, R.; Carpinelli, A. Insights into the critical role of NADPH oxidase(s) in the normal and dysregulated pancreatic beta cell. Diabetologia 2009, 52, 2489–2498. [Google Scholar] [CrossRef] [Green Version]
- Bedard, K.; Krause, K.-H. The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology. Physiol. Rev. 2007, 87, 245–313. [Google Scholar] [CrossRef]
- Li, N.; Li, B.; Brun, T.; Deffert-Delbouille, C.; Mahiout, Z.; Daali, Y.; Ma, X.-J.; Krause, K.-H.; Maechler, P. NADPH Oxidase NOX2 Defines a New Antagonistic Role for Reactive Oxygen Species and cAMP/PKA in the Regulation of Insulin Secretion. Diabetes 2012, 61, 2842–2850. [Google Scholar] [CrossRef] [Green Version]
- Serrander, L.; Cartier, L.; Bedard, K.; Banfi, B.; Lardy, B.; Plastre, O.; Sienkiewicz, A.; Fórró, L.; Schlegel, W.; Krause, K.-H. NOX4 activity is determined by mRNA levels and reveals a unique pattern of ROS generation. Biochem. J. 2007, 406, 105–114. [Google Scholar] [CrossRef] [Green Version]
- Fujikawa, M.; Sugawara, K.; Tanabe, T.; Yoshida, M. Assembly of human mitochondrial ATP synthase through two separate intermediates, F1-c-ring and b-e-g complex. Febs Lett. 2015, 589, 2707–2712. [Google Scholar] [CrossRef] [Green Version]
- Lavie, J.; De Belvalet, H.; Sonon, S.; Ion, A.M.; Dumon, E.; Melser, S.; Lacombe, D.; Dupuy, J.W.; Lalou, C.; Bénard, G. Ubiquitin-Dependent Degradation of Mitochondrial Proteins Regulates Energy Metabolism. Cell Rep. 2018, 23, 2852–2863. [Google Scholar] [CrossRef] [PubMed]
- Swisa, A.; Glaser, B.; Dor, Y. Metabolic Stress and Compromised Identity of Pancreatic Beta Cells. Front. Genet. 2017, 08, 21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Plecitá-Hlavatá, L.; Lessard, M.; Santorová, J.; Bewersdorf, J.; Jezek, P. Mitochondrial oxidative phosphorylation and energetic status are reflected by morphology of mitochondrial network in INS-1E and HEP-G2 cells viewed by 4Pi microscopy. Biochim. Et Biophys. Acta 2008, 1777, 834–846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
‘ | Protein | Sequence |
---|---|---|
Usmg5 | DAPIT | Fw: GATGCCCAATTCCAGTTCAC |
Rev: CCAGGACACATCCATTCTACC | ||
Atp5i | subunit FO e | Fw: CACCGTGGCGCCGTATGCCATGCCG |
Rev: AAACCGGCATGGCATACGGCGGCGCACAC | ||
Atp5j2 | subunit FO f | Fw: GAGAGCTGCCAAGCTGGATA |
Rev: GTCGCCGTTCGTGTTTGAG | ||
Atp5I | subunit FO g | Fw: CACCGCATCCGTAACCTCGCGGACA |
Rev: AAACTGTCCGCGAGGTTACGGATGC | ||
Atp6 | subunit FO a | Fw: CGCCACCCTAGCAATATCAA |
Rev: TTAAGGCGACAGCGATTTCT | ||
Minos1 | Mic10 | Fw: GAACATCCCAGCGGGAGAAA |
Rev: ACTGATGGCACTGTCACAGGA | ||
Atp5f1a | subunit F1 α | Fw: TCCAAGCAGGCT GTTGCTTAC |
Rev: TGT AGGCGGACACATCACCA | ||
Pgc1a | PGC-1α | Fw: GGAGTGACATAGAGTGTGCTG |
Rev: CGCGGGCT ATT GTTGTACT | ||
Actb | Actin | Fw: ATCTGGCACCACACCTTC |
Rev: AGCCAGGTCCAGACGCA | ||
Nd5 of mtDNA | ND5 | Fw: AACTCCCGTCTCTGCCCTAC |
Rev: GGCCTAGTTGGCTGGATGTT | ||
Slco2a1 | SLCO2A1 | Fw: GCAAACTGGGTCATTGCCT |
Rev: CCCTCCAAGAGCCGTTTTCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leguina-Ruzzi, A.; Vodičková, A.; Holendová, B.; Pavluch, V.; Tauber, J.; Engstová, H.; Dlasková, A.; Ježek, P. Glucose-Induced Expression of DAPIT in Pancreatic β-Cells. Biomolecules 2020, 10, 1026. https://0-doi-org.brum.beds.ac.uk/10.3390/biom10071026
Leguina-Ruzzi A, Vodičková A, Holendová B, Pavluch V, Tauber J, Engstová H, Dlasková A, Ježek P. Glucose-Induced Expression of DAPIT in Pancreatic β-Cells. Biomolecules. 2020; 10(7):1026. https://0-doi-org.brum.beds.ac.uk/10.3390/biom10071026
Chicago/Turabian StyleLeguina-Ruzzi, Alberto, Anežka Vodičková, Blanka Holendová, Vojtěch Pavluch, Jan Tauber, Hana Engstová, Andrea Dlasková, and Petr Ježek. 2020. "Glucose-Induced Expression of DAPIT in Pancreatic β-Cells" Biomolecules 10, no. 7: 1026. https://0-doi-org.brum.beds.ac.uk/10.3390/biom10071026