SCRIB Is Involved in the Progression of Ovarian Carcinomas in Association with the Factors Linked to Epithelial-to-Mesenchymal Transition and Predicts Shorter Survival of Diagnosed Patients
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Tissue Samples
2.2. Immunohistochemical Staining in Human Ovarian Carcinoma Tissue
2.3. Cell Lines and Transfection
2.4. Proliferation Assays
2.5. In Vitro Wound Healing and Trans-Chamber Migration and Invasion Assays
2.6. Western Blotting Assay
2.7. Quantitative Reverse-Transcription Polymerase Chain Reaction (qRT-PCR)
2.8. In Vivo Tumorigenic Assay
2.9. Statistical Analysis
3. Results
3.1. The Expression of SCRIB Is Associated with the Progression of Ovarian Carcinomas
3.2. The Expression of SCRIB Is Associated with Shorter Survival of Ovarian Carcinoma Patients in Univariate Analysis
3.3. Nuclear Expression of SCRIB Predicts Shorter Survival of Ovarian Carcinoma Patients in Multivariate Analysis
3.4. The Expression of SCRIB Predicts Shorter Survival of Ovarian Carcinoma Patients Who Received Adjuvant Chemotherapy
3.5. SCRIB Is Associated with the Proliferation and Invasion of Ovarian Cancer Cells
3.6. SCRIB Is Associated with a Change in Expression of Factors Linked to the EMT of Cancer Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Elsum, I.A.; Martin, C.; Humbert, P.O. Scribble regulates an EMT polarity pathway through modulation of MAPK-ERK signaling to mediate junction formation. J. Cell. Sci. 2013, 126, 3990–3999. [Google Scholar] [CrossRef] [Green Version]
- Martin-Belmonte, F.; Perez-Moreno, M. Epithelial cell polarity, stem cells and cancer. Nat. Rev. Cancer 2011, 12, 23–38. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Muthuswamy, S.K. Polarity protein alterations in carcinoma: A focus on emerging roles for polarity regulators. Curr. Opin. Genet. Dev. 2010, 20, 41–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feigin, M.E.; Akshinthala, S.D.; Araki, K.; Rosenberg, A.Z.; Muthuswamy, L.B.; Martin, B.; Lehmann, B.D.; Berman, H.K.; Pietenpol, J.A.; Cardiff, R.D.; et al. Mislocalization of the cell polarity protein scribble promotes mammary tumorigenesis and is associated with basal breast cancer. Cancer Res. 2014, 74, 3180–3194. [Google Scholar] [CrossRef] [Green Version]
- Pearson, H.B.; Perez-Mancera, P.A.; Dow, L.E.; Ryan, A.; Tennstedt, P.; Bogani, D.; Elsum, I.; Greenfield, A.; Tuveson, D.A.; Simon, R.; et al. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia. J. Clin. Invest. 2011, 121, 4257–4267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhan, L.; Rosenberg, A.; Bergami, K.C.; Yu, M.; Xuan, Z.; Jaffe, A.B.; Allred, C.; Muthuswamy, S.K. Deregulation of scribble promotes mammary tumorigenesis and reveals a role for cell polarity in carcinoma. Cell 2008, 135, 865–878. [Google Scholar] [CrossRef] [Green Version]
- Wan, S.; Meyer, A.S.; Weiler, S.M.E.; Rupp, C.; Toth, M.; Sticht, C.; Singer, S.; Thomann, S.; Roessler, S.; Schorpp-Kistner, M.; et al. Cytoplasmic localization of the cell polarity factor scribble supports liver tumor formation and tumor cell invasiveness. Hepatology 2018, 67, 1842–1856. [Google Scholar] [CrossRef] [Green Version]
- Cho, E.S.; Kang, H.E.; Kim, N.H.; Yook, J.I. Therapeutic implications of cancer epithelial-mesenchymal transition (EMT). Arch. Pharm. Res. 2019, 42, 14–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dongre, A.; Weinberg, R.A. New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell. Biol. 2019, 20, 69–84. [Google Scholar] [CrossRef]
- Hussein, U.K.; Ha, S.H.; Ahmed, A.G.; Kim, K.M.; Park, S.H.; Kim, C.Y.; Kwon, K.S.; Zhang, Z.; Lee, S.A.; Park, H.S.; et al. FAM83H and SCRIB stabilize beta-catenin and stimulate progression of gastric carcinoma. Aging (Albany NY) 2020, 12, 11812–11834. [Google Scholar] [CrossRef]
- Hawkins, E.D.; Oliaro, J.; Ramsbottom, K.M.; Newbold, A.; Humbert, P.O.; Johnstone, R.W.; Russell, S.M. Scribble acts as an oncogene in Emu-myc-driven lymphoma. Oncogene 2016, 35, 1193–1197. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Song, L.; Xu, Y.; Zhang, L.; Wu, Y.; Guo, J.; Ji, W.; Li, L.; Zhao, J.; Zhang, X.; et al. Loss of Scribble confers cisplatin resistance during NSCLC chemotherapy via Nox2/ROS and Nrf2/PD-L1 signaling. EBioMedicine 2019, 47, 65–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stewart, B.W.; Wild, C.; International Agency for Research on Cancer; World Health Organization. World Cancer Report 2014; International Agency for Research on Cancer: Lyon, France, 2014. [Google Scholar]
- Du, B.; Shim, J.S. Targeting Epithelial-Mesenchymal Transition (EMT) to Overcome Drug Resistance in Cancer. Molecules 2016, 21, 965. [Google Scholar] [CrossRef] [Green Version]
- Loret, N.; Denys, H.; Tummers, P.; Berx, G. The Role of Epithelial-to-Mesenchymal Plasticity in Ovarian Cancer Progression and Therapy Resistance. Cancers 2019, 11, 838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashrafizadeh, M.; Ang, H.L.; Moghadam, E.R.; Mohammadi, S.; Zarrin, V.; Hushmandi, K.; Samarghandian, S.; Zarrabi, A.; Najafi, M.; Mohammadinejad, R.; et al. MicroRNAs and Their Influence on the ZEB Family: Mechanistic Aspects and Therapeutic Applications in Cancer Therapy. Biomolecules 2020, 10, 1040. [Google Scholar] [CrossRef]
- WHO Classification of Tumours Editorial Board. Female Genital Tumours, 5th ed.; International Agency for Research on Cancer: Lyon, France, 2020. [Google Scholar]
- Amin, M.B.; American Joint Committee on Cancer; American Cancer Society. AJCC Cancer Staging Manual, 8th ed.; American Joint Committee on Cancer; Springer: Chicago, IL, USA, 2017; p. xvii. 1024p. [Google Scholar]
- Therasse, P.; Arbuck, S.G.; Eisenhauer, E.A.; Wanders, J.; Kaplan, R.S.; Rubinstein, L.; Verweij, J.; Van Glabbeke, M.; van Oosterom, A.T.; Christian, M.C.; et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J. Natl. Cancer Inst. 2000, 92, 205–216. [Google Scholar] [CrossRef] [Green Version]
- Allred, D.; Harvey, J.M.; Berardo, M.; Clark, G.M. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod. Pathol. 1998, 11, 155–168. [Google Scholar]
- Kim, K.M.; Hussein, U.K.; Park, S.H.; Kang, M.A.; Moon, Y.J.; Zhang, Z.; Song, Y.; Park, H.S.; Bae, J.S.; Park, B.H.; et al. FAM83H is involved in stabilization of beta-catenin and progression of osteosarcomas. J. Exp. Clin. Cancer Res. 2019, 38, 267. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Ha, S.H.; Moon, Y.J.; Hussein, U.K.; Song, Y.; Kim, K.M.; Park, S.H.; Park, H.S.; Park, B.H.; Ahn, A.R.; et al. Inhibition of SIRT6 potentiates the anti-tumor effect of doxorubicin through suppression of the DNA damage repair pathway in osteosarcoma. J. Exp. Clin. Cancer Res. 2020, 39, 247. [Google Scholar] [CrossRef]
- Niyazi, M.; Niyazi, I.; Belka, C. Counting colonies of clonogenic assays by using densitometric software. Radiat. Oncol. 2007, 2, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonzalez, L.; Agullo-Ortuno, M.T.; Garcia-Martinez, J.M.; Calcabrini, A.; Gamallo, C.; Palacios, J.; Aranda, A.; Martin-Perez, J. Role of c-Src in human MCF7 breast cancer cell tumorigenesis. J. Biol. Chem. 2006, 281, 20851–20864. [Google Scholar] [CrossRef] [Green Version]
- DeLong, E.R.; DeLong, D.M.; Clarke-Pearson, D.L. Comparing the areas under two or more correlated receiver operating characteristic curves: A nonparametric approach. Biometrics 1988, 44, 837–845. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.W.; Ahn, A.R.; Ha, S.H.; Hussein, U.K.; Do Yang, J.; Kim, K.M.; Park, H.S.; Park, S.H.; Yu, H.C.; Jang, K.Y. Expression of FAM83H and ZNF16 are associated with shorter survival of patients with gallbladder carcinoma. Diagn. Pathol. 2020, 15, 63. [Google Scholar] [CrossRef] [PubMed]
- Kapil, S.; Sharma, B.K.; Patil, M.; Elattar, S.; Yuan, J.; Hou, S.X.; Kolhe, R.; Satyanarayana, A. The cell polarity protein Scrib functions as a tumor suppressor in liver cancer. Oncotarget 2017, 8, 26515–26531. [Google Scholar] [CrossRef] [Green Version]
- Santoni, M.J.; Kashyap, R.; Camoin, L.; Borg, J.P. The Scribble family in cancer: Twentieth anniversary. Oncogene 2020, 39, 7019–7033. [Google Scholar] [CrossRef] [PubMed]
- Sinha, D.; Saha, P.; Samanta, A.; Bishayee, A. Emerging Concepts of Hybrid Epithelial-to-Mesenchymal Transition in Cancer Progression. Biomolecules 2020, 10, 1561. [Google Scholar] [CrossRef]
- Kim, K.M.; Park, S.H.; Bae, J.S.; Noh, S.J.; Tao, G.Z.; Kim, J.R.; Kwon, K.S.; Park, H.S.; Park, B.H.; Lee, H.; et al. FAM83H is involved in the progression of hepatocellular carcinoma and is regulated by MYC. Sci. Rep. 2017, 7, 3274. [Google Scholar] [CrossRef] [PubMed]
- Pearson, H.B.; McGlinn, E.; Phesse, T.J.; Schluter, H.; Srikumar, A.; Godde, N.J.; Woelwer, C.B.; Ryan, A.; Phillips, W.A.; Ernst, M.; et al. The polarity protein Scrib mediates epidermal development and exerts a tumor suppressive function during skin carcinogenesis. Mol. Cancer 2015, 14, 169. [Google Scholar] [CrossRef] [Green Version]
- Daulat, A.M.; Wagner, M.S.; Walton, A.; Baudelet, E.; Audebert, S.; Camoin, L.; Borg, J.P. The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/beta-Catenin Signaling Pathway. Proteomics 2019, 19, e1800487. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Lamouille, S.; Derynck, R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res. 2009, 19, 156–172. [Google Scholar] [CrossRef]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamben, I.F.; Rachel, R.A.; Shatadal, S.; Copeland, N.G.; Jenkins, N.A.; Warming, S.; Griep, A.E. Scrib is required for epithelial cell identity and prevents epithelial to mesenchymal transition in the mouse. Dev. Biol. 2013, 384, 41–52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Liu, H.; Bian, Y.; An, J.; Duan, X.; Wan, J.; Yao, X.; Du, C.; Ni, C.; Zhu, L.; et al. Low SCRIB expression in fibroblasts promotes invasion of lung cancer cells. Life Sci. 2020, 256, 117955. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, Z.; Chen, M.; Sun, J.; Zhai, J. Expression and role of hScrib in endometrium, endometriosis, and endometrial adenocarcinoma. Med. Baltim. 2019, 98, e14076. [Google Scholar] [CrossRef] [PubMed]
- Kajiyama, H.; Shibata, K.; Terauchi, M.; Yamashita, M.; Ino, K.; Nawa, A.; Kikkawa, F. Chemoresistance to paclitaxel induces epithelial-mesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int. J. Oncol. 2007, 31, 277–283. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence | Product Size | |
---|---|---|---|
SCRIB | forward | GGGACGACGAGGGCATATTC | 207 |
reverse | CGTTCTCAGGCTCCACCATGC | ||
CTNNB1 (β-catenin) | forward | AAAATGGCAGTGCGTTTAG | 100 |
reverse | TTTGAAGGCAGTCTGTCGTA | ||
CCND1 (Cyclin D1) | forward | GAGGAAGAGGAGGAGGAGGA | 236 |
reverse | GAGATGGAAGGGGGAAAGAG | ||
E-cadherin | forward | CCCGGGACAACGTTTATTAC | 72 |
reverse | ACTTCCCCTTCCTCAGTGAT | ||
N-cadherin | forward | ACAGTGGCCACCTACAAAGG | 201 |
reverse | CCGAGATGGGGTTGATAATG | ||
TGF-β1 | forward | CCCACAACGAAATCTATGACAA | 246 |
reverse | AAGATAACCACTCTGGCGAGTG | ||
SNAL1 (Snail) | forward | ACCCCACATCCTTCTCACTG | 217 |
reverse | TACAAAAACCCACGCAGACA | ||
SMAD2 (Smad2) | forward | ACTAACTTCCCAGCAGGAAT | 97 |
reverse | GTTGGTCACTTGTTTCTCCA | ||
SMAD3 (Smad3) | forward | CGAGAAATGGTGCGAGAAGG | 259 |
reverse | GAAGGCGAACTCACACAGC | ||
GAPDH | forward | AACAGCGACACCCACTCCTC | 258 |
reverse | GGAGGGGAGATTCAGTGTGGT |
Characteristics | No. | nSCRIB | cSCRIB | |||
---|---|---|---|---|---|---|
Positive | p | Positive | p | |||
Age, y | <60 | 69 | 32 (46%) | 0.055 | 30 (43%) | 0.013 |
≥60 | 33 | 22 (67%) | 23 (70%) | |||
CA125 * | Normal | 18 | 3 (17%) | <0.001 | 3 (17%) | 0.001 |
Elevated | 74 | 46 (62%) | 44 (59%) | |||
Stage | I & II | 52 | 21 (40%) | 0.010 | 19 (37%) | 0.001 |
III & IV | 50 | 33 (66%) | 34 (68%) | |||
Cancer size, cm | ≤10 | 67 | 40 (60%) | 0.058 | 41 (61%) | 0.010 |
>10 | 35 | 14 (40%) | 12 (34%) | |||
Lymph node metastasis | Absence | 83 | 43 (52%) | 0.632 | 42 (51%) | 0.566 |
Presence | 19 | 11 (58%) | 11 (58%) | |||
Ascites | Absence | 69 | 30 (43%) | 0.006 | 31 (45%) | 0.040 |
Presence | 33 | 24 (73%) | 22 (67%) | |||
Bilaterality | Unilateral | 58 | 25 (43%) | 0.022 | 25 (43%) | 0.040 |
Bilateral | 44 | 29 (66%) | 28 (64%) | |||
Histologic grade | Low (1) | 26 | 4 (15%) | <0.001 | 4 (15%) | <0.001 |
High (2 and 3) | 76 | 50 (66%) | 49 (64%) | |||
Histologic type | Serous | 73 | 45 (62%) | 0.015 | 49 (67%) | <0.001 |
Mucinous | 20 | 4 (20%) | 3 (15%) | |||
Endometrioid | 5 | 3 (60%) | 0 (0%) | |||
Clear cell | 3 | 2 (67%) | 1 (33%) | |||
Malignant Brenner | 1 | 0 (0%) | 0 (0%) | |||
Platinum-resistance | Absence | 62 | 29 (47%) | 0.006 | 31 (50%) | 0.036 |
Presence | 18 | 15 (83%) | 14 (78%) | |||
cSCRIB | Negative | 49 | 6 (12%) | <0.001 | ||
Positive | 53 | 48 (91%) |
Characteristics | No. | OS | RFS | ||
---|---|---|---|---|---|
HR (95% CI) | p | HR (95% CI) | p | ||
Overall ovarian carcinomas (n = 104) | |||||
Age, y, ≥60 (vs. <60) | 33/102 | 2.763 (1.641–4.717) | <0.001 | 2.338 (1.438–3.802) | <0.001 |
Stage, III & IV (vs. I & II) | 50/102 | 3.286 (1.845–5.853) | <0.001 | 4.206 (2.346–6.908) | <0.001 |
Cancer size, cm, >10 (vs. ≤10) | 35/102 | 0.487 (0.262–0.906) | 0.023 | 0.574 (0.334–0.985) | 0.044 |
LN metastasis, presence (vs. absence) | 19/102 | 1.320 (0.707–2.466) | 0.383 | 1.697 (0.973–2.958) | 0.062 |
Ascites, presence (vs. absence) | 33/102 | 1.967 (1.154–3.353) | 0.013 | 1.914 (1.170–3.131) | 0.010 |
Bilaterality, bilateral (vs. unilateral) | 44/102 | 1.642 (0.969–2.783) | 0.065 | 2.115 (1.297–3.448) | 0.003 |
CA125, elevated (vs. normal) * | 74/92 | 5.083 (1.578–16.376) | 0.006 | 5.009 (1.810–13.861) | 0.002 |
Histologic grade, high (vs. low) | 76/102 | 3.207 (1.444–7.124) | 0.004 | 3.312 (1.631–6.725) | <0.001 |
nSCRIB, positive (vs. negative) | 54/102 | 3.312 (1.820–6.026) | <0.001 | 3.606 (2.082–6.245) | <0.001 |
cSCRIB, positive (vs. negative) | 53/102 | 3.179 (1.747–5.786) | <0.001 | 3.292 (1.917–5.655) | <0.001 |
High-grade serous carcinomas (n = 62) | |||||
Age, y, ≥60 (vs. <60) | 27/62 | 2.139 (1.170–3.911) | 0.013 | 1.689 (0.972–2.934) | 0.063 |
Stage, III & IV (vs. I & II) | 37/62 | 1.822 (0.952–3.486) | 0.070 | 2.831 (1.493–5.366) | 0.001 |
Cancer size, cm, >10 (vs. ≤10) | 14/62 | 0.703 (0.326–1.517) | 0.370 | 0.773 (0.395–1.513) | 0.452 |
LN metastasis, presence (vs. absence) | 14/62 | 1.313 (0.658–2.621) | 0.440 | 1.789 (0.953–3.356) | 0.070 |
Ascites, presence (vs. absence) | 26/62 | 1.342 (0.735–2.450) | 0.338 | 1.391 (0.798–2.427) | 0.245 |
Bilaterality, bilateral (vs. unilateral) | 35/62 | 1.268 (0.684–2.350) | 0.450 | 1.587 (0.887–2.840) | 0.120 |
CA125, elevated (vs. normal) | 52/57 | 2.373 (0.570–9.880) | 0.235 | 1.589 (0.492–5.136) | 0.439 |
nSCRIB, positive (vs. negative) | 42/62 | 2.278 (1.117–4.644) | 0.023 | 1.888 (1.002–3.560) | 0.049 |
cSCRIB, positive (vs. negative) | 45/62 | 2.116 (0.976–4.585) | 0.058 | 1.635 (0.836–3.199) | 0.151 |
Characteristics | OS | RFS | ||
---|---|---|---|---|
HR (95% CI) | p | HR (95% CI) | p | |
Overall ovarian carcinomas (n = 102) * | ||||
Age, y, ≥60 (vs. <60) | 2.254 (1.306–3.890) | 0.004 | 1.654 (1.002–2.730) | 0.049 |
Stage, III & IV (vs. I & II) | 2.218 (1.212–4.059) | 0.010 | 2.802 (1.573–4.990) | <0.001 |
Histologic grade, high (vs. low) | 2.353 (1.071–5.168) | 0.033 | ||
nSCRIB, positive (vs. negative) | 2.252 (1.205–4.207) | 0.011 | 1.768 (0.963–3.245) | 0.066 |
High-grade serous carcinomas (n = 62) ** | ||||
Age, y, ≥60 (vs. <60) | 2.103 (1.150–3.843) | 0.016 | ||
Stage, III & IV (vs. I & II) | 2.831 (1.493–5.366) | 0.001 | ||
nSCRIB, positive (vs. negative) | 2.236 (1.097–4.558) | 0.027 |
Characteristics | No. | OS | RFS | ||
---|---|---|---|---|---|
HR (95% CI) | p | HR (95% CI) | p | ||
Univariate analysis | |||||
Age, y, ≥60 (vs. <60) | 26/80 | 2.805 (1.527–5.153) | 0.001 | 2.152 (1.248–3.713) | 0.006 |
Stage, III & IV (vs. I & II) | 44/80 | 3.213 (1.605–6.433) | <0.001 | 3.709 (1.984–6.934) | <0.001 |
Cancer size, cm, >10 (vs. ≤10) | 26/80 | 0.617 (0.303–1.255) | 0.182 | 0.766 (0.421–1.394) | 0.383 |
LN metastasis, presence (vs. absence) | 17/80 | 1.169 (0.572–2.391) | 0.668 | 1.489 (0.805–2.756) | 0.205 |
Ascites, presence (vs. absence) | 29/80 | 2.306 (1.252–4.247) | 0.007 | 2.045 (1.182–3.537) | 0.010 |
Bilaterality, bilateral (vs. unilateral) | 37/80 | 1.465 (0.796–2.697) | 0.220 | 1.933 (1.113–3.358) | 0.019 |
CA125, elevated (vs. normal) | 65/77 | 10.560 (1.448–77.004) | 0.020 | 7.140 (1.731–29.448) | 0.007 |
Histologic grade, high (vs. low) | 62/80 | 5.150 (1.140–23.276) | 0.033 | 2.693 (1.210–5.991) | 0.015 |
nSCRIB, positive (vs. negative) | 44/80 | 3.352 (1.680–6.688) | <0.001 | 3.598 (1.943–6.664) | <0.001 |
cSCRIB, positive (vs. negative) | 45/80 | 3.334 (1.634–6.801) | <0.001 | 3.182 (1.719–5.890) | <0.001 |
Multivariate analysis | |||||
Age, y, ≥60 (vs. <60) | 2.308 (1.244–4.280) | 0.008 | |||
Stage, III & IV (vs. I & II) | 4.079 (1.672–9.953) | 0.002 | 2.619 (1.343–5.108) | 0.005 | |
Bilaterality, bilateral (vs. unilateral) | 0.436 (0.202–0.942) | 0.035 | |||
nSCRIB, positive (vs. negative) | 2.363 (1.149–4.859) | 0.019 | 2.530 (1.313–4.875) | 0.006 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hussein, U.K.; Ahmed, A.G.; Choi, W.K.; Kim, K.M.; Park, S.-H.; Park, H.S.; Noh, S.J.; Lee, H.; Chung, M.J.; Moon, W.S.; et al. SCRIB Is Involved in the Progression of Ovarian Carcinomas in Association with the Factors Linked to Epithelial-to-Mesenchymal Transition and Predicts Shorter Survival of Diagnosed Patients. Biomolecules 2021, 11, 405. https://0-doi-org.brum.beds.ac.uk/10.3390/biom11030405
Hussein UK, Ahmed AG, Choi WK, Kim KM, Park S-H, Park HS, Noh SJ, Lee H, Chung MJ, Moon WS, et al. SCRIB Is Involved in the Progression of Ovarian Carcinomas in Association with the Factors Linked to Epithelial-to-Mesenchymal Transition and Predicts Shorter Survival of Diagnosed Patients. Biomolecules. 2021; 11(3):405. https://0-doi-org.brum.beds.ac.uk/10.3390/biom11030405
Chicago/Turabian StyleHussein, Usama Khamis, Asmaa Gamal Ahmed, Won Ku Choi, Kyoung Min Kim, See-Hyoung Park, Ho Sung Park, Sang Jae Noh, Ho Lee, Myoung Ja Chung, Woo Sung Moon, and et al. 2021. "SCRIB Is Involved in the Progression of Ovarian Carcinomas in Association with the Factors Linked to Epithelial-to-Mesenchymal Transition and Predicts Shorter Survival of Diagnosed Patients" Biomolecules 11, no. 3: 405. https://0-doi-org.brum.beds.ac.uk/10.3390/biom11030405