Next Article in Journal
What Traits Should Be Measured for Biomass in Kenaf?
Previous Article in Journal
Responses to Salinity in Four Plantago Species from Tunisia
Previous Article in Special Issue
Salinity Stress Affects Photosynthesis, Malondialdehyde Formation, and Proline Content in Portulaca oleracea L.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 7
10.3390/plants10071393
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity and Synergistic Modulation of Salinity Tolerance Genes in Aegilops tauschii Coss

by
Adeel Abbas
,
Haiyan Yu
,
Hailan Cui
and
Xiangju Li
*
Key Laboratory of Weed Biology and Management, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
*
Author to whom correspondence should be addressed.
Plants 2021, 10(7), 1393; https://0-doi-org.brum.beds.ac.uk/10.3390/plants10071393
Submission received: 13 May 2021 / Revised: 13 June 2021 / Accepted: 21 June 2021 / Published: 7 July 2021
(This article belongs to the Special Issue Salinity Stress in Plants and Molecular Responses)
Browse Figures
Review Reports Versions Notes

Abstract

:
Aegilops tauschii Coss. (2n = 2x = 14, DD) is a problematic weed and a rich source of genetic material for wheat crop improvement programs. We used physiological traits (plant height, dry weight biomass, Na+ and K+ concentration) and 14 microsatellite markers to evaluate the genetic diversity and salinity tolerance in 40 Ae. tauschii populations. The molecular marker allied with salinity stress showed polymorphisms, and a cluster analysis divided the populations into different groups, which indicated diversity among populations. Results showed that the expression level of AeHKT1;4 and AeNHX1 were significantly induced during salinity stress treatments (50 and 200 mM), while AeHKT1;4 showed relative expression in roots, and AeNHX1 was expressed in leaves under the control conditions. Compared with the control conditions, the expression level of AeHKT1;4 significantly increased 1.7-fold under 50 mM salinity stress and 4.7-fold under 200 mM salinity stress in the roots of Ae. tauschii. AeNHX1 showed a relative expression level of 1.6-fold under 50 mM salinity stress and 4.6-fold under 200 mM salinity stress compared with the control conditions. The results provide strong evidence that, under salinity stress conditions, AeHKT1;4 and AeNHX1 synergistically regulate the Na+ homeostasis through regulating Na+ transport in Ae. tauschii. AeNHX1 sequestrated the Na+ into vacuoles, which control the regulation of Na+ transport from roots to leaves under salinity stress conditions in Ae. tauschii.

1. Introduction

Soil salinity is one of the major environmental factors which limits the agriculture productivity [1]. It is estimated that more than 6% of the world’s land area has been affected by salinity [2]. The main consequences under salinity stress conditions are an interruption in Na+ homeostasis, abnormality in cellular metabolism, membrane dysfunction, flaws in plant development, impacted photosynthesis, and consequently, slowed plant growth [3,4]. Plants have developed various mechanisms against salinity stress including sequestering Na+ concentration in vacuoles, decreasing Na+ accumulation in the cytosol, and extruding cytoplasmic Na+ out of the cell aided by (bifunctional K:H/Na: H antiporter) NHX1 [5]. Exploring stress mechanisms focuses on stress perception and stress-induced biochemical, physiological, and genetic changes in plants [6,7].
The Ae. tauschii D genome was impaired with Na+ exclusion in bread wheat and increases salinity discriminations. The indicative restricting unidirectional Na+ movement indicates the salt tolerance mechanism in crops [8]. As a result, Na+ is a fundamental strategy for plants to overcome salinity stress, and the related phenotypes, facilitated by different Na+ transport-related genes, including HKT1, play an important role in vital functions in Na+ homeostasis [9]. HKT transporter also interferes with Na+ transport and is involved in Na+ and K+ homeostasis [10]. A higher ratio of K+/Na+ is maintained by a specific Na+ transporter (HKT1;5) to confer salinity tolerance [3]. In Arabidopsis thaliana, the HKT;1 is responsible for Na+ movement in xylem vessels and decreases Na+ concentration in leaves [11]. A high expression level of HKT1;4 in roots boosts the inflow of Na+ in XPCs, which restrains Na+ accumulation in leaves [12]. Proteins located on plasma membranes of surrounding cells remove Na+ from the xylem, thus reducing its transport towards plant leaves [13].
In the regulation of Na+ homeostasis, AeNHX1 plays an essential role by sequestering Na+ into plant vacuoles [14]. It is well documented that overexpression of the AeNHX1 gene plays a vital roles in salinity tolerance of different plant species, such as Arabidopsis thaliana and Oryza sativa [15]. Similarly, the expression of NHX1 is upregulated in A. thaliana under salinity stress conditions [16]. HKT1;4 is active in Zygophyllum xanthoxylum under mild salinity stress. This HKT1;4 leads to the deposition of Na+ into the xylem, which then transmits Na+ to the leaves, and lastly plays a key role in Na+ compartmentalization in the plant leaves [17]. HKT1;4 shows Na+ exclusion from the blades during salt stress. Silencing AeNHX1 changed the typical salt-accumulation characteristics to salt-exclusion, namely, HKT1;4 became more active and unloaded Na+ from the xylem into XPCs, limiting salt accretion in shoots [18]. HKT1;4 transporters confirmed variability in Na+ transport within different cereals [19] (overall, HKT1;4 and NHX1 maintain salt-accumulation features in different plants).
Ae. tauschii is one of the wheat relatives and is an important source of abiotic stress tolerance genes [20]. Ae. tauschii is distributed in the Mediterranean region, present in Syria, Iran, Russia, Kazakhstan, Afghanistan, Pakistan, Turkey, and Iran, and extends eastwards of the Yili Valley of Xinjiang in China [21]. In China, Ae. tauschii has been reported in more than ten provinces, and its growth affects wheat crops on a large scale [22]. Genetic diversity between different Ae. tauschii populations have been verified using various techniques, including simple sequence repeat (SSR) [23]. Mostly, researchers have reported that salt tolerance varies in different crop species and at different developmental stages [24]. The D genome of Ae. tauschii is a rich source of genetic material, and it may serve as a rich source of genes, such as those involved in salt tolerance, for wheat crop varieties [25]. No adequate work has been published to reveal the genetic diversity of Ae. tauschii populations of China through molecular markers allied with salinity stress treatments. Thus, we evaluated the salinity tolerance populations based on physiological parameters and microsatellite markers. We also analyzed the expression profile of AeHKT1;4 and AeNHX1 in Ae. tauschii under different salinity treatments. Then, we created a model to understand the mechanism of salinity tolerance in Ae. tauschii.

2. Results

2.1. Physiological Traits

Analysis of variance of dry weight biomass, plant height, Na+, K+, and K+/Na+ concentration showed significant discrimination when Ae. tauschii populations were exposed to salinity stress conditions compared with control. Salinity stress significantly affected all traits except plant height (cm), while a combination of salinity stress with populations showed significant results in all traits (Table 1). Salinity stress affects all the physiological traits of Ae. tauschii. Moreover, out of 40 populations, ten populations showed lower Na+ concentrations than the rest. Maximum Na+ concentration was recorded in population 12 from Shanxi Province, while the minimum (Figure 1) was recorded 39.3 in population 7 collected from Shandong; under salinity stress conditions, 11 populations from different provinces maintained lower concentrations of Na+ and high dry biomass (Figure 2). These 11 populations maintained higher survival rates under salinity stress treatments (200 mM NaCl). Variations among populations were observed in Na+ and K+ accumulation under salinity stress conditions (Figure 1). Na+ concentration showed variation in Ae. tauschii populations under salinity stress (200 mM NaCl) conditions. Some populations (P) (P.1, P.2, P.4, P.6, P.7, P.8, P.11, P.15, P.17, P.18, P.19, P.23, and P.24) maintain lower concentrations as compared with others. Na+ concentration was recorded 6-fold lower in population 12 (from Shanxi Province) than the mean value of other populations under salinity stress treatments (Figure 1). The plant height of individuals in all populations decreased under salinity stress conditions compared with the plants grown under control conditions.
The data recorded about the minimum and maximum plant height showed variation under salinity stress conditions (Table 2). Some of the populations that survived better under salinity stress conditions had increased plant height compared with the plants grown under control conditions. In addition, a relationship was observed between physiological traits and salinity tolerance; under the salinity stress treatment, dry weight biomass, plant height, Na+, K+, and K+/Na+ concentrations were correlated with salinity tolerance in Ae. tauschii (Table 3).
The linear regression analysis between Na+ concentrations and dry biomass showed that populations (P.) (P.1, P.2, P.3, P.4, P.6, P.8, P.9, P.11, P.15, P.17, P.18, P.19, P.23, and P.24) with higher biomass maintained the lower concentration of Na+. These populations possessed lower Na+ content under salinity stress treatments as compared with other populations included in this study. The regression coefficient between the Na+ concentration and dry biomass was related to salinity tolerance (R2 = 0.62) under salinity stress treatments (Figure 2).

2.2. Molecular Markers

Out of 26 EST-SSR primers used, 14 primers created a clear pattern and showed polymorphism in 40 populations. A total of 60 alleles were amplified using the 14 primers, with an average of 4.28 alleles per primer. (Table 4). Eight alleles were amplified in Xgwm 410, Xgwm 312, and Xgwm 3 primers. The maximum polymorphism information content (PIC) was recorded at 0.92 in primer Xgwm 410, with an average of 0.39. The highest major allele frequency was 0.98 in the Xgwm 609 primer, with an average of 0.68. On the basis of phylogenetic analysis (Figure 3), 40 populations of Ae. tauschii were divided into four groups; populations with similar genetic relationships were present in the same group. Group I had six, group II had fourteen, and group III and IV had ten populations in each group. Furthermore, the populations that showed superior tolerance under salinity stress conditions were present in the same cluster and showed a similar genetic relationship. Populations (P.1, P.2, P.7, P.8, P.9, P.15, P.16, P.18, P.19, P.23, P.24) that showed salinity tolerance based on physiological response were present in the same group, which showed a close relationship between these populations. The circle indicated that salinity tolerance populations based on physiological parameters were present in the same group, which showed a close relationship between these populations.

2.3. HKT1;4 and NHX1 Expression in Ae. tauschii Shoots and Roots

We determined the tissue-specific expression levels of AeHKT1;4 and AeNHX1 in Ae. tauschii roots and leaves under control conditions. We performed real-time PCR to analyze the relative expression pattern of these two genes. The expression level of AeHKT1;4 showed high values in roots compared with leaves (Figure 4A,B). The relative expression level of AeNHX1 was higher in leaves as compared with roots.

2.4. Expression Patterns of HKT1;4 in Roots

The expression pattern of AeHKT1;4 was investigated in roots under different salinity stress treatments (Figure 5) in 10 Ae. tauschii populations. Under 50 and 200 mM NaCl conditions, the expression pattern of AeHKT1;4 was significantly induced compared to the control. The expression level of AeHKT1;4 was induced under 50 mM NaCl, and 1.2, 1.7, 1.1, 1.4, 1.8, 1.2, 1.4, 1.2, 1.4, and 1.8-fold changes were recorded compared with control conditions. The expression pattern of AeHKT1;4 was significantly induced under 200 mM NaCl, and 5.6, 5.9, 4.8, 5.8, 4.6, 5.1, 6.1, 4.5, 4.2, and 4.3-fold changes were recorded compared with control conditions.

2.5. Expression Patterns of NHX1 in Leaves

The expression level of AeNHX1 in leaves was investigated under different salinity stress conditions (Figure 6). Under 50 and 200 mM NaCl conditions, the expression pattern of NHX1 was significantly induced, and 11 populations were used in this experiment. The expression profile of AeNHX1 showed substantial changes under 50 and 200 Mm NaCl. Conspicuously, in the salinity stress treatment of 200 mM NaCl, the expression level of NHX1 was higher than the expression level of AeNHX1 in the 50 mM NaCl treatment. The expression level of AeNHX1 was 1.5, 1.2, 1.2, 1.2, 1.3, 1.4, 1.1, 1.4, 1.2, and 1.4-fold higher under 50 mM compared with control conditions. The expression level of NHX1 under 200 mM significantly induced 5.9, 4.3, 5.3, 4.8, 5.4, 5.8, 4.8, 4.9, 5.9, and 4.2-fold higher compared with control conditions.

3. Discussion

3.1. Perspectives about Salinity Tolerance and Genetic Diversity in Ae.tauschii

In this study, we investigated the physiological parameters and microsatellite markers (allied with salinity tolerance) were investigated under control and salinity stress conditions in Ae. tauschii. Our results indicated that all physiological parameters were significantly affected by salinity stress conditions. The most salt-tolerant populations were identified on the basis of dry weight biomass and Na+ concentration of leaves under salinity stress conditions. Biomass production in crop plants is one of the most critical and an important factors used to categorize salinity tolerant populations [26]. Eleven populations showed more salinity tolerance compared to the other populations under salinity stress conditions. This may be due to the combined effect of salinity stress and waterlogging conditions in some areas, which may increase in some populations that survived better under hypersaline conditions [27]. The authors [28] have studied Aegilops cylindrica populations collected from different countries under salinity stress (400 mM NaCl) treatments. These data illustrate the effects of natural selection on the adaptation of these populations under salinity stress conditions. The gene pool of these ten populations is highly enriched for wheat crop improvement.
Our study’s salinity tolerant populations showed lower dry weight biomass and higher concentrations of Na+ under salinity stress conditions among 40 populations. This could be attributed to natural selection, which may have led to the adaptation of these populations to salinity stress conditions. These populations were collected from saline habitats, which support the salinity tolerance of these populations. This phenomenon also explains why most populations that can tolerate salinity have redeveloped mechanisms to thrive in a saline environment. The mechanisms by which plants tolerate salinity stress are the following: (1) osmotic adjustment, (2) attenuation of salt concentration in the plant body through excretion (salt glands) and exclusion (from roots to leaves), and (3) preventing harmful effects on the plant body via compartmentalization [29,30]. A crop plant that maintains low Na+ concentration and high dry weight biomass has more salinity tolerance than other populations [31,32]. The present study also reported salt excretion in Ae. tauschii populations. Wild relatives of wheat perform better under salinity stress; thus, they can be considered halophytes [33,34].
Microsatellite markers were analyzed to detect genetic diversity among 40 populations of Ae. tauschii. The PIC values range from 0.05 to 0.92, showing variation among these populations. Sixty alleles were amplified in fourteen primers, with an average of 4.28 alleles identified per primer. The results obtained in this study were confirmed by a previous study that reported an average of 9.21 alleles per primer and ranged 6–15 alleles per primer that were achieved by SSR markers [35]. The PIC value shows variation because it depends on GT content, the number of alleles per locus, and the type of motifs. The results of the cluster analysis divided the Ae. tauschii populations into different groups, which showed genetic variation among these populations. During cluster analysis, populations that showed salinity tolerance were present in one group.
Additionally, the microsatellite salinity tolerance markers Xgwm 312 and Xgwm 410 showed polymorphism in Ae. tauschii populations. The microsatellite marker Xgwm 410 has been previously reported to be linked with salinity tolerance (sodium excretion gene (NAX2) from xylem to root). The microsatellite markers Xgwm 312 and Xgwm 410 are linked with salinity tolerance and associated with the salinity tolerance gene HKT1;5 and HKT1;4 in wheat crops [36,37]. Furthermore, HKT1;5 and HKT1;4 are very important for salinity in crops. It was concluded that populations surviving better under high salinity conditions have variability from the normal population. Variability in Ae. tauschii populations under salinity stress conditions are vital and helpful for plant breeding.

3.2. Role and Expression Pattern of Salinity Tolerance Genes in Ae. tauschii

The gene conferring salinity tolerance mapped to the distal end of chromosome 5AL in wheat corresponds to a Na+ transporter with HKT1;4, while Ae. tauschii is the ancestor of the wheat crop and shares the DD genome [38]. In addition, it supports the availability of a salinity tolerance gene (Na+ exclusion). Another marker in our study (Xgwm 312) allied with salinity tolerance and closely linked with the gene (HKT1;4). HKT1;4 decreased the rate of Na+ movement from roots to shoots and reduced Na+ quantity in leaf cells [39]. Furthermore, it showed that the DD genome of Ae. tauschii acquired a locus related to the HKT1;4. HKT plays an important role in regulating Na+ and K+ transport and maintaining their homeostasis in plants [40]. HKT family genes were recognized as Na+ transporters in rice and wheat plants and arbitrate Na+ reclamation from xylem HKT1;5 is also expressed in parenchyma cells close to xylem cells to prevent Na+ overaccumulation in shoots by blocking Na+ transport to leaves. [41]. Furthermore, AeHKT1;1 unloaded the Na+ from the xylem vessels that decreased the Na+ concentration in plant leaves, and showed high root expression compared to leaves. HKT1;4 is regulated by salinity and showed high expression levels in roots but not in leaves of Triticum monococcum and Triticum aestivum [42]
HKT family proteins in wheat and rice, encoded by HKT1;4 and HKT1;5 are acknowledged as Na+ transporters and facilitate Na+ reclamation from the xylem in wheat and rice. The voltage-clamp investigation showed that to avoid the Na+ accumulation in leaves, HKT1;5 removes excessive Na+ from the xylem sap of roots. Likewise, AeHKT1;1 played a significant role in preventing Na+ toxicity by removing Na+ directly from xylem vessels, consequently decreasing Na+ content in leaves and roots [43]. Similar results have been found for NAX2 and KNA1 to prevent Na+ movement from xylem to leaves. Previous studies reported that NHXs play an important role in Na+ sequestering and decrease the concentration of cytoplasmic vacuoles in many plants [44]. Overexpression of ZxNHX significantly increased the salt tolerance in Lotus corniculatus by increasing Na+ concentration [45]. NAX2 and KNA1 were found to be expressed in the roots of T. monococcum and T. aestivum, respectively, but not in the leaves, and expression levels were upregulated under salinity stress treatments [13].
Similarly, HKT1;4 expressed in the roots of Ae. tauschii showed high expression under salinity stress conditions (200 mM), implying that HKT1;5 played an imperative role in Na+ unloading from xylem cells of roots under salinity stress conditions. The authors [46] reported that when barley was sown under salinity stress conditions, the maximum Na+ concentration was reached in plant vacuoles, which synchronized HKT to remove Na+ from the xylem. Our results also showed that Na+ accumulation significantly increased in Ae. tauschii leaves under salinity stress conditions; these stress conditions strongly induced the expression of HKT1;4, thus facilitating the removal of excess Na+ from the roots and subsequently alleviating the Na+ toxicity in plants. Under salinity stress conditions, one of the fundamental strategies in plants is to reduce the Na+ concentration in the cytoplasm through Na+ sequestering into vacuoles [47,48].

3.3. Synergistic Model of Salinity Tolerance in Ae. tauschii

NHX1 is an omnipresent transmembrane protein that plays an imperative function in compartmentalizing Na+ into vacuoles to sustain the Na+ homeostasis, increasing salinity salt tolerance in plants [49]. The transcript level of NHX1 in leaves was noticeably increased under salinity stress conditions in many studies. The transcript level of McNHX1 increased in the leaves of Mesembryanthemum crystallinum, cotton, and chrysanthemum under salinity stress conditions but not in the roots [16,50]. A similar trend was observed in Z. xanthoxylum and D. morifolium leaves, and a previous study showed a positive correlation between NHX1 and Na+ accumulation under salinity stress conditions [51]. In our results, AeNHX1 in leaves was pointedly regulated after the 50 and 200 mM NaCl treatments and showed 1.7- and 4.8-folds changes, respectively, compared with the control conditions (Figure 7. Under lower salinity stress conditions (50 mM NaCl), AeNHX1 in leaves compartmentalized of Na+ in vacuoles and sequestering Na+ would increase loading into xylem by AeHKT1;4. Thus; Na+ could transport in leaves by the transportation stream; under high salinity stress conditions (200 mM NaCl), Na+ rapidly and unremittingly sequesters in vacuoles of leaves by AeNHX1. The vacuole capacity becomes saturated by sequestering Na+, which restricted the Na+ transport from roots and induced the expression level of AeHKT1:4 and assists in unloading excessive Na+ from the xylem. It also predicted that under the lower concentration of salinity stress, Na+ accumulates in plant leaves, and perhaps its concentration is sequestered until vacuole capacity is reached [52]. While under high salinity stress conditions, Na+ accumulates in Ae. tauschii leaves, which may be why NHX1 showed high expression compared with control conditions.
Many genes conferring tolerance to salinity stress conditions have been identified in plants. Under salinity stress conditions, plants have complex genetic regulatory mechanisms related to the control of Na+ transport and extrusion of Na+ from the vacuoles [53]. HKT1;4, and NHX1 were found to be involved in Na+ transport and played an important role in salinity stress tolerance. However, HKT1;4 and NHX1 have the opposite role in Na+ regulation in roots and leaves. In plants, Na+ influx and efflux across the plasma membrane of xylem cells contribute to Na+ homeostasis [17]. Similarly, in Z. xanthoxylum, NHXI regulated the Na+ accumulation in vacuoles and the Na+ transport in the plasma membrane of xylem vessels [18]. Furthermore, Ae. tauschii showed lower Na+ uptake under salinity stress conditions. In the 50 mM NaCl treatment, Ae. tauschii NHX1 was induced (Figure 6), following which, Na+ was slowly compartmentalized into vacuoles. The high expression level of NHX1 in leaves showed a large concentration of Na+ sequestered in plant vacuoles. AeHKT1;4 showed a high expression level in roots under salinity stress treatments compared with the control conditions. Under salinity stress conditions, Na+ accumulation in leaves was lower because of the sequestration of Na+ by NHX1. HKT1;4 also compensates and becomes involved in Na+ loading into the xylem [17].

4. Materials and Methods

Forty populations of Ae. tauschii collected from five different provinces of China were used in this experiment. Seeds were sown in plastic pots containing gravel under greenhouse conditions. The excess water passed through the hole at the bottom of each pot and collected on the plate underneath. Initially, tap water was applied, and after one week at the second leaf stage, irrigated water was replaced with Hoagland nutrient solution. The Hoagland nutrient solution was added in five gradual steps until the final salt concentrations reached 300 mM NaCl. The study was designed as a randomized complete block with a split arrangement design under salinity treatments (0 and 300 mM NaCl), and 40 populations (Table S1) from different parts of China were used as a subplot. Three plants were maintained in each pot. After three weeks of treatments, data regarding plant height (cm) and dry weight biomass (g) were recorded. Na+ and K+ concentrations in leaves were measured by flame photometer (Jenway PFP7, Stone, Staffordshire, UK).

4.1. Molecular Markers

For SSR analysis, plant leaves were harvested and stored at −80 °C for DNA isolation. DNA was isolated from leaves using a plant kit (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). The DNA concentration and quality were checked using 1% agarose gel electrophoresis and a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), respectively. Moreover, the DNA concentration was diluted to 30–50 ng μL−1 using TE buffer. Out of 26 primers pairs, 14 were used (salinity tolerance SSR primers) for SSR. Polymerase chain reactions (PCRs) were carried out in a 20 μL reaction mixture containing 10 μM PCR MasterMix (0.1 U Taq polymerase μL−1, 5.0 × 10−4 mol L−1 dNTPs, 2.0 × 10−2 mol L−1 Tris-HCl (pH 8.3), 0.1 mol L−1 KCl, 3.0 × 10−3 mol L−1 MgCl; Tiangen, Beijing, China), 40 ng of genomic DNA (1 μL), and 0.6 μM of each forward and reverse primer (7.8 μM). The PCR program consisted of denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 45−60 °C (primer temperature) for 30 s, and 72 °C for 2 min, with a final extension at 72 °C for 10 min. Amplified PCR products were separated on 0.9% electrophoreses gels, and the vertical device was used for simple sequence repeats.
The SSR primers with high polymorphism and specific amplification were selected for further study. Among these SSR markers, 14 primers pair were screened and labeled with the fluorescent dyes 6-FAM or HEX by Invitrogen Biotechnology Co., Ltd. (Shanghai, China) (Table 5). Each primer’s annealing temperature was optimized accordingly, and PCR products were verified using 1.5% agarose gel electrophoreses. Primers that displayed polymorphism were screened and labeled with fluorescent dyes; the HUM-STR method was applied for electrophoreses analysis (capillary temperature 60 °C; sample injection 2 KV for 30 s; electrophoresis 4.8 kV, run times: 65 min).

4.2. RNA Extraction and cDNA Synthesis

Total RNA was extracted using RNA Plant Kit (Tiangen Biotech Beijing Co., Ltd., Beijing, China). The purity and concentration of RNA were detected using a NanoDropTM spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA synthesis was performed according to the instructions of TransScript Green miRNA Two-Step qRT-PCR SuperMix (Transgenic, Beijing, China). General cDNA was synthesized using the Fast Quant RT kit (Tiangen Biotech Beijing Co., Ltd., Beijing, China) with 1 μg of total RNA and a total volume of 20 μL. The samples were stored at −80 °C until used.

4.3. qPCR Analysis

Primer pairs for AeACTIN, AeHKT1;4 and AeNHX1 were designed using the software Beacon designer with a maximum amplification length of 129 bp (Table 6), an optimal temperature of 55–60 °C, a primer length of 18–22 bp, and a GC percentage of 40–60%. The expression level of AeHKT1;4 and AeNHX1 were analyzed in leaves and roots of Ae. tauschii under different salinity treatments (50 and 200 mM NaCl). We used 11 populations that perform better under salinity stress conditions. An ABI 7500 qPCR machine was used to detect the gene expression using SYBR green (Applied Biosystems, California, USA). The reaction was conducted in a total volume of 20 μL PCR mix, containing 10 μL Power SYBR Green PCR Master Mix, 1 μL of cDNA, 0.6 μL of each primer, 0.6 μL dye, and 7.8 μL of ddH2O. The cycling conditions for the qRT-PCR were set to the following: 10 min at 95 °C, 40 cycles of 95 °C for 15 s and 57–58 °C for 32 s; to obtain a melting curve, the temperature was increased by 0.5 °C every 5 s. The qPCR assays were performed with three technical and biological replicates.

4.4. Data Analysis

Analysis of variance (ANOVA) was carried out to examine the effects of NaCl treatments (0 and 300 mM). The statistical analysis of physiological traits and regression analysis between salinity tolerance and Na+ concentrations in 40 Ae. tauschii populations were conducted by SAS version 9.3 (SAS Institute 2011). The amplified production using fluorescent SSR primers was detected using an ABI PRISM 3730xl DNA sequencer with GS500 (Applied Biosystems, USA) as an internal size standard. GeneMarker version 2.2.0 (Applied Biosystems) was used to determine the allele size. Power marker 3.1 was used to calculate allele frequency, gene diversity, and polymorphism information content. The unweighted pair group method with an arithmetic average (UPGMA) was used to determine the genetic relationships among populations using genetic similarity coefficient values. A cluster analysis was conducted using software (Power marker MEGA 3.5). The relative expression level of salinity tolerance genes (AeHKT1;4 and AeNHX1) were calculated using the 2−ΔΔCt method.

5. Conclusions

The present study results determined that Na+ movement and exclusion is one of the most imperative physiological attributes of Ae. tauschii under salinity stress conditions. Ae. tauschii showed salinity tolerance and performed well under salinity stress conditions. Microsatellite markers allied with salinity tolerance showed polymorphism and diversity between these populations. The microsatellite markers Xgwm 410 and Xgwm 312 allied with salinity tolerance and showed linkage with salinity tolerance genes (HKT1;4, HKT1:5). Our results showed that HKT1;4 and NHX1 were synergistically involved in the regulation of Na+ by maintaining Na+ homeostasis and controlling the Na+ movement under salinity stress conditions in Ae. tauschii. Under mild salinity stress conditions, AeNHX1 in leaves compartmentalizes the Na+ into vacuoles very slowly, and the Na+ concentration starts sequestering in vacuoles, increasing the Na+ loading into vacuoles by AeHKT1;4. However, under high salinity stress conditions, Na+ was increased rapidly and sequestered into vacuoles by AeNHX1, and Na+ saturated the leaf vacuoles, restricting the Na+ transport from roots to leaves and provoking the expression pattern of AeHKT1;4. Further, this led to the excessive unloading of Na+ from the xylem to alleviate the Na+ toxicity from photosynthetic tissues (Figure 7).
In summary, AeNHX1 and AeHKT1;4 played an important role in synergistically regulating Na+ and controlled the Na+ transport in Ae. tauschii under salinity stress conditions. Therefore, this synergistic model of salinity is very important and an essential prospect for future application. The salt exclusion mechanism in Ae. tauschii has a close genetic relationship with cereal crops (e.g., wheat, barley), so these genes conferring salinity tolerance from Ae. tauschii have the potential to be used in the breeding of salt-tolerant cultivars.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/plants10071393/s1, Table S1: populations information.

Author Contributions

Conceptualization, design, X.L.; Methodology, A.A., H.Y. and H.C.; Software, H.Y. and A.A.; Writing—original draft, A.A. and H.Y.; Writing—reviewing and editing, X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the National Key Research and Development Program of China (2016YFD0300701) and the earmarked fund for the China Agriculture Research System (CARS-25).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in Table S1: Supplementary material.

Acknowledgments

We thank the Plant Protection and Quarantine Stations of each county in Henan, Shandong, Hebei, Shaanxi, Shanxi, Hubei, Anhui, Jiangsu, Sichuan, and Xinjiang provinces, as well as in Beijing and Tianjin, for providing a random countryside survey of Ae. tauschii.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gu, M.; Li, N.; Shao, T.; Long, X.; Brestič, M.; Shao, H.; Li, J. Accumulation capacity of ions in cabbage (Brassica oleracea L.) supplied with sea water. Plant Soil Environ. 2016, 62, 314–320. [Google Scholar]
  2. Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [Green Version]
  3. Almeida, D.M.; Oliveira, M.M.; Saibo, N.J. Regulation of Na+ and K+ homeostasis in plants: Towards improved salt stress tolerance in crop plants. Genet. Mol. Biol. 2017, 40, 326–345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Vahdati, K.; Lotfi, N. Abiotic stress tolerance in plants with emphasizing on drought and salinity stresses in walnut. In Abiotic Stress-Plant Responses and Applications in Agriculture; InTech: Rijeka, Croatia, 2013; pp. 307–365. [Google Scholar]
  5. Hamed, K.B.; Ellouzi, H.; Talbi, O.Z.; Hessini, K.; Slama, I.; Ghnaya, T.; Bosch, S.M.; Savouré, A.; Abdelly, C. Physiological response of halophytes to multiple stresses. Funct. Plant Biol. 2013, 40, 883–896. [Google Scholar] [CrossRef] [PubMed]
  6. Kumar, S.; Singh, A.K.; Mohapatra, T. Epigenetics: History, present status and future perspective. Indian J. Genet. Plant Breed. 2017, 77, 445–463. [Google Scholar] [CrossRef]
  7. Majumdar, R.; Lebar, M.; Mack, B.; Minocha, R.; Minocha, S.; Carter-Wientjes, C.; Sickler, C.; Rajasekaran, K.; Cary, J.W. The Aspergillus flavus Spermidine synthase (spds) gene, is required for normal development, aflatoxin production, and pathogenesis during infection of maize kernels. Front. Plant Sci. 2018, 9, 317. [Google Scholar] [CrossRef] [Green Version]
  8. Wang, C.M.; Zhang, J.L.; Liu, X.S.; Li, Z.; Wu, G.Q.; Cai, J.Y.; Flowers, T.J.; Wang, S.M. Puccinellia tenuiflora maintains a low Na+ level under salinity by limiting unidirectional Na+ influx resulting in a high selectivity for K+ over Na+. Plant Cell Environ. 2009, 32, 486–496. [Google Scholar] [CrossRef] [PubMed]
  9. Assaha, D.V.; Ueda, A.; Saneoka, H.; Al-Yahyai, R.; Yaish, M.W. The role of Na+ and K+ transporters in salt stress adaptation in glycophytes. Front. Physiol. 2017, 8, 509. [Google Scholar] [CrossRef]
  10. Ali, A.; Raddatz, N.; Pardo, J.M.; Yun, D.J. HKT sodium and potassium transporters in Arabidopsis thaliana and related halophyte species. Physiol. Plant. 2020. [Google Scholar] [CrossRef]
  11. Wang, Q.; Guan, C.; Wang, P.; Ma, Q.; Bao, A.-K.; Zhang, J.-L.; Wang, S.-M. The Effect of AtHKT1; 1 or AtSOS1 mutation on the expressions of Na+ or K+ transporter genes and ion homeostasis in Arabidopsis thaliana under salt stress. Int. J. Mol. Sci. 2019, 20, 1085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Møller, I.S.; Gilliham, M.; Jha, D.; Mayo, G.M.; Roy, S.J.; Coates, J.C.; Haseloff, J.; Tester, M. Shoot Na+ exclusion and increased salinity tolerance engineered by cell type–specific alteration of Na+ transport in Arabidopsis. Plant Cell 2009, 21, 2163–2178. [Google Scholar] [CrossRef] [Green Version]
  13. Munns, R.; James, R.A.; Xu, B.; Athman, A.; Conn, S.J.; Jordans, C.; Byrt, C.S.; Hare, R.A.; Tyerman, S.D.; Tester, M.; et al. Wheat grain yield on saline soils is improved by an ancestral Na+ transporter gene. Nat. Biotechnol. 2012, 30, 360–364. [Google Scholar] [CrossRef] [PubMed]
  14. Bassil, E.; Coku, A.; Blumwald, E. Cellular ion homeostasis: Emerging roles of intracellular NHX Na+/H+ antiporters in plant growth and development. J. Exp. Bot. 2012, 63, 5727–5740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Rajagopal, D.; Agarwal, P.; Tyagi, W.; Singla-Pareek, S.L.; Reddy, M.K.; Sopory, S. Pennisetum glaucum Na+/H+ antiporter confers high level of salinity tolerance in transgenic Brassica juncea. Mol. Breed. 2007, 19, 137–151. [Google Scholar] [CrossRef]
  16. Zhang, H.; Liu, Y.; Xu, Y.; Chapman, S.; Love, A.J.; Xia, T. A newly isolated Na+/H+ antiporter gene, DmNHX1, confers salt tolerance when expressed transiently in Nicotiana benthamiana or stably in Arabidopsis thaliana. Plant Cell Tissue Organ Cult. (PCTOC) 2012, 110, 189–200. [Google Scholar] [CrossRef]
  17. Zhang, W.-D.; Wang, P.; Bao, Z.; Ma, Q.; Duan, L.-J.; Bao, A.-K.; Zhang, J.-L.; Wang, S.-M. SOS1, HKT1;5, and NHX1 synergistically modulate Na+ homeostasis in the halophytic grass Puccinellia tenuiflora. Front. Plant Sci. 2017, 8, 576. [Google Scholar]
  18. Yuan, H.-J.; Ma, Q.; Wu, G.-Q.; Wang, P.; Hu, J.; Wang, S.-M. ZxNHX controls Na+ and K+ homeostasis at the whole-plant level in Zygophyllum xanthoxylum through feedback regulation of the expression of genes involved in their transport. Ann. Bot. 2015, 115, 495–507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Jabnoune, M.; Espeout, S.; Mieulet, D.; Fizames, C.; Verdeil, J.-L.; Conéjéro, G.; Rodríguez-Navarro, A.; Sentenac, H.; Guiderdoni, E.; Abdelly, C. Diversity in expression patterns and functional properties in the rice HKT transporter family. Plant Physiol. 2009, 150, 1955–1971. [Google Scholar] [CrossRef] [Green Version]
  20. Huang, S.; Spielmeyer, W.; Lagudah, E.S.; Munns, R. Comparative mapping of HKT genes in wheat, barley, and rice, key determinants of Na+ transport, and salt tolerance. J. Exp. Bot. 2008, 59, 927–937. [Google Scholar] [CrossRef] [Green Version]
  21. Wei, H.; Li, J.; Peng, Z.; Lu, B.; Zhao, Z.; Yang, W. Relationships of Aegilops tauschii revealed by DNA fingerprints: The evidence for agriculture exchange between China and the West. Prog. Nat. Sci. 2008, 18, 1525–1531. [Google Scholar] [CrossRef]
  22. Abbas, A.; Yu, H.; Cui, H.; Li, X. Effect of drought stress on chlorophyll fluorescence, and biomass portioning of Aegilops tauschii L. Appl. Ecol. Environ. Res. 2019, 17, 1071–1082. [Google Scholar] [CrossRef]
  23. Abbas, A.; Yu, H.Y.; Cui, H.L.; Li, X.J. Assessment of the genetic diversity in Aegilops tauschii (coss.) By using ssr markers and morphysiological traits. Appl. Ecol. Environ. Res. 2020, 18, 7011–7020. [Google Scholar] [CrossRef]
  24. Al-Ashkar, I.; Alderfasi, A.; Ben Romdhane, W.; Seleiman, M.F.; El-Said, R.A.; Al-Doss, A. Morphological and genetic diversity within salt tolerance detection in eighteen wheat genotypes. Plants 2020, 9, 287. [Google Scholar] [CrossRef] [Green Version]
  25. Hsam, S.; Kieffer, R.; Zeller, F. Significance of Aegilops tauschii glutenin genes on breadmaking properties of wheat. Cereal Chem. 2001, 78, 521–525. [Google Scholar] [CrossRef]
  26. Mbarki, S.; Skalicky, M.; Vachova, P.; Hajihashemi, S.; Jouini, L.; Zivcak, M.; Tlustos, P.; Brestic, M.; Hejnak, V.; Zoghlami Khelil, A. Comparing Salt Tolerance at Seedling and Germination Stages in Local Populations of Medicago ciliaris L. to Medicago intertexta L. and Medicago scutellata L. Plants 2020, 9, 526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Kamran, M.; Parveen, A.; Ahmar, S.; Malik, Z.; Hussain, S.; Chattha, M.S.; Saleem, M.H.; Adil, M.; Heidari, P.; Chen, J.-T. An overview of hazardous impacts of soil salinity in crops, tolerance mechanisms, and amelioration through selenium supplementation. Int. J. Mol. Sci. 2020, 21, 148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Arabbeigi, M.; Arzani, A.; Majidi, M.M.; Kiani, R.; Tabatabaei, B.E.S.; Habibi, F. Salinity tolerance of Aegilops cylindrica genotypes collected from hyper-saline shores of Uremia Salt Lake using physiological traits and SSR markers. Acta Physiol. Plant. 2014, 36, 2243–2251. [Google Scholar] [CrossRef]
  29. Gupta, B.; Huang, B. Mechanism of salinity tolerance in plants: Physiological, biochemical, and molecular characterization. Int. J. Genom. 2014, 2014, 701596. [Google Scholar] [CrossRef] [PubMed]
  30. Hasanuzzaman, M.; Nahar, K.; Fujita, M. Plant response to salt stress and role of exogenous protectants to mitigate salt-induced damages. In Ecophysiology and Responses of Plants under Salt Stress; Springer: Berlin/Heidelberg, Germany, 2013; pp. 25–87. [Google Scholar]
  31. Pestsova, E.; Korzun, V.; Goncharov, N.; Hammer, K.; Ganal, M.; Röder, M. Microsatellite analysis of Aegilops tauschii germplasm. Theor. Appl. Genet. 2000, 101, 100–106. [Google Scholar] [CrossRef]
  32. Stavridou, E.; Webster, R.J.; Robson, P.R. The effects of moderate and severe salinity on composition and physiology in the biomass crop miscanthus× giganteus. Plants 2020, 9, 1266. [Google Scholar] [CrossRef]
  33. Colmer, T.D.; Flowers, T.J.; Munns, R. Use of wild relatives to improve salt tolerance in wheat. J. Exp. Bot. 2006, 57, 1059–1078. [Google Scholar] [CrossRef] [Green Version]
  34. Kiani, R.; Arzani, A.; Habibi, F. Physiology of salinity tolerance in Aegilops cylindrica. Acta Physiol. Plant. 2015, 37, 1–10. [Google Scholar] [CrossRef]
  35. Naghavi, M.R.; Mardi, M.; Pirseyedi, S.M.; Kazemi, M.; Potki, P.; Ghaffari, M.R. Comparison of genetic variation among accessions of Aegilops tauschii using AFLP and SSR markers. Genet. Resour. Crop Evol. 2007, 54, 237–240. [Google Scholar] [CrossRef]
  36. Jaime-Pérez, N.; Pineda, B.; García-Sogo, B.; Atares, A.; Athman, A.; Byrt, C.S.; Olías, R.; Asins, M.J.; Gilliham, M.; Moreno, V. The sodium transporter encoded by the HKT1; 2 gene modulates sodium/potassium homeostasis in tomato shoots under salinity. Plant Cell Environ. 2017, 40, 658–671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. James, R.A.; Davenport, R.J.; Munns, R. Physiological characterization of two genes for Na+ exclusion in durum wheat, Nax1 and Nax2. Plant Physiol. 2006, 142, 1537–1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Byrt, C.S. Genes for Sodium Exclusion in Wheat. Ph.D. Thesis, School of Agriculture, Food and Wine, University of Adelaide, Adelaide, Australia, 2008. [Google Scholar]
  39. Shamaya, N.J.; Shavrukov, Y.; Langridge, P.; Roy, S.J.; Tester, M. Genetics of Na+ exclusion and salinity tolerance in Afghani durum wheat landraces. BMC Plant Biol. 2017, 17, 1–8. [Google Scholar] [CrossRef] [Green Version]
  40. Ahmadi, J.; Pour-Aboughadareh, A.; Ourang, S.F.; Khalili, P.; Poczai, P. Unraveling salinity stress responses in ancestral and neglected wheat species at early growth stage: A baseline for utilization in future wheat improvement programs. Physiol. Mol. Biol. Plants 2020, 26, 1–13. [Google Scholar] [CrossRef] [PubMed]
  41. Shohan, M.U.S.; Sinha, S.; Nabila, F.H.; Dastidar, S.G.; Seraj, Z.I. HKT1;5 transporter gene expression and association of amino acid substitutions with salt tolerance across rice genotypes. Front. Plant Sci. 2019, 10, 1420. [Google Scholar] [CrossRef] [Green Version]
  42. Tounsi, S.; Ben Amar, S.; Masmoudi, K.; Sentenac, H.; Brini, F.; Véry, A.-A. Characterization of two HKT1; 4 transporters from Triticum monococcum to elucidate the determinants of the wheat salt tolerance Nax1 QTL. Plant Cell Physiol. 2016, 57, 2047–2057. [Google Scholar] [CrossRef] [Green Version]
  43. Ismail, A.M.; Horie, T. Genomics, physiology, and molecular breeding approaches for improving salt tolerance. Annu. Rev. Plant Biol. 2017, 68, 405–434. [Google Scholar] [CrossRef] [Green Version]
  44. Ferreres, F.; Figueiredo, R.; Bettencourt, S.; Carqueijeiro, I.; Oliveira, J.; Gil-Izquierdo, A.; Pereira, D.M.; Valentão, P.; Andrade, P.B.; Duarte, P. Identification of phenolic compounds in isolated vacuoles of the medicinal plant Catharanthus roseus and their interaction with vacuolar class III peroxidase: An H2O2 affair? J. Exp. Bot. 2011, 62, 2841–2854. [Google Scholar] [CrossRef] [Green Version]
  45. Bao, Y.; Aggarwal, P.; Robbins, N.E.; Sturrock, C.J.; Thompson, M.C.; Tan, H.Q.; Tham, C.; Duan, L.; Rodriguez, P.L.; Vernoux, T. Plant roots use a patterning mechanism to position lateral root branches toward available water. Proc. Natl. Acad. Sci. USA 2014, 111, 9319–9324. [Google Scholar] [CrossRef] [Green Version]
  46. Wu, H.; Shabala, L.; Zhou, M.; Su, N.; Wu, Q.; Ul-Haq, T.; Zhu, J.; Mancuso, S.; Azzarello, E.; Shabala, S. Root vacuolar Na+ sequestration but not exclusion from uptake correlates with barley salt tolerance. Plant J. 2019, 100, 55–67. [Google Scholar] [CrossRef]
  47. Gong, Q.; Li, P.; Ma, S.; Indu Rupassara, S.; Bohnert, H.J. Salinity stress adaptation competence in the extremophile Thellungiella halophila in comparison with its relative Arabidopsis thaliana. Plant J. 2005, 44, 826–839. [Google Scholar] [CrossRef]
  48. Martinoia, E.; Massonneau, A.; Frangne, N. Transport processes of solutes across the vacuolar membrane of higher plants. Plant Cell Physiol. 2000, 41, 1175–1186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Shi, H.; Zhu, J.-K. Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. Plant Mol. Biol. 2002, 50, 543–550. [Google Scholar] [CrossRef] [PubMed]
  50. Cosentino, C.; Fischer-Schliebs, E.; Bertl, A.; Thiel, G.; Homann, U. Na+/H+ antiporters are differentially regulated in response to NaCl stress in leaves and roots of Mesembryanthemum crystallinum. New Phytol. 2010, 186, 669–680. [Google Scholar] [CrossRef] [PubMed]
  51. Wu, G.-Q.; Feng, R.-J.; Wang, S.-M.; Wang, C.-M.; Bao, A.-K.; Wei, L.; Yuan, H.-J. Co-expression of xerophyte Zygophyllum xanthoxylum ZxNHX and ZxVP1-1 confers enhanced salinity tolerance in chimeric sugar beet (Beta vulgaris L.). Front. Plant Sci. 2015, 6, 581. [Google Scholar] [CrossRef] [Green Version]
  52. Blumwald, E. Sodium transport and salt tolerance in plants. Curr. Opin. Cell Biol. 2000, 12, 431–434. [Google Scholar] [CrossRef]
  53. Apse, M.P.; Blumwald, E. Na+ transport in plants. FEBS Lett. 2007, 581, 2247–2254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Plants 10 01393 g001 550
Figure 1. Na+ concentration in leaves of 40 Ae. tauschii populations under salinity stress conditions (300 mM NaCl). Values are means, and bars indicate standard deviation (SD).
Figure 1. Na+ concentration in leaves of 40 Ae. tauschii populations under salinity stress conditions (300 mM NaCl). Values are means, and bars indicate standard deviation (SD).
Plants 10 01393 g001
Plants 10 01393 g002 550
Figure 2. A regression analysis between salinity tolerance and Na+ concentrations in 40 Ae. tauschii populations were collected from different parts of China. The circle indicates the populations with salinity tolerance, which showed the lowest sodium concentration and maximum dry biomass. The fitted linear regression is R2 = 0.62.
Figure 2. A regression analysis between salinity tolerance and Na+ concentrations in 40 Ae. tauschii populations were collected from different parts of China. The circle indicates the populations with salinity tolerance, which showed the lowest sodium concentration and maximum dry biomass. The fitted linear regression is R2 = 0.62.
Plants 10 01393 g002
Plants 10 01393 g003 550
Figure 3. Phylogenetic tree illustrating the genetic relationships among the 40 Ae. tauschii populations collected in China based on the 14 SSRs marker.
Figure 3. Phylogenetic tree illustrating the genetic relationships among the 40 Ae. tauschii populations collected in China based on the 14 SSRs marker.
Plants 10 01393 g003
Plants 10 01393 g004 550
Figure 4. Relative expression levels of AeHKT1;4 (A) and AeNHX1 (B) in roots and shoots of Ae. tauschii under control conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviations (SD).
Figure 4. Relative expression levels of AeHKT1;4 (A) and AeNHX1 (B) in roots and shoots of Ae. tauschii under control conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviations (SD).
Plants 10 01393 g004
Plants 10 01393 g005a 550Plants 10 01393 g005b 550
Figure 5. Relative expression levels of AeHKT1;4 in in roots of Ae. tauschii populations under salinity conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviation (SD). (S1 = 50 mM NaCl and S2 = 200 mM NaCl and P. = population).
Figure 5. Relative expression levels of AeHKT1;4 in in roots of Ae. tauschii populations under salinity conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviation (SD). (S1 = 50 mM NaCl and S2 = 200 mM NaCl and P. = population).
Plants 10 01393 g005aPlants 10 01393 g005b
Plants 10 01393 g006 550
Figure 6. Relative expression levels of AeNHX1 in leaves of Ae. tauschii populations under salinity conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviation (SD). (S1 = 50 mM NaCl and S2 = 200 mM NaCl and P. = population).
Figure 6. Relative expression levels of AeNHX1 in leaves of Ae. tauschii populations under salinity conditions. Actin was used as an internal reference. Experiments were repeated three times. Values are means, and bars indicate standard deviation (SD). (S1 = 50 mM NaCl and S2 = 200 mM NaCl and P. = population).
Plants 10 01393 g006
Plants 10 01393 g007 550
Figure 7. The schematic model of AeHKT1;4 and AeNHX1 in Na+ transport under salinity stress conditions in Ae. tauschii. Under lower salinity stress conditions (50 mM NaCl), AtNHX1 in leaves compartmentalized of Na+ in vacuoles and sequestering Na+ would increase loading into xylem by AeHKT1;4. Na+ could transport in leaves by the transportation stream; under high salinity stress conditions (200 mM NaCl), Na+ rapidly and unremittingly sequesters in vacuoles of leaves by AeNHX1. The vacuoles’ capacity becomes saturated by sequestering Na+, which restricted the Na+ transport from roots and induced the expression level of AeHKT:4 and assisted in the unloading of excessive Na+ from the xylem.
Figure 7. The schematic model of AeHKT1;4 and AeNHX1 in Na+ transport under salinity stress conditions in Ae. tauschii. Under lower salinity stress conditions (50 mM NaCl), AtNHX1 in leaves compartmentalized of Na+ in vacuoles and sequestering Na+ would increase loading into xylem by AeHKT1;4. Na+ could transport in leaves by the transportation stream; under high salinity stress conditions (200 mM NaCl), Na+ rapidly and unremittingly sequesters in vacuoles of leaves by AeNHX1. The vacuoles’ capacity becomes saturated by sequestering Na+, which restricted the Na+ transport from roots and induced the expression level of AeHKT:4 and assisted in the unloading of excessive Na+ from the xylem.
Plants 10 01393 g007
Table
Table 1. Analysis of variance of dry weight biomass (g), plant height (cm), Na+, K+, and Na+/K+ ratio under salinity and control conditions.
Table 1. Analysis of variance of dry weight biomass (g), plant height (cm), Na+, K+, and Na+/K+ ratio under salinity and control conditions.
Source of VariationdfDry Weight BiomassPlant HeightNa+K+K+/Na
Replication20.3492.662125.632793.0218.38 *
Salt (S)14.516 **1.4431035.51 **9603.59 **4.61 *
Error 120.0199.655123.568936.530.23
Population (P)390.444 **3.614 **2796.89 **1535.92 **18.40 *
S × P390.572 **4.897 **2740.92 **1556.75 **19.03 **
Error 21560.0751.8731032.213620.6910.65
Total2390.2372.7205911.381152.9513.23
*, ** Significant at 0.05 and 0.01 probability levels, respectively.
Table
Table 2. Mean values of physiological traits under control and salinity stress conditions.
Table 2. Mean values of physiological traits under control and salinity stress conditions.
Dry Weight Biomass (g)Plant Height
(cm)		Na+
(mg g dw−1)		K+
(mg g dw−1)		K+/Na
Control
Mini.1.5410.5014.67374.0214.82
Maxi.3.3817.0034.38693.3747.91
Mean2.2513.6524.73532.1723.67
300 mM NaCl
Mini.1.2910.3739.97154.920.27
Maxi.2.9914.89510.01680.217.56
Mean1.9813.44240.71378.901.02
Table
Table 3. The correlation coefficient between plant dry weight biomass, plant height, Na+, K+, and K+/Na+ in Ae. tauschii populations (40) under salinity stress condition (200 mM NaCl).
Table 3. The correlation coefficient between plant dry weight biomass, plant height, Na+, K+, and K+/Na+ in Ae. tauschii populations (40) under salinity stress condition (200 mM NaCl).
Dry Weight Biomass Plant HeightNa+K+K+/Na
Dry weight biomass10.37 *−0.784 **−0.44 **0.41 **
Plant height 1−0.3127 *−0.0630.17
Na+ 10.411 **−0.56 **
K+ 10.36 **
K+/Na+ 1
*, ** Significant at 0.05 and 0.01 probability levels, respectively.
Table
Table 4. Major allele frequency, allele number, gene diversity, and polymorphism information content of the 40 Ae. tauschii populations collected from China based on the 14 SSRs.
Table 4. Major allele frequency, allele number, gene diversity, and polymorphism information content of the 40 Ae. tauschii populations collected from China based on the 14 SSRs.
MarkerMajor Allele FrequencyAllele NoPIC
Xgwm4280.7330.34
Xbarc1590.8920.18
Xgwm2050.9530.09
Xgwm550.9530.09
Xgwm3120.3680.72
Xgwm30.3680.72
Xbarc2730.4170.73
Xgwm4100.1580.92
Xgwm1650.7330.34
Xwmc7730.7330.39
Xbarc740.7330.39
Xgwm6090.9820.05
Xgwm5830.9530.09
Xwmc3670.5840.45
Mean0.684.280.39
Table
Table 5. Sequence of 14 simple sequence repeats (SSR) primers.
Table 5. Sequence of 14 simple sequence repeats (SSR) primers.
Sr.NoPrimersForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)5′ Modify
1Xgwm 583TTCACACCCAACCAATAGCATCTAGGCAGACACATGCCTGHex
2Xwmc 773GAGGCTTGCATGTGCTTGAGCCAACTGCAACCGGTACTCT6-Fam
3Xbarc 74GCGCTTGCCCCTTCAGGCGAGCGCGGGAGAACCACCAGTGACAGAGCHex
4Xbarc 159CGCAATTTATTATCGGTTTTAGGAACGCCCGATAGTTTTTCTAATTTCTGA6-Fam
5Xbarc 273AATTCAGAGAAACACACCTCCCTTTTAACTCCATCAACCCCGTTCATTHex
6Xwmc 367CTGACGTTGATGGGCCACTATTGTGGTGGAAGAGGAAGGAGAGG6-Fam
7Xgwm 428CGAGGCAGCGAGGATTTTTCTCCACTAGCCCCGCHex
8Xgwm 609GCGACATGACCATTTTGTTGGATATTAAATCTCTCTATGTGTG6-Fam
9Xgwm 55GCATCTGGTACACTAGCTGCCTCATGGATGCATCACATCCTHex
10Xgwm 312AGGAGCTCCTCTGTGCCACTTCGGGACTCTCTTCCCTG6-Fam
11Xgwm 3GCAGCGGCACTGGTACATTTAATATCGCATCACTATCCCAHex
12Xgwm 410GCTTGAGACCGGCACAGTCGAGACCTTGAGGGTCTAGA6-Fam
13Xgwm 205CGACCCGGTTCACTTCAGAGTCGCCGTTGTATAGTGCC6-Fam
14Xgwm 165TGCAGTGGTCAGATGTTTCCCTTTTCTTTCAGATTGCGCCHex
Table
Table 6. Sequence of primers used for real-time PCR amplification.
Table 6. Sequence of primers used for real-time PCR amplification.
PrimerSequences (5′–3′)Gene
P1GCGTTCTTGTGCTTCTTGAeACTIN-F
P2TTCTGACCTTGACCATTCCAeACTIN-R
P3ACGCGCTCAAAATGTAACCGAeHKT1;4 F
P4TGCCAAATCAAGGGCTCCAAAeHKT1;4-R
P5CGGCAGTGCATGAAACTGTGAeNHX1-F
P6TTTTCTCCGGTTATGCCGCTAeNHX1-R
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Abbas, A.; Yu, H.; Cui, H.; Li, X. Genetic Diversity and Synergistic Modulation of Salinity Tolerance Genes in Aegilops tauschii Coss. Plants 2021, 10, 1393. https://0-doi-org.brum.beds.ac.uk/10.3390/plants10071393

AMA Style

Abbas A, Yu H, Cui H, Li X. Genetic Diversity and Synergistic Modulation of Salinity Tolerance Genes in Aegilops tauschii Coss. Plants. 2021; 10(7):1393. https://0-doi-org.brum.beds.ac.uk/10.3390/plants10071393

Chicago/Turabian Style

Abbas, Adeel, Haiyan Yu, Hailan Cui, and Xiangju Li. 2021. "Genetic Diversity and Synergistic Modulation of Salinity Tolerance Genes in Aegilops tauschii Coss" Plants 10, no. 7: 1393. https://0-doi-org.brum.beds.ac.uk/10.3390/plants10071393

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop