Polymorphism Analysis of Ch1 and Ch2 Genes in the Siberian Cat
Abstract
:1. Introduction
2. Materials and Methods
- 5′GGGGATCCTGGAACACCATGTTAGACGCAG3′ (Forward)
- 5′GGGAATTCTGCAGTTACCTTTAACACAGAG3′ (Reverse) for Ch1;
- 5′GGGCTGCAGATTCTAGTCAGCCTGATTGA3′ (Forward)
- 5′GGGGATCCTGACACCATGAGGGGGGCA3′ (Reverse) for Ch2.
3. Results
4. Discussion
5. Conclusions
Author Contributions
Conflicts of Interest
References
- Morgenstern, J.P.; Griffith, I.J.; Brauer, A.W.; Rogers, B.L.; Bond, J.F.; Chapman, M.D.; Kuo, M.C. Aminoacid sequence of Fel dI, the major allergen of the domestic cat: Protein sequence analysis and cDNA cloning. Proc. Natl. Acad. Sci. USA 1991, 88, 9690–9694. [Google Scholar] [CrossRef] [PubMed]
- Perzanowski, M.S.; Ronmark, E.; Platts-Mills, T.A.; Lundback, P. Effect of cat and dog ownership on sensitization and development of asthma among preteenage children. Am. J. Respir. Crit. Care Med. 2002, 166, 696–702. [Google Scholar] [CrossRef] [PubMed]
- Becker, E.C.; Wolke, G.; Heinrich, J. Bronchial responsiveness, spirometry and mortality in a cohort of adults. J. Ashtma 2013, 50, 427–432. [Google Scholar] [CrossRef] [PubMed]
- Chapman, M.D.; Aalberse, R.C.; Brown, M.J.; Platt-Mills, T.A. Single step affinity purification of Feld I, N-terminal sequence analysis, and development of a sensitive two-site immunoassay to assess Fel d I exposure. J. Immunol. 1988, 140, 812–818. [Google Scholar] [PubMed]
- Duffort, O.A.; Carreira, J.; Nitti, G.; Polo, F.; Lombardero, M. Studies on the biochemical structure of the major cat allergen Felis domesticus. Mol. Immunol. 1991, 28, 301–309. [Google Scholar] [CrossRef]
- Van Milligen, F.J.; Aalbertse, R.C.; Van Swieten, P. Variability of Feld I structure in commercial cat allergen extracts as revealed by monoclonal antibodies to denatured Fel dI. J. Allergy Clin. Immunol. 1991, 87, 327. [Google Scholar] [CrossRef]
- Charpin, C.; Mata, P.; Charpin, D.; Lavaut, M.N.; Allasia, C.; Vervloet, D. Feld I allergen distribution in cat fur and skin. J. Allergy Clin. Immunol. 1991, 88, 77–82. [Google Scholar] [CrossRef]
- Brown, P.R.; Leitermann, K.; Ohman, J.L., Jr. Distribution of cat allergen 1 in cat tissues and fluids. Int. Arch. Allergy Appl. Immunol. 1984, 74, 67–70. [Google Scholar] [CrossRef] [PubMed]
- Ohman, J.L., Jr.; Lowell, F.C.; Bloch, K.J. Allergens of mammalian origins. III. Properties of a major feline allergen. J. Immunol. 1974, 113, 1668–1677. [Google Scholar] [PubMed]
- Ohman, J.L., Jr.; Kendall, S.; Lowell, F.C. IgE antibody to cat allergens in an allergic population. J. Allergy Clin. Immunol. 1977, 60, 317–323. [Google Scholar] [CrossRef]
- Anderson, M.C.; Baer, H. Allergenically active components of cat allergen extracts. J. Immunol. 1981, 127, 972–975. [Google Scholar] [PubMed]
- Lowenstein, H.; Lind, P.; Weeke, B. Identification and clinical significance of allergenic moleculs of cat origin. Allergy 1985, 40, 430–441. [Google Scholar] [CrossRef] [PubMed]
- Van Metre, T.E.; Marsh, D.G.; Adkinson, N.F., Jr.; Fish, J.E.; Kagey-Sabotka, A.; Norman, P.S.; Radden, E.B., Jr.; Rosenberg, G.L. Dose of cat (Felis domesticus) allergen I (Feld I) that induces asthma. J. Allergy Clin. Immunol. 1986, 78, 62–75. [Google Scholar] [CrossRef]
- Luczinska, C.M.; Li, Y.; Chapman, M.D.; Platts-Mills, T.A.E. Airborne concentrations and particle size distribution of allergen derived from domestic cats (Felis domesticus): Measurements using cascade impactor, liquid impinger and two site monoclonal antibody assay for Fel d I. Am. Rev. Respir. Dis. 1990, 141, 361–367. [Google Scholar] [CrossRef] [PubMed]
- Satorina, J.; Szalai, K.; Willensdorfer, A.; Motes-Lucksh, N.; Lukschal, A.; Jensen-Jarolim, E. Do hypoallergenic cats exist?-Determination of major allergen Fel d 1 production in normal and hypoallergenic cat breeds. Clin. Transl. Allergy 2014, 4. [Google Scholar] [CrossRef]
- Griffith, I.J.; Craig, S.; Pollok, J.; Yu, X.B.; Morgenstern, J.P.; Rogers, B.L. Expression and genomic structure of the genes encoding FdI, the major allergen from the domestic cat. Gene 1992, 113, 263–268. [Google Scholar] [CrossRef]
- National Center of Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov (accessed on 30 November 2017).
- Almqvist, C.; Wickman, M.; Perfetti, L.; Berglind, N.; Renstrom, A.; Hedren, M.; Larsson, K.; Hedlin, G.; Malmberg, P. Worsening of ashtma in children allergic to cats, after indirect exposure to cat at school. Am. J. Respir. Crit. Care Med. 2001, 163, 694–698. [Google Scholar] [CrossRef] [PubMed]
- Tasaniyananda, N.; Tungtrongchitr, A.; Seesuay, W.; Sakolvaree, Y.; Aiumurai, P.; Indrawattana, N.; Chaicumpa, W.; Sookrung, N. Quantification of Fel d 1 in house dust samples of cat allergic patients by using monoclonal antibody specific to a novel IgE-binding epitope. Asian Pac. J. Allergy Immunol. 2017. [Google Scholar] [CrossRef]
Cat No. | Mutation Ch1 X62477 | Effect | Mutation Ch2 NM_001048154.1 | Effect | Mutation Ch2 X62478 | Effect | Fel d 1 (µg/mL) |
---|---|---|---|---|---|---|---|
g.138G > T | p.A13S | c.260_265delAGCTCC | p.S85_S86del | g.2231A > G | p.N85S | ||
21 | − | + | − | unknown | |||
37 | + | + | + | 0.48 | |||
38 | − | + | - | 2.19 | |||
39 | Not amplified | + | − | 1.66 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sartore, S.; Landoni, E.; Maione, S.; Tarducci, A.; Borrelli, A.; Soglia, D.; Rasero, R.; Sacchi, P. Polymorphism Analysis of Ch1 and Ch2 Genes in the Siberian Cat. Vet. Sci. 2017, 4, 63. https://0-doi-org.brum.beds.ac.uk/10.3390/vetsci4040063
Sartore S, Landoni E, Maione S, Tarducci A, Borrelli A, Soglia D, Rasero R, Sacchi P. Polymorphism Analysis of Ch1 and Ch2 Genes in the Siberian Cat. Veterinary Sciences. 2017; 4(4):63. https://0-doi-org.brum.beds.ac.uk/10.3390/vetsci4040063
Chicago/Turabian StyleSartore, Stefano, Eleonora Landoni, Sandra Maione, Alberto Tarducci, Antonio Borrelli, Dominga Soglia, Roberto Rasero, and Paola Sacchi. 2017. "Polymorphism Analysis of Ch1 and Ch2 Genes in the Siberian Cat" Veterinary Sciences 4, no. 4: 63. https://0-doi-org.brum.beds.ac.uk/10.3390/vetsci4040063