Microfungi Associated with Peach Branch Diseases in China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Fungal Isolation
2.2. Morphological and Cultural Characterization
2.3. DNA Extraction, PCR Amplification, and Sequencing
2.4. Phylogenetic Analyses
Genes | Primers | Sequence (5′–3′) | References |
---|---|---|---|
ITS | ITS5 ITS4 | GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC | De Hoog and Gerrits van den Ende (1998) [31] White et al. (1990) [32] |
LSU | LROR LR5 | ACCCGCTGAACTTAAGC TCCTGAGGGAAACTTCG | Vilgalys and Hester (1990) [33] Rehner and Samuels (1994) [34] |
rpb2 | RPB2-5F RPB2-7cR | GAYGAYMGWGATCAYTTYGG CCCATRGCTTGYTTRCCCAT | Sung et al. (2007) [35] Liu et al. (1999) [36] |
tef1 | EF1-688F EF1-1251R | CGGTCACTTGATCTACAAGTGC CCTCGAACTCACCAGTACCG | Alves et al. (2008) [37] |
EF1-728F EF1-986R | CATCGAGAAGTTCGAGAAGG TACTTGAAGGAACCCTTACC | Carbone and Kohn (1999) [38] | |
tub2 | Bt2a Bt2b | GGTAACCAAATCGGTGCTGCTTTC ACCCTCAGTGTAGTGACCCTTGGC | Glass and Donaldson (1995) [39] |
T1 | AACATGCGTGAGATTGTAAGT | O’Donnell and Cigelnik (1997) [40] | |
Btub2Fd Btub4Rd | GTBCACCTYCARACCGGYCARTG CCRGAYTGRCCRAARACRAAGTTGTC | Woudenberg et al. (2009) [41] | |
act | ACT-512F ACT-783R | ATGTGCAAGGCCGGTTTCGC TACGAGTCCTTCTGGCCCAT | Carbone and Kohn (1999) [38] |
Family | Genera | ITS | LSU | rpb2 | tef1 | act | tub2 |
---|---|---|---|---|---|---|---|
Didymellaceae | Ascochyta | ITS4/ITS5 | LR0R/LR5 | RPB2-5F2/ RPB2-7cR | - | - | Btub2Fd/ Btub4Rd |
Didymella | ITS4/ITS5 | LR0R/LR5 | RPB2-5F2/ RPB2-7cR | - | - | Btub2Fd/ Btub4Rd | |
Nothophoma | ITS4/ITS5 | LR0R/LR5 | RPB2-5F2/ RPB2-7cR | - | - | Btub2Fd/ Btub4Rd | |
Botryosphaeriaceae | Botryosphaeria | ITS4/ITS5 | - | - | EF1-728F/ EF1-986R | - | Bt2a/Bt2b |
Diplodia | ITS4/ITS5 | - | - | EF1-728F/ EF1-986R | - | Bt2a/Bt2b | |
Neofusicoccum | ITS4/ITS5 | - | - | EF1-728F/ EF1-986R | Bt2a/Bt2b | ||
Phaeobotryon | ITS4/ITS5 | LROR/LR5 | - | EF1-728F/ EF1-986R | - | - | |
Lasiodiplodia | ITS4/ITS5 | - | - | EF1-688F/ EF1-1251R | - | T1/Bt2b | |
Togniniaceae | Phaeoacremonium | - | - | - | - | ACT-512F/ ACT-783R | Bt2a /Bt2b |
3. Results
Phylogenetic Analysis and Morphological Characterization
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pakbin, B.; Razavi, S.H.; Mahmoudi, R.; Gajarbeygi, P. Producing probiotic peach juice. Biotechnol. Health Sci. 2014, 1, e24683. [Google Scholar] [CrossRef]
- Liao, X.X.; Greenspan, P.; Pegg, B.P. Characterizing the phenolic constituents and antioxidant capacity of georgia peaches. Food Chem. 2018, 271, 345–353. [Google Scholar] [CrossRef]
- Faust, M.; Béla, T. Origin and dissemination of peach. Hortic. Rev. 2010, 17, 331–379. [Google Scholar]
- Li, H.L. The domestication of plants in china: Ecogeographical considerations. In The Origins of Chinese Civilization; Keightley, D.N., Ed.; University of California Press: Berkeley, CA, USA, 1983; pp. 21–64. [Google Scholar]
- Yu, M.L.; Wang, L.R.; Wang, Z.Q.; Peng, F.T.; Zhang, F.; Ye, Z.W. Fruit scientific research in New China in the past 70 years: Peach. J. Fruit Sci. 2019, 36, 1283–1291. [Google Scholar]
- Wang, L.R.; Zhu, G.R.; Fang, W.C. Peach Genetic Resource in China; China Agriculture Press: Beijing, China, 2012; pp. 201–212. [Google Scholar]
- Gomez, L.; Vercambre, G.; Jordan, M.O. Spatial-temporal management of nitrogen and carbon on the peach tree (Prunus persicae L. Batsch.). Sci. Hortic. 2020, 273, 109613. [Google Scholar] [CrossRef]
- Byrne, D.H.; Raseira, M.B.; Bassi, D.; Piagnani, M.C.; Gasic, K.; Reighard, G.L.; Moreno, M.A.; Pérez, S. Peach. In Fruit Breeding; Springer Science & Business Media: New York, NY, USA, 2012; pp. 505–569. [Google Scholar]
- Zhou, T.; Schneider, K.E.; Li, X.Z. Development of biocontrol agents from food microbial isolates for controlling post-harvest peach brown rot caused by Monilinia fructicola. Int. J. Food Microbiol. 2008, 126, 180–185. [Google Scholar] [CrossRef] [PubMed]
- Li, H.Y.; Cao, R.B.; Mu, Y.T. In vitro inhibition of Botryosphaeria dothidea and Lasiodiplodia theobromae, and chemical control of gummosis disease of Japanese apricot and peach trees in Zhejiang Province, China. Crop Prot. 1995, 14, 187–191. [Google Scholar] [CrossRef]
- Chen, C.; Bock, C.H.; Wood, B.W. Draft genome sequence of Venturia carpophila, the causal agent of peach scab. Stand. Genom. Sci. 2017, 12, 68. [Google Scholar] [CrossRef] [PubMed]
- Tavares, S.; Inácio, J.; Fonseca, Á.; Oliveira, C. Direct detection of Taphrina deformans on peach trees using molecular methods. Eur. J. Plant Pathol. 2004, 110, 973–982. [Google Scholar] [CrossRef]
- Guzmán, G.; Latorre, B.A.; Torres, R.; Wilcox, W.F. Relative susceptibility of peach rootstocks to crown gall and Phytophthora root and crown rot in Chile. Cienc. E Investig. Agrar. 2007, 34, 31–40. [Google Scholar]
- Luo, C.X.; Schnabel, G.; Hu, M.; Cal, A.D. Global distribution and management of peach diseases. Phytopathol. Res. 2022, 4, 30. [Google Scholar] [CrossRef]
- Adaskaveg, J.E.; Schnabel, G.; Förster, H. Diseases of peach caused by fungi and fungal-like organisms: Biology, epidemiology and management. In The Peach: Botany, Production and Uses; CABI Publishing: Wallingford, UK, 2008; pp. 352–406. [Google Scholar]
- Senanayake, I.C.; Rathnayaka, A.R.; Marasinghe, D.S.; Calabon, M.S.; Gentekaki, E.; Lee, H.B.; Hurdeal, V.G.; Pem, D.; Dissanayake, L.S.; Wijesinghe, S.N.; et al. Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere 2020, 11, 2678–2754. [Google Scholar] [CrossRef]
- Smith, H.; Wingfield, M.J.; Coutinho, T.A.; Crous, P.W. Sphaeropsis sapinea and Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. S. Afr. J. Bot. 1996, 62, 86–88. [Google Scholar] [CrossRef]
- Boerema, G.H.; De Gruyer, J.D.; Noordeloos, M.E.; Hamers, M.C.E. Phoma Identification Manual. Differentiation of Specific and Infra-Specific taxa in Culture; CABI Publishing: Cambridge, MA, USA; Wallingford, UK, 2004; pp. 14–18. [Google Scholar]
- Rayner, R.W. A Mycological Colour Chart; Commonwealth Mycological Institute and British Mycological Society: Surrey, UK, 1970; p. 34. [Google Scholar]
- Aveskamp, M.M.; Gruyter, J.D.; Woudenberg, J.H.C.; Verkley, G.J.M.; Crous, P.W. Highlights of the Didymellaceae: A polyphasic approach to characterize Phoma and related pleosporalean genera. Stud. Mycol. 2010, 65, 1–60. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Jiang, J.R.; Zhang, G.Z.; Cai, L.; Crous, P.W. Resolving the Phoma enigma. Stud. Mycol. 2015, 82, 137–217. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Hou, L.W.; Duan, W.J.; Crous, P.W.; Cai, L. Didymellaceae revisited. Stud. Mycol. 2017, 87, 105–159. [Google Scholar] [CrossRef] [PubMed]
- Wijayawardene, N.N.; Hyde, K.D.; Dai, D.Q.; Sánchez-García, M.; Goto, B.T.; Saxena, R.K.; Erdoğdu, M.; Selçuk, F.; Rajeshkumar, K.C.; Aptroot, A.; et al. Outline of Fungi and fungus-like taxa—2021. Mycosphere 2022, 13, 53–453. [Google Scholar] [CrossRef]
- Hongsanan, S.; Hyde, K.D.; Phookamsak, R.; Wanasinghe, D.N.; Eric, H.C.M.; Sarma, V.V.; Lücking, R.; Boonmee, S.; Bhat, J.D.; Liu, N.G.; et al. Refined families of Dothideomycetes: Orders and families incertae sedis in Dothideomycetes. Fungal Divers. 2020, 105, 17–318. [Google Scholar] [CrossRef]
- Ye, Q.T.; Jia, J.Y.; Manawasinghe, I.S.; Li, X.H.; Zhang, W.; Mugnai, L.; Wu, X.H.; Hyde, K.D.; Yan, J.Y. Fomitiporia punicata and Phaeoacremonium minimum associated with Esca complex of grapevine in China. Phytopathol. Res. 2021, 3, 11. [Google Scholar] [CrossRef]
- Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2013, 30, 1312–1313. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4.0b10; Sinauer and Associates: Sunderland, MA, USA, 2002. [Google Scholar]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference un-der mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Gateway Computing Environments Workshop (GCE); IEEE Computer Society: Washington, DC, USA, 2010; pp. 1–7. [Google Scholar]
- De Hoog, G.S.; Gerrits van den Ende, A.H.G. Molecular diagnostics of clinical strains of filamentous asidiomycetes. Mycoses 1998, 41, 183–189. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed]
- Rehner, S.A.; Samuels, G.J. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol. Res. 1994, 98, 625–634. [Google Scholar] [CrossRef]
- Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Alves, A.; Crous, P.W.; Correia, A.; Phillips, A.J.L. Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Divers. 2008, 28, 1–13. [Google Scholar]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are Nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
- Woudenberg, J.H.C.; Aveskamp, M.M.; Gruyter, J.D.; Spiers, A.G.; Crous, P.W. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 2009, 22, 56–62. [Google Scholar] [CrossRef]
- Valenzuela-Lopez, N.; Cano-Lira, J.F.; Guarro, J.; Sutton, D.A.; Wiederhold, N.; Crous, P.W.; Stchigel, A.M. Coelomycetous Dothideomycetes with emphasis on the families Cucurbitariaceae and Didymellaceae. Stud. Mycol. 2018, 90, 1–69. [Google Scholar] [CrossRef] [PubMed]
- Gossen, B.D.; Morrall, R.A.A. Transmission of Ascochyta lentis from infected lentil seed and plant residue. Can. J. Plant Pathol. 1986, 8, 28–32. [Google Scholar] [CrossRef]
- Davidson, J.A.; Kimber, R.B.E. Integrated disease management of Ascochyta blight in pulse crops. Eur. J. Plant Pathol. 2007, 119, 99–110. [Google Scholar] [CrossRef]
- Tivoli, B.; Banniza, S. Comparison of the epidemiology of Ascochyta blights on grain legumes. Eur. J. Plant Pathol. 2007, 119, 59–76. [Google Scholar] [CrossRef]
- Farr, D.F.; Rossman, A.Y. Fungal Databases, Systematic Mycology and Microbiology Laboratory. ARS, USDA. 2019. Available online: http://nt.ars-grin.gov/fungaldatabases/ (accessed on 1 March 2024).
- Hou, L.; Hernández-Restrepo, M.; Groenewald, J.Z.; Cai, L.; Crous, P.W. Citizen science project reveals high diversity in Didymellaceae (Pleosporales, Dothideomycetes). MycoKeys 2020, 65, 49–99. [Google Scholar] [CrossRef] [PubMed]
- Chilvers, M.I.; Rogers, J.D.; Dugan, F.M.; Stewart, J.E.; Chen, W.; Peever, T.L. Didymella pisi sp. nov., the teleomorph of Ascochyta pisi. Mycol. Res. 2009, 113, 391–400. [Google Scholar] [CrossRef]
- Lahoz, E.; Caiazzo, R.; Fanigliulo, A.; Comes, S.; Crescenzi, A. Phoma glomerata as causal agent of crown rot disease of fennel in southern Italy. Commun. Agric. Appl. Biol. Sci. 2007, 72, 875–878. [Google Scholar] [PubMed]
- Aghapour, B.; Fotouhifar, K.B.; Ahmadpour, A.; Ghazanfari, K. First report of leaf spot disease on Ficus elastica caused by Phoma glomerata in Iran. Australas. Plant Dis. Notes 2009, 4, 82–83. [Google Scholar] [CrossRef]
- Thomidis, T.; Michailides, T.J.; Exadaktylou, E. Phoma glomerata (Corda) Wollenw. & Hochapfel a new threat causing cankers on shoots of peach trees in Greece. Eur. J. Plant Pathol. 2011, 131, 171–178. [Google Scholar]
- Rodeva, R.; Carrieri, R.; Stoyanova, Z.; Dacheva, S.; Lahoz, E.; Fanigliulo, A.; Crescenzi, A. New report of Phoma glomerata on Coriandrum sativum L. Commun. Agric. Appl. Biol. Sci. 2013, 78, 617–620. [Google Scholar] [PubMed]
- Keirnan, E.C.; Tan, Y.P.; Laurence, M.H.; Mertin, A.A.; Liew, E.C.Y.; Summerell, B.A.; Shivas, R.G. Cryptic diversity found in Didymellaceae from Australian native legumes. MycoKeys 2021, 78, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Chethana, K.W.T.; Jayawardene, R.S.; Zhang, W.; Zhou, Y.Y.; Liu, M.; Hyde, K.D.; Li, X.H.; Wang, J.; Zhang, K.C.; Yan, J.Y. Molecular characterization and pathogenicity of fungal taxa associated with cherry leaf spot disease. Mycosphere 2019, 10, 490–530. [Google Scholar] [CrossRef]
- Chen, S.F.; Morgan, D.P.; Michailides, T.J. First report of Phoma fungicola associated with stem canker and fruit blight of pistachio in Arizona. J. Plant Pathol. 2013, 95, 447–452. [Google Scholar]
- Triki, M.A.; Gharbi, Y.; Bouazizi, E.; Cheff, M.; Krid, S.; Feki, F.A.; Bouhamed, J. First report of branch blight of almond trees caused by Nothophoma quercina in Tunisia. J. Plant Pathol. 2019, 101, 1277. [Google Scholar] [CrossRef]
- Phillips, A.J.L.; Alves, A.; Abdollahzadeh, J.; Slippers, B.; Wingfield, M.J.; Groenewald, J.Z.; Crous, P.W. The Botryosphaeriaceae, genera and species known from culture. Stud. Mycol. 2013, 76, 51–167. [Google Scholar] [CrossRef] [PubMed]
- Chethana, K.W.T.; Li, X.H.; Zhang, W.; Hyde, K.D.; Yan, J.Y. Trail of decryption of molecular research on Botryosphaeriaceae in woody plants. Phytopathol. Mediterr. 2016, 55, 147–171. [Google Scholar]
- Weaver, D.J. A gummosis disease of peach trees caused by Botryosphaeria dothidea. Phytopathology 1974, 64, 1429–1432. [Google Scholar] [CrossRef]
- Britton, K.O. Three species of Botryosphaeria cause peach tree gummosis in georgia. Plant Dis. 1982, 66, 1120. [Google Scholar] [CrossRef]
- Chen, X.Z. Studies on the gummosis of peach (Prunus persica) caused by Botryosphaeria dothidea. Acta Phytopathol. Sin. 1985, 15, 53–57. [Google Scholar]
- Wang, F.; Zhao, L.; Li, G.H.; Huang, J.B.; Hsiang, T. Identification and characterization of Bofryosphaeria spp. causing gummosis of peach trees in hubei province, central china. Plant Dis. 2011, 95, 1378–1384. [Google Scholar] [CrossRef]
- Tian, Y.L.; Zhao, Y.Q.; Sun, T.; Wang, L.; Liu, J.; Ma, X.F.; Hu, B.S. Identification and characterization of Phomopsis amygdali and Botryosphaeria dothidea associated with peach shoot blight in yangshan, china. Plant Dis. 2018, 102, 2511–2518. [Google Scholar] [CrossRef]
- Úrbez-Torres, J.R. The status of Botryosphaeriaceae species infecting grapevines. Phytopathol. Mediterr. 2011, 50, 5–45. [Google Scholar]
- Gramaje, D.; Rbez-Torres, J.R.; Sosnowski, M.R. Managing grapevine trunk diseases with respect to etiology and epidemiology: Current strategies and future prospects. Plant Dis. 2018, 102, 12–39. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.N.; Li, X.H.; Zhang, W.; Zhou, Y.Y.; Yan, J.Y. Identification and biological characteristics of Lasiodiplodia citricola causing Botryosphaeria dieback of grapes in Beijing. Acta Phytopathol. Sin. 2021, 52, 1003–1005. (In Chinese) [Google Scholar]
- Zhang, W.; Groenewald, J.Z.; Lombard, L.; Schumacher, R.K.; Phillips, A.J.L.; Crous, P.W. Evaluating species in Botryosphaeriales. Persoonia-Mol. Phylogeny Evol. Fungi 2021, 46, 63–115. [Google Scholar] [CrossRef] [PubMed]
- Marsberg, A.; Kemler, M.; Jami, F.; Nagel, J.H.; Postma-Smidt, A.; Naidoo, S.; Wingfield, M.J.; Crous, P.W.; Spatafora, J.W.; Hesse, C.N.; et al. Botryosphaeria dothidea: A latent pathogen of global importance to woody plant health. Mol. Plant Pathol. 2017, 18, 477–488. [Google Scholar] [CrossRef]
- Chattaoui, M.; Rhouma, A.; Msallem, M.; Pérez, M.; Moral, J.; Trapero, A. First Report of Botryosphaeria obtusa as causal agent of olive tree branch dieback in Tunisia. Plant Dis. 2012, 96, 905. [Google Scholar] [CrossRef]
- Kaliterna, J.; Milicevic, T.; Ivic, D.; Bencic, D.; Mesic, A. First report of Diplodia seriata as causal agent of olive dieback in Croatia. Plant Dis. 2012, 96, 290. [Google Scholar] [CrossRef]
- Abreo, E.; Martínez, S.; Bettucci, L.; Lupo, S. Characterization of Botryosphaeriaceae species associated with grapevines in Uruguay. Australas. Plant Pathol. 2013, 42, 241–249. [Google Scholar] [CrossRef]
- Delgado, L.; Mondino, P.; Alaniz, S. Botryosphariaceae species associated with stem canker, die-back and fruit rot on apple in Uruguay. Eur. J. Plant Pathol. 2016, 146, 637–655. [Google Scholar] [CrossRef]
- Crous, P.W.; Slippers, B.; Wingfield, M.J.; Rheeder, J.; Marasas, W.F.O.; Philips, A.J.L.; Alves, A.; Burgess, T.; Barber, P.; Groenewald, J.Z. Phylogenetic lineages in the Botryosphaeriaceae. Stud. Mycol. 2006, 55, 235–254. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.Z.; Qi, Y.K.; Lv, J.; Zhang, Y.J.; Zhang, W.; Liu, Y.; Fu, C.C.; Liu, Y.; Liu, B.Y.; Wang, Q.H. Identification and Pathogenicity of Neofusicoccum occulatum the Agent Shoot Blight of Platycladus orientalis in Shandong Province, China. For. Res. 2022, 35, 197–204. [Google Scholar]
- Theissen, F.; Sydow, H. Die Dothideales. Kritisch-systematische Originaluntersuchungen. Ann. Mycol. 1915, 13, 147–746. [Google Scholar]
- Fan, X.L.; Hyde, K.D.; Liu, J.K.; Liang, Y.M.; Tian, C.M. Multigene phylogeny and morphology reveal Phaeobotryon rhois sp. nov. (Botryosphaeriales, Ascomycota). Phytotaxa 2015, 205, 90–98. [Google Scholar] [CrossRef]
- Xia, G.; Manawasinghe, I.S.; Phillips, A.J.L.; You, C.; Jayawardena, R.S.; Luo, M.; Hyde, K.D. Lasiodiplodia fici sp. Nov., Causing Leaf Spot on Ficus altissima in China. Pathogens 2022, 11, 840. [Google Scholar] [CrossRef]
- Gramaje, D.; Mostert, L.; Groenewald, J.Z.; Crous, P.W. Phaeoacremonium: From esca disease to phaeohyphomycosis. Fungal Biol. 2015, 119, 759–783. [Google Scholar] [CrossRef]
- Ye, Q.T.; Manawasinghe, I.S.; Zhang, W.; Mugnai, L.; Hyde, K.D.; Li, X.H.; Yan, J.Y. First report of Phaeoacremonium minimum associated with grapevine trunk diseases in China. Plant Dis. 2020, 104, 1259. [Google Scholar] [CrossRef]
- Mostert, L.; Groenewald, J.Z.; Summerbell, R.C.; Robert, V.; Sutton, D.A.; Padhye, A.A.; Crous, P.W. Species of Phaeoacremonium associated with infections in humans and environmental reservoirs in infected woordy plants. J. Clin. Microbiol. 2005, 43, 1752–1767. [Google Scholar] [CrossRef]
- Mostert, L.; Crous, P.W.; Groenewald, J.Z.; Gams, W.; Summerbell, R.C. Togninia (Calosphaeriales) is confirmed as teleomorph of Phaeoacremonium by means of morphology, sexual compatibility, and DNA phylogeny. Mycologia 2003, 95, 646–659. [Google Scholar] [CrossRef] [PubMed]
- Damm, U.; Mostert, L.; Crous, P.W.; Fourie, P.H. Novel Phaeoacremonium species associated with necrotic wood of prunus trees. Persoonia 2008, 20, 87–102. [Google Scholar] [CrossRef] [PubMed]
- Deb, D.; Khan, A.; Dey, N. Phoma diseases: Epidemiology and Control. Plant Pathol. 2020, 1, 1203–1217. [Google Scholar] [CrossRef]
- Boerema, G.H.; Bollen, G.J. Conidiogenesis and conidial septation as differentiating criteria between Phoma and Ascochyta. Persoonia-Mol. Phylogeny Evol. Fungi 1975, 8, 111–444. [Google Scholar]
- Sullivan, R.F.; White, J.F. Phoma glomerata as a mycoparasite of powdery mildew. Appl. Environ. Microbiol. 2000, 66, 425–427. [Google Scholar] [CrossRef]
- Deng, J.X.; Paul, N.C.; Li, M.J.; Seo, E.Y.; Sung, G.H.; Yu, S.H. Molecular characterization and morphology of two endophytic Peyronellaea species from Pinus koraiensis in Korea. Mycobiology 2011, 39, 266–271. [Google Scholar] [CrossRef] [PubMed]
- Tran, H.S.; You, M.P.; Lanoiselet, V.; Khan, T.N.; Barbetti, M.J. First report of Phoma glomerata associated with the Ascochyta blight complex on feld pea (Pisum sativum) in Australia. Plant Dis. 2014, 98, 427. [Google Scholar] [CrossRef]
- Sessa, L.; Abreo, E.; Bettucci, L.; Lupo, S. Botryosphaeriaceae species associated with wood diseases of stone and pome fruits trees: Symptoms and virulence across different hosts in Uruguay. Eur. J. Plant Pathol. 2016, 146, 519–530. [Google Scholar] [CrossRef]
- Hernánde-Rodríguez, L.; Mondino-Hintz, P.; Alaniz-Ferro, S. Diversity of Botryosphaeriaceae species causing stem canker and fruit rot in olive trees in Uruguay. J. Phytopathol. 2022, 170, 264–277. [Google Scholar] [CrossRef]
- Ma, X.Y.; Hyde, K.D.; Phillips, A.J.L.; Kang, J.C.; Chomnunti, P.; Doilom, M. Three new host records of endophytic neofusicoccum species reported from dendrobium orchids. Phytotaxa 2021, 494, 193–207. [Google Scholar] [CrossRef]
- Sakalidis, M.L.; Hardy, G.E.; Burgess, T.I. Use of the genealogical sorting index (GSI) to delineate species boundaries in the Neofusicoccum parvum-Neofusicoccum ribis species complex. Mol. Phylogenet. Evol. 2011, 60, 333–344. [Google Scholar] [CrossRef] [PubMed]
- Scarlett, K.A.; Shuttleworth, L.A.; Collins, D.; Rothwell, C.T.; Guest, D.I.; Daniel, R. Botryosphaeriales associated with stem blight and dieback of blueberry (Vaccinium spp.) in New South Wales and Western Australia. Australas. Plant Pathol. 2019, 48, 45–57. [Google Scholar] [CrossRef]
- Zhu, H.Y.; Tian, C.M.; Fan, X.L. Studies of botryosphaerialean fungiassociated with canker and dieback of tree hosts in Dongling Mountain of China. Phytotaxa 2018, 348, 63–76. [Google Scholar] [CrossRef]
- Pan, M.; Zhu, H.Y.; Bezerra, J.D.P.; Guido, B.; Tian, C.M.; Fan, X.L. Botryosphaerialean fungi causing canker and dieback of tree hostsfrom Mount Yudu in China. Mycol. Prog. 2019, 18, 1341–1361. [Google Scholar] [CrossRef]
- Kraus, C.; Voegele, R.T.; Fischer, M. Temporal development of the culturable, endophytic fungal community in healthy grapevine branches and occurrence of GTD-associated fungi. Microb. Ecol. 2019, 77, 866–876. [Google Scholar] [CrossRef]
- Jayawardena, R.S.; Purahong, W.; Zhang, W.; Wubet, T.; Li, X.; Liu, M.; Zhao, W.; Hyde, K.D.; Liu, J.; Yan, J. Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches. Fungal Divers. 2018, 90, 1–84. [Google Scholar] [CrossRef]
- Manawasinghe, I.S.; Phillips, A.J.L.; Xu, J.; Balasuriya, A.; Hyde, K.D.; Tępień, L.; Harischandra, D.L.; Karunarathna, A.; Yan, J.; Weerasinghe, J.; et al. Defining a species in plant pathology: Beyond the species level. Fungal Divers. 2021, 109, 267–282. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Manawasinghe, I.S.; He, Z.; Zhang, W.; Liu, M.; Song, J.; Li, S.; Fan, Z.; Yan, J. Microfungi Associated with Peach Branch Diseases in China. J. Fungi 2024, 10, 217. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10030217
Zhou Y, Manawasinghe IS, He Z, Zhang W, Liu M, Song J, Li S, Fan Z, Yan J. Microfungi Associated with Peach Branch Diseases in China. Journal of Fungi. 2024; 10(3):217. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10030217
Chicago/Turabian StyleZhou, Ying, Ishara S. Manawasinghe, Zhizheng He, Wei Zhang, Mei Liu, Jinyan Song, Shifang Li, Zaifeng Fan, and Jiye Yan. 2024. "Microfungi Associated with Peach Branch Diseases in China" Journal of Fungi 10, no. 3: 217. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10030217