Infection of Phytophthora palmivora Isolates on Arabidopsis thaliana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Pathogen Growth and Infection Assay
2.3. Microscopic Visualization of the Infection Process
2.4. Extraction of Total RNA, cDNA Synthesis, and qRT-PCR Analysis
3. Results
3.1. Infection Dynamics of P. palmivora on Arabidopsis Col-0
3.2. Root Inoculation and Symptom Evaluation
3.3. Microscopic Analysis of Infection Mechanisms
3.4. The Expression of Infection-Related Genes of P. palmivora Is Upregulated during Colonization of Arabidopsis Leaves
3.5. Arabidopsis Induces Defense-Related Genes in Response to P. palmivora Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mohamed Azni, I.N.A.; Sundram, S.; Ramachandran, V. Pathogenicity of Malaysian Phytophthora palmivora on cocoa, durian, rubber and oil palm determines the threat of bud rot disease. For. Pathol. 2019, 49, e12557. [Google Scholar] [CrossRef]
- Torres, G.A.; Sarria, G.A.; Martinez, G.; Varon, F.; Drenth, A.; Guest, D.I. Bud Rot Caused by Phytophthora palmivora: A Destructive Emerging Disease of Oil Palm. Phytopathology 2015, 106, 320–329. [Google Scholar] [CrossRef]
- Sundram, S.; Intan-Nur, A.M.A. South American Bud rot: A biosecurity threat to South East Asian oil palm. Crop Protect. 2017, 101, 58–67. [Google Scholar] [CrossRef]
- Sarria, G.; Martinez, G.; Varon, F.; Drenth, A.; Guest, D. Histopathological studies of the process of Phytophthora palmivora infection in oil palm. Eur. J. Plant Pathol. 2016, 145, 39–51. [Google Scholar] [CrossRef]
- Fawke, S.; Doumane, M.; Schornack, S. Oomycete Interactions with Plants: Infection Strategies and Resistance Principles. Microbiol. Mol. Biol. Rev. 2015, 79, 263–280. [Google Scholar] [CrossRef]
- Sarria, G.; Garcia, A.; Mestizo, Y.; Medina, C.; Varon, F.; Mesa, E.; Hernandez, S. Antagonistic interactions between Trichoderma spp. And Phytophthora palmivora (Butler) from oil palm in Colombia. Eur. J. Plant Pathol. 2021, 161, 751–768. [Google Scholar] [CrossRef]
- Tupaz-Vera, A.; Ayala-Diaz, I.M.; Rincon, V.; Sarria, G.; Romero, H.M. An integrated disease management of oil palms affected by bud rot results in shorter recovery times. Agronomy 2021, 11, 1995. [Google Scholar] [CrossRef]
- Boyd, L.A.; Ridout, C.; O’Sullivan, D.M.; Leach, J.E.; Leung, H. Plant–pathogen interactions: Disease resistance in modern agriculture. Trends Genet. 2013, 29, 233–240. [Google Scholar] [CrossRef]
- Herlihy, J.; Ludwig, N.R.; van den Ackerveken, G.; McDowell, J.M. Oomycetes Used in Arabidopsis Research. Arab. Book 2019, 17, e0188. [Google Scholar]
- Mauch-Mani, B.; Slusarenko, A.J. Arabidopsis as a model host for studying plant-pathogen interactions. Trends Microbiol. 1993, 1, 265–270. [Google Scholar] [CrossRef]
- Roetschi, A.; Si-Ammour, A.; Belbahri, L.; Mauch, F.; Mauch-Mani, B. Characterization of an Arabidopsis-Phytophthora pathosystem: Resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J. 2001, 28, 293–305. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Meng, Y.; Zhang, M.; Tong, X.; Wang, Q.; Sun, Y.; Quan, J.; Govers, F.; Shan, W. Infection of Arabidopsis thaliana by Phytophthora parasitica and identification of variation in host specificity. Mol. Plant Pathol. 2011, 12, 187–201. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Bouwmeester, K.; Van de Mortel, J.E.; Shan, W.; Govers, F. A novel Arabidopsis–oomycete pathosystem: Differential interactions with Phytophthora capsici reveal a role for camalexin, indole glucosinolates and salicylic acid in defence. Plant Cell Environ. 2013, 36, 1192–1203. [Google Scholar] [CrossRef] [PubMed]
- Robinson, L.H.; Cahill, D.M. Ecotypic variation in the response of Arabidopsis thaliana to Phytophthora cinnamomi. Australas. Plant Pathol. 2003, 32, 53–64. [Google Scholar] [CrossRef]
- Daniel, R.; Guest, D. Defence responses induced by potassium phosphonate in Phytophthora palmivora-challenged Arabidopsis thaliana. Physiol. Mol. Plant Pathol. 2005, 67, 194–201. [Google Scholar] [CrossRef]
- Rivero, L.; Scholl, R.; Holomuzki, N.; Crist, D.; Grotewold, E.; Brkljacic, J. Handling Arabidopsis Plants: Growth, Preservation of Seeds, Transformation, and Genetic Crosses. In Arabidopsis Protocols; Sanchez-Serrano, J.J., Salinas, J., Eds.; Humana Press: Totowa, NJ, USA, 2014; Volume 1062, pp. 3–25. [Google Scholar] [CrossRef]
- Gil, J.; Herrera, M.; Duitama, J.; Sarria, G.; Restrepo, S.; Romero, H.M. Genomic variability of Phytophthora palmivora isolates from different oil palm cultivation regions in Colombia. Phytopathology 2020, 110, 1553–1564. [Google Scholar] [CrossRef] [PubMed]
- Ávila-Méndez, K.; Avila-Diazgranados, R.; Pardo, A.; Herrera, M.; Sarria, G.; Romero, H.M. Response of in vitro obtained oil palm and interspecific OxG hybrids to inoculation with Phytophthora palmivora. For. Pathol. 2019, 49, e12486. [Google Scholar] [CrossRef]
- Lamari, L. Assess: Image Analysis Software for Plant Disease Quantification; APS Press: Eagan, MN, USA, 2002. [Google Scholar]
- Fernández-Bautista, N.; Domínguez-Núñez, J.; Castellano, M.M.; Berrocal-Lobo, M. Plant Tissue Trypan Blue Staining during Phytopathogen Infection. Bio-protocol 2016, 6, e2078. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- García-Gaona, M.; Botero-Rozo, D.; Araque, L.; Romero, H.M. The Dynamic Interaction between Oil Palm and Phytophthora palmivora in Bud Rot Disease: Insights from Transcriptomic Analysis and Network Modelling. J. Fungi 2024, 10, 164. [Google Scholar] [CrossRef]
- Lu, W.; Deng, F.; Jia, J.; Chen, X.; Li, J.; Wen, Q.; Li, T.; Meng, Y.; Shan, W. The Arabidopsis thaliana gene AtERF019 negatively regulates plant resistance to Phytophthora parasitica by suppressing PAMP-triggered immunity. Mol. Plant Pathol. 2020, 21, 1179–1193. [Google Scholar] [CrossRef]
- Huitema, E.; Vleeshouwers, V.G.A.A.; Francis, D.M.; Kamoun, S. Active defence responses associated with non-host resistance of Arabidopsis thaliana to the oomycete pathogen Phytophthora infestans. Mol. Plant Pathol. 2003, 4, 487–500. [Google Scholar] [CrossRef]
- Kamoun, S.; van West, P.; Vleeshouwers, V.G.; de Groot, K.E.; Govers, F. Resistance of nicotiana benthamiana to phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 1998, 10, 1413–1426. [Google Scholar] [CrossRef] [PubMed]
- Kamoun, S. A Catalogue of the Effector Secretome of Plant Pathogenic Oomycetes. Annu. Rev. Phytopathol. 2006, 44, 41–60. [Google Scholar] [CrossRef]
- Ceulemans, E.; Ibrahim, H.M.M.; De Coninck, B.; Goossens, A. Pathogen Effectors: Exploiting the Promiscuity of Plant Signaling Hubs. Trends Plant Sci. 2021, 26, 780–795. [Google Scholar] [CrossRef]
- Wildermuth, M.C.; Dewdney, J.; Wu, G.; Ausubel, F.M. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 2001, 414, 562–565. [Google Scholar] [CrossRef] [PubMed]
- Uknes, S.; Dincher, S.; Friedrich, L.; Negrotto, D.; Williams, S.; Thompson-Taylor, H.; Potter, S.; Ward, E.; Ryals, J. Regulation of pathogenesis-related protein-1a gene expression in tobacco. Plant Cell 1993, 5, 159–169. [Google Scholar] [CrossRef] [PubMed]
- Catinot, J.; Buchala, A.; Abou-Mansour, E.; Métraux, J.-P. Salicylic acid production in response to biotic and abiotic stress depends on isochorismate in Nicotiana benthamiana. FEBS Lett. 2008, 582, 473–478. [Google Scholar] [CrossRef]
- Shine, M.B.; Yang, J.-W.; El-Habbak, M.; Nagyabhyru, P.; Fu, D.-Q.; Navarre, D.; Ghabrial, S.; Kachroo, P.; Kachroo, A. Cooperative functioning between phenylalanine ammonia lyase and isochorismate synthase activities contributes to salicylic acid biosynthesis in soybean. New Phytol. 2016, 212, 627–636. [Google Scholar] [CrossRef]
- Breen, S.; Williams, S.J.; Outram, M.; Kobe, B.; Solomon, P.S. Emerging Insights into the Functions of Pathogenesis-Related Protein 1. Trends Plant Sci. 2017, 22, 871–879. [Google Scholar] [CrossRef]
- Jain, D.; Khurana, J.P. Role of Pathogenesis-Related (PR) Proteins in Plant Defense Mechanism. In Molecular Aspects of Plant-Pathogen Interaction; Singh, A., Singh, I.K., Eds.; Springer: Singapore, 2018; pp. 265–281. [Google Scholar] [CrossRef]
- Luo, X.; Tian, T.; Feng, L.; Yang, X.; Li, L.; Tan, X.; Wu, W.; Li, Z.; Treves, H.; Serneels, F.; et al. Pathogenesis-related protein 1 suppresses oomycete pathogen by targeting against AMPK kinase complex. J. Adv. Res. 2023, 43, 13–26. [Google Scholar] [CrossRef]
- Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M.R.; Chiu, W.-L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F.M.; Sheen, J. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977–983. [Google Scholar] [CrossRef] [PubMed]
- Bigeard, J.; Colcombet, J.; Hirt, H. Signaling Mechanisms in Pattern-Triggered Immunity (PTI). Mol. Plant 2015, 8, 521–539. [Google Scholar] [CrossRef] [PubMed]
- Bouchez, O.; Huard, C.; Lorrain, S.; Roby, D.; Balagué, C. Ethylene Is One of the Key Elements for Cell Death and Defense Response Control in the Arabidopsis Lesion Mimic Mutant vad1. Plant Physiol. 2007, 145, 465–477. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Guo, H. From endoplasmic reticulum (ER) to nucleus: EIN2 bridges the gap in ethylene signaling. Mol. Plant 2013, 6, 11–14. [Google Scholar] [CrossRef]
- Moffat, C.S.; Ingle, R.A.; Wathugala, D.L.; Saunders, N.J.; Knight, H.; Knight, M.R. ERF5 and ERF6 Play Redundant Roles as Positive Regulators of JA/Et-Mediated Defense against Botrytis cinerea in Arabidopsis. PLoS ONE 2012, 7, e35995. [Google Scholar] [CrossRef] [PubMed]
- Chauvin, A.; Lenglet, A.; Wolfender, J.-L.; Farmer, E.E. Paired Hierarchical Organization of 13-Lipoxygenases in Arabidopsis. Plants 2016, 5, 16. [Google Scholar] [CrossRef]
- Li, W.; Zhao, D.; Dong, J.; Kong, X.; Zhang, Q.; Li, T.; Meng, Y.; Shan, W. AtRTP5 negatively regulates plant resistance to Phytophthora pathogens by modulating the biosynthesis of endogenous jasmonic acid and salicylic acid. Mol. Plant Pathol. 2020, 21, 95–108. [Google Scholar] [CrossRef]
- Berger, S.; Bell, E.; Sadka, A.; Mullet, J.E. Arabidopsis thaliana Atvsp is homologous to soybean VspA and VspB, genes encoding vegetative storage protein acid phosphatases, and is regulated similarly by methyl jasmonate, wounding, sugars, light and phosphate. Plant Mol. Biol. 1995, 27, 933–942. [Google Scholar] [CrossRef] [PubMed]
- Ellis, C.; Turner, J.G. The Arabidopsis Mutant cev1 Has Constitutively Active Jasmonate and Ethylene Signal Pathways and Enhanced Resistance to Pathogens. Plant Cell 2001, 13, 1025–1033. [Google Scholar] [CrossRef]
- Ah-Fong, A.M.V.; Kim, K.S.; Judelson, H.S. RNA-seq of life stages of the oomycete Phytophthora infestans reveals dynamic changes in metabolic, signal transduction, and pathogenesis genes and a major role for calcium signaling in development. BMC Genom. 2017, 18, 198. [Google Scholar] [CrossRef]
- Rodenburg, S.Y.A.; Seidl, M.F.; Judelson, H.S.; Vu, A.L.; Govers, F.; de Ridder, D. Metabolic Model of the Phytophthora infestans-Tomato Interaction Reveals Metabolic Switches during Host Colonization. mBio 2019, 10, e00454-19. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Liu, J.; Mishra, B.; Mukhtar, M.S.; McDowell, J.M. Sparking a sulfur war between plants and pathogens. Trends Plant Sci. 2022, 27, 1253–1265. [Google Scholar] [CrossRef] [PubMed]
- Cain, T.J.; Smith, A.T. Ferric iron reductases and their contribution to unicellular ferrous iron uptake. J. Inorg. Biochem. 2021, 218, 111407. [Google Scholar] [CrossRef] [PubMed]
- Herlihy, J.H. The Impact of Iron Deficiency on Plant-Oomycete Interactions; Virginia Tech: Blacksburg, VA, USA, 2020. [Google Scholar]
- Ökmen, B.; Bachmann, D.; De Wit, P.J. A conserved GH17 glycosyl hydrolase from plant pathogenic Dothideomycetes releases a DAMP causing cell death in tomato. Mol. Plant Pathol. 2019, 20, 1710–1721. [Google Scholar] [CrossRef] [PubMed]
- Armendáriz-Ruiz, M.; Rodríguez-González, J.A.; Camacho-Ruíz, R.M.; Mateos-Díaz, J.C. Carbohydrate Esterases: An Overview. In Lipases and Phospholipases: Methods and Protocols; Sandoval, G., Sandoval, G., Eds.; Springer: Berlin/Heidelberg, Germany, 2018; pp. 39–68. [Google Scholar] [CrossRef]
- Mindrebo, J.T.; Nartey, C.M.; Seto, Y.; Burkart, M.D.; Noel, J.P. Unveiling the functional diversity of the alpha/beta hydrolase superfamily in the plant kingdom. Curr. Opin. Struct. Biol. 2016, 41, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Duan, W.; Wei, C.; Chen, K.; Grierson, D.; Zhang, B. Genome-Wide Identification and Functional Analysis of Carboxylesterase and Methylesterase Gene Families in Peach (Prunus persica L. Batsch). Front. Plant Sci. 2019, 10, 1511. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Hwang, S.; Seo, Y.W.; Jeon, W.B.; Oh, B.-J. Molecular characterization of the AtCXE8 gene, which promotes resistance to Botrytis cinerea infection. Plant Biotechnol. Rep. 2013, 7, 109–119. [Google Scholar] [CrossRef]
- Rui, C.; Peng, F.; Fan, Y.; Zhang, Y.; Zhang, Z.; Xu, N.; Zhang, H.; Wang, J.; Li, S.; Yang, T.; et al. Genome-wide expression analysis of carboxylesterase (CXE) gene family implies GBCXE49 functional responding to alkaline stress in cotton. BMC Plant Biol. 2022, 22, 194. [Google Scholar] [CrossRef]
- Seo, H.-H.; Park, A.R.; Lee, H.-H.; Park, S.; Han, Y.-J.; Hoang, Q.T.N.; Choi, G.J.; Kim, J.-C.; Kim, Y.S.; Kim, J.-I. A Fungus-Inducible Pepper Carboxylesterase Exhibits Antifungal Activity by Decomposing the Outer Layer of Fungal Cell Walls. MPMI 2018, 31, 505–515. [Google Scholar] [CrossRef]
- Hiscock, S.J.; Bown, D.; Gurr, S.J.; Dickinson, H.G. Serine esterases are required for pollen tube penetration of the stigma in Brassica. Sex. Plant Reprod. 2002, 15, 65–74. [Google Scholar] [CrossRef]
- de Vries, S.; de Vries, J.; Archibald, J.M.; Slamovits, C.H. Comparative analyses of saprotrophy in Salisapilia sapeloensis and diverse plant pathogenic oomycetes reveal lifestyle-specific gene expression. FEMS Microbiol. Ecol. 2020, 96, fiaa184. [Google Scholar] [CrossRef] [PubMed]
- Mahapatra, R. Production, Purification, and Characterization of Elicitin from Phytophthora Species. In Biotic Elicitors: Production, Purification, and Characterization; Amin, D., Amaresan, N., Ray, S., Amin, D., Amaresan, N., Ray, S., Eds.; Springer: New York, NY, USA, 2022; pp. 13–17. [Google Scholar]
- Derevnina, L.; Dagdas, Y.F.; De la Concepcion, J.C.; Bialas, A.; Kellner, R.; Petre, B.; Domazakis, E.; Du, J.; Wu, C.-H.; Lin, X.; et al. Nine things to know about elicitins. New Phytol. 2016, 212, 888–895. [Google Scholar] [CrossRef] [PubMed]
- Kamoun, S.; Young, M.; Förster, H.; Coffey, M.D.; Tyler, B.M. Potential Role of Elicitins in the Interaction between Phytophthora Species and Tobacco. Appl. Environ. Microbiol. 1994, 60, 1593–1598. [Google Scholar] [CrossRef] [PubMed]
- Kasuga, T.; Gijzen, M. Epigenetics and the evolution of virulence. Trends Microbiol. 2013, 21, 575–582. [Google Scholar] [CrossRef] [PubMed]
- Deb, D.; Anderson, R.G.; How-Yew-Kin, T.; Tyler, B.M.; McDowell, J.M. Conserved RxLR effectors from oomycetes hyaloperonospora arabidopsidis and phytophthora sojae suppress PAMP—And effector-triggered immunity in diverse plants. Mol. Plant-Microbe Interact. 2018, 31, 374–385. [Google Scholar] [CrossRef] [PubMed]
- Pozo, M.J.; Van Loon, L.C.; Pieterse, C.M.J. Jasmonates—Signals in Plant-Microbe Interactions. J. Plant Growth Regul. 2004, 23, 211–222. [Google Scholar] [CrossRef]
- Takemoto, D.; Jones, D.A.; Hardham, A.R. GFP-tagging of cell components reveals the dynamics of subcellular re-organization in response to infection of Arabidopsis by oomycete pathogens. Plant J. 2003, 33, 775–792. [Google Scholar] [CrossRef] [PubMed]
- Attard, A.; Gourgues, M.; Callemeyn-Torre, N.; Keller, H. The immediate activation of defense responses in Arabidopsis roots is not sufficient to prevent Phytophthora parasitica infection. New Phytol. 2010, 187, 449–460. [Google Scholar] [CrossRef]
- Chuberre, C.; Plancot, B.; Driouich, A.; Moore, J.P.; Bardor, M.; Gügi, B.; Vicré, M. Plant Immunity Is Compartmentalized and Specialized in Roots. Front. Plant Sci. 2018, 9, 1692. [Google Scholar] [CrossRef]
- Le Fevre, R.; O’Boyle, B.; Moscou, M.J.; Schornack, S. Colonization of Barley by the Broad-Host Hemibiotrophic Pathogen Phytophthora palmivora Uncovers a Leaf Development–Dependent Involvement of Mlo. MPMI 2016, 29, 385–395. [Google Scholar] [CrossRef]
Gen Name | Sequence (5′->3′) |
---|---|
Gh17-Fw | GGAGGCGTACTTCGGTCTGT |
Gh17-Rv | GCCACCCACAACGGTGATTG |
Eli17-Fw | GCGGAAGTGCCGTTCTATCC |
Eli17-Rv | AGCCCATGGCCTGAGTATCG |
CXE-Fw | CCTCGTGTGGATGGCTTTAT |
CXE-Rv | CCTCGTGTAGCTCGTGTGAA |
RXLR_40906-Fw | TCTCTTCCGGTGTCGATCCT |
RXLR_40906-Rv | GAGCGATGTCATCCCACCAG |
RXLR_44719-Fw | CTCGCTACGAAGTTGGCTGA |
RXLR_44719-Rv | CAACATTGCGGTCCTTTGCA |
FRE-Fw | GCGTTCGATTCTCAACGAGC |
FRE-Rv | CTAGCATCGTCACGGCAGAT |
Hpm1-Fw | TGCCATTCTTGATCTGCCGT |
Hpm1-Rv | CAGATTCACGCAGCATGAGC |
NmrA-Fv | CAACGTGGTTGTTCGGTGAC |
NmrA-Rv | AGGCAGGAATGGGATCTCCT |
MFS_1-Fw | CTGGGTGAGTCTCCTCGGTA |
MFS_1-Rv | GCCACGTAGTAACCGGGTAG |
SulP-Fw | TTGCCATCTTCCTCATGCGT |
SulP-Rv | CGAAGCGGTCACCATCGATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
García-Gaona, M.; Romero, H.M. Infection of Phytophthora palmivora Isolates on Arabidopsis thaliana. J. Fungi 2024, 10, 446. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10070446
García-Gaona M, Romero HM. Infection of Phytophthora palmivora Isolates on Arabidopsis thaliana. Journal of Fungi. 2024; 10(7):446. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10070446
Chicago/Turabian StyleGarcía-Gaona, Mariandrea, and Hernán Mauricio Romero. 2024. "Infection of Phytophthora palmivora Isolates on Arabidopsis thaliana" Journal of Fungi 10, no. 7: 446. https://0-doi-org.brum.beds.ac.uk/10.3390/jof10070446