An Improved Technique for Genotyping the ABCB1 Gene Variant of Exon 21 †
Abstract
:1. Introduction
2. Experimental Design
2.1. Equipment
- Thermal Cycler
- Thermostatic digital dry bath
- Electrophoresis Tank and Power supply
2.2. Biological Material
3. Procedure
3.1. Primers Design
3.2. Genotypic Evaluation
3.3. Data Analysis
4. Expected Results
4.1. Improvement of the PCR Technique
4.2. Discussion
5. Reagents Setup
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoffmeyer, S.; Burk, O.; von Richter, O.; Arnold, H.; Brockmöller, J.; Johne, A.; Cascorbi, I.; Gerloff, T.; Roots, I.; Eichelbaum, M.; et al. Functional polymorphisms of the human multidrug-resistance gene: Multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 3473–3478. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, Y.; Li, Y.; Yang, L. MDR1 gene polymorphisms and clinical relevance. Acta Genet. Sin. 2006, 33, 93–104. [Google Scholar] [CrossRef] [PubMed]
- Fung, K.L.; Gottesman, M.M. A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function. Biochim. Biophys. Acta 2009, 1794, 860–871. [Google Scholar] [CrossRef] [PubMed]
- Zolnerciks, J.; Booth-Genthe, C.; Gupta, A.; Harris, J.; Unadkat, J. Substrate- and species-dependent inhibition of P-glycoprotein-mediated transport: Implications for predicting in vivo drug interactions. J. Pharm. Sci. 2011, 100, 3055–3061. [Google Scholar] [CrossRef] [PubMed]
- Thomas, C.; Tampé, R. Structural and Mechanistic Principles of ABC Transporters. Annu. Rev. Biochem. 2020, 89, 605–636. [Google Scholar] [CrossRef]
- Fromm, M.F. P-glycoprotein: A defence mechanism limiting oral bioavailability and CNS accumulation of drugs. Int. J. Clin. Pharmacol. Ther. 2000, 38, 69–74. [Google Scholar] [CrossRef]
- Tanigawara, Y. Role of P-glycoprotein in drug disposition. Ther. Drug Monit. 2000, 22, 137–140. [Google Scholar] [CrossRef]
- Schwab, M.; Eichelbaum, M.; Fromm, M. Genetic polymorphisms of the human MDR1 drug transporter. Ann. Rev. Pharmacol. Toxicol. 2003, 43, 285–307. [Google Scholar] [CrossRef]
- Thuerauf, N.; Fromm, M. The role of the transporter P-glycoprotein for disposition and effects of centrally acting drugs and for the pathogenesis of CNS diseases. Eur. Arch. Psychiatry Clin. Neurosci. 2006, 256, 281–286. [Google Scholar] [CrossRef]
- Taheri, M.; Mahjoubi, F.; Omranipour, R. Effect of MDR1 polymorphism on multidrug resistance expression in breast cancer patients. Gen. Mol. Res. 2010, 9, 34–40. [Google Scholar] [CrossRef]
- Brambila-Tapia, A.J. MDR1 (ABCB1) polymorphisms: Functional effects and clinical implications. Rev. Investig. Clin. 2013, 65, 445–454. [Google Scholar]
- Wolking, S.; Schaeffeler, E.; Lerche, H.; Schwab, M.; Nies, A. Impact of genetic polymorphisms of ABCB1 (MDR1, P-Glycoprotein) on drug disposition and potential clinical implications: Update of the literature. Clin. Pharmacokinet. 2015, 54, 709–735. [Google Scholar] [CrossRef]
- Jurkic, K.C.; Subramanian, N.; Mark, A.; O’Mara, M.L. The reliability of molecular dynamics simulations of the multidrug transporter P-glycoprotein in a membrane environment. PLoS ONE 2018, 13, e0191882. [Google Scholar]
- Moore, J.M.; Bell, E.; Hughes, R.O.; Garfield, A.S. ABC transporters: Human disease and pharmacotherapeutic potential. Trends Mol. Med. 2023, 29, 152–172. [Google Scholar] [CrossRef]
- Mollazadeh, S.; Sahebkar, A.; Hadizadeh, F.; Behravan, J.; Arabzadeh, S. Structural and functional aspects of P-glycoprotein and its inhibitors. Life Sci. 2018, 214, 118–123. [Google Scholar] [CrossRef]
- Brant, S.; Panhuysen, C.; Nicolae, D.; Reddy, D.; Bonen, D.; Karaliukas, R.; Zhang, L.; Swanson, E.; Datta, L.; Moran, T.; et al. Ala893 polymorphism is associated with inflammatory bowel disease. Am. J. Hum. Genet. 2003, 73, 1282–1292. [Google Scholar] [CrossRef]
- Bart, G.; Giang, L.; Yen, H.; Hodges, J.; Brundage, R. Effect of HIV, antiretrovirals, and genetics on methadone pharmacokinetics: Results from the methadone antiretroviral pharmacokinetics study. Drug Alcohol Depend. 2021, 227, 109025. [Google Scholar] [CrossRef]
- Lähteenmäki, J.; Vuorinen, A.L.; Pajula, J.; Harno, K.; Lehto, M.; Niemi, M.; van Gils, M. Pharmacogenetics of Bleeding and Thromboembolic Events in Direct Oral Anticoagulant Users. Clin. Pharmacol. Ther. 2021, 110, 768–776. [Google Scholar] [CrossRef]
- Vivaldi, C.; Crucitta, S.; Catanese, S.; Cucchiara, F.; Arrigoni, E.; Pecora, I.; Rofi, E.; Fornaro, L.; Salani, F.; Massa, V.; et al. Comprehensive pharmacogenetic analysis of DPYD, UGT, CDA, and ABCB1 polymorphisms in pancreatic cancer patients receiving mFOLFIRINOX or gemcitabine plus nab-paclitaxel. Pharmacogenom. J. 2021, 21, 233–242. [Google Scholar] [CrossRef]
- Song, C.; Li, X.; Zhang, H.; Bao, J.; Lu, W.; Peng, Q.; Zhang, Y. Impact of MDR1 and UGT Gene Polymorphisms on Sodium Valproate Plasma Concentration in Patients with Epilepsy. Clin. Lab. 2022, 1, 68. [Google Scholar] [CrossRef]
- Saiz-Rodríguez, M.; Valdez-Acosta, S.; Borobia, A.; Burgueño, M.; Gálvez-Múgica, M.; Acero, J.; Cabaleiro, T.; Muñoz-Guerra, M.; Puerro, M.; Llanos, L.; et al. Influence of Genetic Polymorphisms on the Response to Tramadol, Ibuprofen, and the Combination in Patients with Moderate to Severe Pain after Dental Surgery. Clin. Ther. 2021, 43, e86–e102. [Google Scholar] [CrossRef]
- Chen, Y.; Lu, J.; Huang, C.; Wu, W.; Lee, K.; Liu, H.; Wu, L.S.-H. Pharmacogenetic study of methadone treatment for heroin addiction: Associations between drug-metabolizing gene polymorphisms and treatment efficacy. Pharmacogenet. Genom. 2021, 32, 31–38. [Google Scholar] [CrossRef]
- Irwin, M.; Ellingrod, V.; Smith, M. Pharmacogenetics of Methadone for Pain Management in Palliative Care. J. Pain Symptom Manage. 2022, 63, e142–e145. [Google Scholar] [CrossRef]
- Maeda, A.; Ando, H.; Irie, K.; Hashimoto, N.; Morishige, J.I.; Fukushima, S.; Okada, A.; Ebi, H.; Matsuzaki, M.; Iwata, H.; et al. Effects of ABCB1 and ABCG2 polymorphisms on the pharmacokinetics of abemaciclib. Eur. J. Clin. Pharmacol. 2022, 78, 1239–1247. [Google Scholar] [CrossRef]
- Pagnotta, P.; Melito, V.; Lavandera, J.; Parera, V.; Rossetti, M.; Zuccoli, J.; Buzaleh, A. Role of ABCB1 and glutathione S-transferase gene variants in the association of porphyria cutanea tarda and human immunodeficiency virus infection. Biomed. Rep. 2021, 14, 22. [Google Scholar] [CrossRef]
- Manrique Bojórquez, N.Z.; Zuccoli, J.; Pagnotta, P.; Parera, V.; Rossetti, M.; Batlle, A.; Melito, V.; Buzaleh, A. MDR1 polymorphims and Acute Intermittent Porphyria. Medicina 2018, 78 (Suppl. III), 197. [Google Scholar]
- Pagnotta, P.; Buscalia, M.; Zuccoli, J.; Melito, V.; Parera, V.; Buzaleh, A. Bioinformatic complementation of the role of genetic variants in the manifestation of Porphyrias. Medicina 2022, 82 (Suppl. V), 92–93. [Google Scholar]
- Elghannam, D.; Ibrahim, L.; Ebrahim, M.; Azmy, E.; Hakem, H. Association of MDR1 gene polymorphism (G2677T) with imatinib response in Egyptian chronic myeloid leukemia patients. Hematology 2014, 19, 123–128. [Google Scholar] [CrossRef]
- Zoto, T.; Kilickap, S.; Yasar, U.; Celik, I.; Bozkurt, A.; Babaoglu, M. Improved anti-emetic efficacy of 5-HT3 receptor antagonists in cancer patients with genetic polymorphisms of ABCB1 (MDR1) drug transporter. Basic Clin. Pharmacol. Toxicol. 2015, 116, 354–360. [Google Scholar] [CrossRef]
- Cascorbi, I.; Gerloff, T.; Johne, A.; Meisel, C.; Hoffmeyer, S.; Schwab, M.; Schaeffeler, E.; Eichelbaum, M.; Brinkmann, U.; Roots, I. Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects. Clin. Pharmacol. Ther. 2001, 69, 169–174. [Google Scholar] [CrossRef]
- Zhang, Y.; Jiang, X.; Hu, Y.; Li, Z.; Su, L.; Wang, Z.; Ma, G. MDR1 genotypes do not influence the absorption of a single oral dose of 600 mg valacyclovir in healthy Chinese Han ethnic males. Br. J. Clin. Pharmacol. 2008, 66, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Cusinato, D.; Lacchini, R.; Romao, E.; Moysés-Neto, M.; Coelho, E. Relationship of CYP3A5 genotype and ABCB1 diplotype to tacrolimus disposition in Brazilian kidney transplant patients. Br. J. Clin Pharmacol. 2014, 78, 364–372. [Google Scholar] [CrossRef] [PubMed]
- Tovilla-Zárate, C.; Vargas, I.; Hernández, S.; Fresán, A.; Aguilar, A.; Escamilla, R.; Saracco, R.; Palacios, J.; Camarena, B. Association study between the MDR1 gene and clinical characteristics in schizophrenia. Braz. J. Psychiatry 2014, 36, 227–232. [Google Scholar] [CrossRef] [PubMed]
- Smolarz, B.; Skalski, D.; Rysz, A.; Marchel, A.; Romanowicz, H.; Makowska, M. Polymorphism of the multidrug resistance 1 gene MDR1 G2677T/A (rs2032582) and the risk of drug-resistant epilepsy in the Polish adult population. Acta Neurol. Belg. 2017, 117, 849–855. [Google Scholar] [CrossRef]
- Zuccoli, J.; Melito, V.; Ruspini, S.; Lavandera, J.; Abelleyro, M.; Parera, V.; Rossetti, M.; Batlle, A.; Buzaleh, A. Análisis de polimorfismos del exón 21 del gen MDR1 en la asociación Porfiria Cutánea Tardía-VIH. J. Basic Appl. Genet. 2014, XXV, 112. [Google Scholar]
- Pagnotta, P.; Zuccoli, J.; Parera, V.; Rossetti, M.; Lavandera, J.; Batlle, A.; Buzaleh, A.; Melito, V. MDR1 polymorphisms in HIV infected individuals. Its influence in Porphyria Cutanea Tarda triggering. Medicina 2017, 77 (Suppl. 1), 262. [Google Scholar]
- Pagnotta, P.A. Polimorfismos del Gen de Resistencia a Multidrogas y de la Glutatión S-Transferasa. Su Efecto en el Desencadenamiento de la Porfiria Cutánea Tardía en Individuos Infectados con el Virus de la Inmunodeficiencia Humana. Master’s Thesis, University of Buenos Aires, Buenos Aires, Argentina, 2018. [Google Scholar]
- Manrique Bojórquez, N.Z. Polimorfismos del Gen de Resistencia a Multidrogas “ABCB1” en Familias con Porfiria Aguda Intermitente. Master’s Thesis, University of Buenos Aires, Buenos Aires, Argentina, 2019. [Google Scholar]
- Słomka, M.; Sobalska-Kwapi, M.; Wachulec, M.; Bartosz, G.; Strapagiel, D. High Resolution Melting (HRM) for High-Throughput Genotyping-Limitations and Caveats in Practical Case Studies. Int. J. Mol. Sci. 2017, 18, 2316. [Google Scholar] [CrossRef]
- Milojkovic, M.; Stojnev, S.; Jovanovic, I.; Ljubisavljevic, S.; Stefanovic, V.; Sunder, R. Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymorphisms in the Serbian population. Pharmacol. Rep. 2011, 63, 808–814. [Google Scholar] [CrossRef]
Forward Primer: MDR9_New Reverse Primer: MDR10_New | 5’ATACCCCTAGCATTTTTCCATA3’ 5’GCTTTAGTAATGTTGCCGTGAT3’ | |||||
DNA 250 pM, Salt 50 mM | Forward Primer | Reverse Primer | ||||
Primer Tm Primer Overall Stability Primer Location | 50.7 °C −40.0 kc/m 23.44 | 49.5 °C −40.3 kc/m 1123.1102 | ||||
Product Tm – Primer Tm Primers Tm Difference Optimal Annealing Temperature | 23.6 °C 1.2 °C 51.1 °C | |||||
Product Length Product Tm (%GC Method) Product GC Content Product Tm at 6xSSC | 1101 bp 73.1 °C 33.6% 94.7 °C | |||||
Product Melting Temperature (%GC Method) | ||||||
Salt | Formamide | |||||
mM | xSSC | xSSPE | 0% | 10% | 20% | 50% |
1 10 50 165 330 500 1000 | 0.005 0.051 0.256 0.846 1.692 2.564 5.128 | 0.006 0.062 0.312 1.031 2.062 3.125 6.250 | 44.9 61.5 73.1 81.7 86.7 89.7 94.7 | 38.4 55.0 66.6 75.2 80.2 83.2 88.2 | 31.9 48.5 60.1 68.7 73.7 76.7 81.7 | 12.4 29.0 40.6 49.2 54.2 57.2 62.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zuccoli, J.R.; Pagnotta, P.A.; Melito, V.A.; Lavandera, J.V.; Parera, V.E.; Buzaleh, A.M. An Improved Technique for Genotyping the ABCB1 Gene Variant of Exon 21. Methods Protoc. 2023, 6, 53. https://0-doi-org.brum.beds.ac.uk/10.3390/mps6030053
Zuccoli JR, Pagnotta PA, Melito VA, Lavandera JV, Parera VE, Buzaleh AM. An Improved Technique for Genotyping the ABCB1 Gene Variant of Exon 21. Methods and Protocols. 2023; 6(3):53. https://0-doi-org.brum.beds.ac.uk/10.3390/mps6030053
Chicago/Turabian StyleZuccoli, Johanna Romina, Priscila Ayelén Pagnotta, Viviana Alicia Melito, Jimena Verónica Lavandera, Victoria Estela Parera, and Ana María Buzaleh. 2023. "An Improved Technique for Genotyping the ABCB1 Gene Variant of Exon 21" Methods and Protocols 6, no. 3: 53. https://0-doi-org.brum.beds.ac.uk/10.3390/mps6030053