Characteristics of Lipo-Oligosaccharide Loci of Campylobacter jejuni Isolates Associated with Guillain-Barré Syndrome from Hebei, China
Abstract
:1. Introduction
2. Results and Discussion
2.1. Gene Contents and Organizations of the LOS Biosynthesis Loci in 8 C.jejuin Strains
2.2. Discussion
3. Materials and Methods
3.1. Bacteria Identification and Serotyping
3.2. PCR and PCR Products Sequencing
3.3. DNA Sequence Alignment and Assigned GenBank Accession Number
4. Conclusions
Acknowledgments
References
- Allos, BM. Association between Campylobacter infection and Guillain-Barré syndrome. J. Infect. Dis 1997, 176, S125–S128. [Google Scholar]
- Kaldor, J; Speed, BR. Guillain-Barré syndrome and Campylobacter jejuni: A serological study. Br. Med. J. (Clin. Res. Ed.) 1984, 288, 1867–1870. [Google Scholar]
- Nachamkin, I; Allos, BM; Ho, T. Campylobacter species and Guillain-Barré syndrome. Clin. Microbiol. Rev 1998, 11, 555–567. [Google Scholar]
- Speed, B; Kaldor, J; Cavanagh, P. Guillain-Barré syndrome associated with Campylobacter jejuni enteritis. J. Infect 1984, 8, 85–86. [Google Scholar]
- Aspinall, GO; Fujimoto, S; McDonald, AG; Pang, H; Kurjanczyk, LA; Penner, JL. Lipopolysaccharides from Campylobacter jejuni associated with Guillain-Barré syndrome patients mimic human gangliosides in structure. Infect. Immun 1994, 62, 2122–2125. [Google Scholar]
- Moran, AP; Prendergast, MM. Molecular mimicry in Campylobacter jejuni lipopolysaccharides and the development of Guillain-Barré syndrome. J. Infect. Dis 1998, 178, 1549–1551. [Google Scholar]
- Leonard, EE; Tompkins, LS; Falkow, S; Nachamkin, I. Comparison of Campylobacter jejuni isolates implicated in Guillain-Barré syndrome and strains that cause enteritis by a DNA microarray. Infect. Immun 2004, 72, 1199–1203. [Google Scholar]
- Parker, CT; Horn, ST; Gilbert, M; Miller, WG; Woodward, DL; Mandrell, RE. Comparison of Campylobacter jejuni lipooligosaccharide biosynthesis loci from a variety of sources. J. Clin. Microbiol 2005, 43, 2771–2781. [Google Scholar]
- Gilbert, M; Karwaski, MF; Bernatchez, S; Young, NM; Taboada, E; Michniewicz, J; Cunningham, AM; Wakarchuk, WW. The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J. Biol. Chem 2002, 277, 327–337. [Google Scholar]
- Godschalk, PC; Gilbert, M; Jacobs, BC; Kramers, T; Tio-Gillen, AP; Ang, CW; van Den, BN; Li, J; Verbrugh, HA; van, BA; Endtz, HP. Co-infection with two different Campylobacter jejuni strains in a patient with the Guillain-Barré syndrome. Microbes. Infect 2006, 8, 248–253. [Google Scholar]
- Parker, CT; Gilbert, M; Yuki, N; Endtz, HP; Mandrell, RE. Characterization of lipooligosaccharide-biosynthetic loci of Campylobacter jejuni reveals new lipooligosaccharide classes: Evidence of mosaic organizations. J. Bacteriol 2008, 190, 5681–5689. [Google Scholar]
- Ang, CW; Endtz, HP; Jacobs, BC; Laman, JD; de Klerk, MA; van der Meche, FG; van Doorn, PA. Campylobacter jejuni lipopolysaccharides from Guillain-Barré syndrome patients induce IgG anti-GM1 antibodies in rabbits. J. Neuroimmunol 2000, 104, 133–138. [Google Scholar]
- Ang, CW; Noordzij, PG; De Klerk, MA; Endtz, HP; van Doorn, PA; Laman, JD. Ganglioside mimicry of Campylobacter jejuni lipopolysaccharides determines antiganglioside specificity in rabbits. Infect. Immun 2002, 70, 5081–5085. [Google Scholar]
- Xiang, SL; Zhong, M; Cai, FC; Deng, B; Zhang, XP. The sialic acid residue is a crucial component of C. jejuni lipooligosaccharide ganglioside mimicry in the induction Guillain-Barré syndrome. J. Neuroimmunol 2006, 174, 126–132. [Google Scholar]
- Yuki, N; Handa, S; Takahashi, M; Saito, K; Tsujino, Y; Taki, T. Ganglioside-like epitopes of lipopolysaccharides from Campylobacter jejuni (PEN 19) in three isolates from patients with Guillain-Barré syndrome. J. Neurol. Sci 1995, 130, 112–116. [Google Scholar]
- Ang, CW; De Klerk, MA; Endtz, HP; Jacobs, BC; Laman, JD; van Der Meche, FG; van Doorn, PA. Guillain-Barré syndrome and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b Antibodies in rabbits. Infect. Immun 2001, 69, 2462–2469. [Google Scholar]
- Perelle, S; Dilasser, F; Grout, J; Fach, P. Identification of the O-antigen biosynthesis genes of Escherichia coli O91 and development of a O91 PCR serotyping test. J. Appl. Microbial 2002, 93, 758–764. [Google Scholar]
- Nam Shin, J; Ackloo, ES; Mainkar, AS; Monteiro, MA; Pang, H; Penner, JL; Aspinall, GO. Lipo-oligosaccharides of Campylobacter jejuni serotype O:10. Structures of core oligosaccharide regions from a bacterial isolate from a patient with the Miller-Fisher syndrome and from the serotype reference strain. Carbohydr. Res 1998, 305, 223–232. [Google Scholar]
- Koga, M; Takahashi, M; Masuda, M; Hirata, K; Yuki, N. Gene polymorphism as a determinant of clinical features of Campylobacter Guillain-Barré Syndrome. Neurology 2005, 65, 1376–1381. [Google Scholar]
- Godschalk, PC; Heikema, AP; Gilbert, M; Komagamine, T; Ang, CW; Glerum, J; Brochu, D; Li, J; Yuki, N; Jacobs, BC; van Belkum, A; Endtz, HP. The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barré syndrome. J. Clin. Invest 2004, 114, 1659–1665. [Google Scholar]
Strain no. | Isolated Time | Isolated Place | Subtype (GBS) | Penner type (HS) | LOS locus class |
---|---|---|---|---|---|
LLCj | 1993 | HeiBei Province | AMAN | 37 | P |
ZXCj | 1993 | HeiBei Province | AMAN | 37 | P |
LCCj | 1993 | HeiBei Province | AIDP | ND | H |
LXCCj | 1993 | HeiBei Province | AMAN | 19 | A |
QYTCj | 1993 | HeiBei Province | AMAN | 2 | A |
ZBCj | 1993 | HeiBei Province | AMAN | 19 | A |
ZHXCj | 1993 | HeiBei Province | AMAN | ND | A |
XWMCj | 1993 | HeiBei Province | AMAN | ND | F |
Primer no. | Primer sequence5′-3′ |
---|---|
P1 a | AAAGAATACGAATTTGCTAAAGAGG |
P2 b | ATCATAAAAATCACTTGCCAAAACT |
P3 b | AATTTTCCAAGAGGAGCACATGCAC |
P4 b | CTATGGTGTAAGTGGGCATTGGGCT |
P5 b | AAAAGCCCAATGCCCACTTACAC |
P6 a | TTGCCAAGGTGAAGTTTGAGTAA |
P7 c | ACATATAGACCCCTGAGGTAATTCTTT |
P8 c | GTTATTATTGCTGGAAATGGACCAAGT |
© 2010 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Jiang, H.; Zhang, M.-J.; Liu, R.-C.; Tian, X.-Y.; Gu, Y.-X.; Zhang, J.-Z. Characteristics of Lipo-Oligosaccharide Loci of Campylobacter jejuni Isolates Associated with Guillain-Barré Syndrome from Hebei, China. Int. J. Mol. Sci. 2010, 11, 1155-1161. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms11031155
Jiang H, Zhang M-J, Liu R-C, Tian X-Y, Gu Y-X, Zhang J-Z. Characteristics of Lipo-Oligosaccharide Loci of Campylobacter jejuni Isolates Associated with Guillain-Barré Syndrome from Hebei, China. International Journal of Molecular Sciences. 2010; 11(3):1155-1161. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms11031155
Chicago/Turabian StyleJiang, Hai, Mao-Jun Zhang, Rui-Chun Liu, Xin-Ying Tian, Yi-Xin Gu, and Jian-Zhong Zhang. 2010. "Characteristics of Lipo-Oligosaccharide Loci of Campylobacter jejuni Isolates Associated with Guillain-Barré Syndrome from Hebei, China" International Journal of Molecular Sciences 11, no. 3: 1155-1161. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms11031155