Isolation and Characterization of 11 New Microsatellite Loci in Erigeron breviscapus (Asteraceae), an Important Chinese Traditional Herb
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgements
References
- Liu, H; Yang, XL; Ding, JY; Feng, YD; Xu, HB. Antibacterial and antifungal activity of Erigeron breviscapus. Fitoterapia 2003, 74, 387–389. [Google Scholar]
- Lin, R; Chen, YL; Shi, Z. Flora Reipublicae Popularis Sinicae; Science Press: Beijing, China, 1985; Volume 74, pp. 308–309. [Google Scholar]
- Tao, YH; Jiang, DY; Xu, HB; Yang, XL. Inhibitory effect of Erigeron breviscapus extract and its flavonoid components on GABA shunt enzymes. Phymedicine 2008, 15, 92–97. [Google Scholar]
- Sun, HD; Zhao, QS. A drug for treating cardio-cerebrovascular diseases—Phenolic compounds of Erigeron breviscapus. Prog. Chem 2009, 21, 77–83. [Google Scholar]
- Yu, HY; Chen, ZL. Study on artificial culture of Erigeron breviscapus. Acta Bot. Yunnanica 2002, 24, 115–120. [Google Scholar]
- Raymond, M; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Doyle, JJ; Dickson, E. Preservation of plant samples for DNA restriction endonuclease analysis. Taxon 1987, 36, 715–722. [Google Scholar]
- Chen, T; Zhou, RC; Ge, XJ; Shi, SH. Development and characterization of microsatellite markers for a mangrove tree species Sonneratia caseolaris (L.) Engler (Lythraceae sensu lato). Conserv. Genet 2008, 9, 957–959. [Google Scholar]
- Zane, L; Bargelloni, L; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Gary, B. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res 1999, 27, 573–580. [Google Scholar]
- Clarke, KR; Gorley, RN. PRIMER (Version 5): User Manual/Tutorial; PRIMER-E Ltd.: Plymouth, UK, 2001; p. 91. [Google Scholar]
Locus | GenBank Accession NO. | Repeat Motif | Primer Sequences(5′-3′) | Size Range (bp) | Ta (°C) | A | HO | HE |
---|---|---|---|---|---|---|---|---|
EB-2 | HM173666 | (AC)7-(AC)9-(ACC)5 | F: CAAAAAGAAAACCACCCCC R: ACGCCGAAGGAGAAAGAG | 144–170 | 58 | 6 | 0.708 | 0.612 |
EB-8 | HM173667 | (GT)11-(AG)5 | F: CCACCAAAGTGCCAAATCC R: CAAAACCCTTACACCCTCCC | 275–285 | 60 | 4 | 0.958 | 0.685 * |
EB-10 | HM173668 | (AC)13(CT)3CAT(CT)3TT(CT)2 | F: TCATTTACCCTTATCTCC R: GGTGTAAGAATTTTAGTGAG | 100–110 | 57 | 5 | 0.542 | 0.732 * |
EB-11 | HM173669 | (GT)6 | F: AAGCGTGTACGTGTGTTC R: CCTTTTCATCTTCCAGTCTC | 143–157 | 57 | 3 | 0.833 | 0.528 * |
EB-17 | HM173670 | (TTG)5-(GTG)6-(TGG)4-(GT)4TT(GT)9TT(GT)4 | F: CTAAAACATCATCTTCCAC R: ACTTATTTCCCCTTCCTC | 195–225 | 53 | 4 | 0.417 | 0.426 |
EB-28 | HM173671 | (AG)2A(AG)4A(AG)3 | F: AAGGAGGATGAGGGTGT R: GCAAGAGTGTTAGTGGG | 135–145 | 62 | 3 | 0.917 | 0.582 * |
EB-30 | HM173672 | (CT)11(TA)7 | F: AGGCTACTTTGAAGGTTTCA R: AATCTAACCCACCCCTATG | 220–266 | 54 | 7 | 0.250 | 0.786 * |
EB-40 | HM173673 | (AC)11 | F: GTAAACCAGCAGGCACT R: ATGGAGATGGAGGGATG | 140–160 | 54 | 6 | 0.792 | 0.726 |
EB-47 | HM173674 | (TC)12-(CA)9TA(CA)4 | F: AGGTATTTTCGGGTCAC R: AACTGCCACGTCAAGTA | 170–184 | 54 | 4 | 0.792 | 0.533 |
EB-48 | HM173675 | (TTC)5 | F: CCAGTCAGTGGGTAAAGTATG R: GAGTTTGTCCAAGAGAGGTG | 180–190 | 58 | 2 | 0.417 | 0.337 |
EB-55 | HM173676 | (GA)5CA(GA)CA(GA)2 | F: GAGATTATCGTGTTGCCG R: AGGACCCTGTTGAAAGTTAC | 245–259 | 55 | 3 | 0.250 | 0.370 |
Locus | E. canadensis (n = 4) | E. altaicus (n = 4) |
---|---|---|
EB-2 | N | P(2) |
EB-8 | W | M |
EB-10 | N | N |
EB-11 | P(3) | M |
EB-17 | M | N |
EB-28 | M | M |
EB-30 | N | N |
EB-40 | N | P(2) |
EB-47 | M | P(2) |
EB-48 | M | P(2) |
EB-55 | N | M |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Li, X.; Song, K.; Yang, J.; Yi, T. Isolation and Characterization of 11 New Microsatellite Loci in Erigeron breviscapus (Asteraceae), an Important Chinese Traditional Herb. Int. J. Mol. Sci. 2011, 12, 7265-7270. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms12107265
Li X, Song K, Yang J, Yi T. Isolation and Characterization of 11 New Microsatellite Loci in Erigeron breviscapus (Asteraceae), an Important Chinese Traditional Herb. International Journal of Molecular Sciences. 2011; 12(10):7265-7270. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms12107265
Chicago/Turabian StyleLi, Xiang, Kexian Song, Junbo Yang, and Tingshuang Yi. 2011. "Isolation and Characterization of 11 New Microsatellite Loci in Erigeron breviscapus (Asteraceae), an Important Chinese Traditional Herb" International Journal of Molecular Sciences 12, no. 10: 7265-7270. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms12107265