Isolation and Characterization of Polymorphic Microsatellite Markers from the Chinese Medicinal Herb Atractylodes macrocephala (Asteraceae)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Data Analysis
4. Conclusions
Supplementary Information
ijms-13-16046-s001.pdfAcknowledgments
References
- Shi, Y.Y.; Guan, S.H.; Tang, R.N.; Tao, S.J.; Guo, D.A. Simultaneous determination of four sesquiterpenoids in Atractylodes macrocephala Rhizoma by GC-FID: Optimisation of an ultrasound-assisted extraction by central composite design. Phytochem. Anal 2012, 23, 408–414. [Google Scholar]
- Shiba, M.; Kondo, K.; Miki, E.; Yamaji, H.; Morota, T.; Terabayashi, S.; Takeda, S.; Miyamoto, K.; Aburada, M. Identification of medicinal Atractylodes based on ITS sequences of nrDNA. Biol. Pharm. Bull 2006, 29, 315–320. [Google Scholar]
- Pharmacopoeia Commission of People’s Republic of China, Pharmacopoeia of the People’s Republic of China (in Chinese), 2010 ed; China Chemical Industry Press: Beijing, China, 2010; Volume 1, pp. 95–96.
- Wang, K.T.; Chen, L.G.; Wu, C.H.; Chang, C.C.; Wang, C.C. Gastroprotective activity of atractylenolide III from Atractylodes ovata on ethanol-induced gastric ulcer in vitro and in vivo. J. Pharm. Pharmacol 2010, 62, 381–388. [Google Scholar]
- Wang, C.H.; Duan, H.J.; He, L.C. Inhibitory effect of atractylenolide I on angiogenesis in chronic inflammation in vivo and in vitro. Eur. J. Pharmacol 2009, 612, 143–152. [Google Scholar]
- Kang, T.H.; Bang, J.Y.; Kim, M.H.; Kang, I.C.; Kim, H.M.; Jeong, H.J. Atractylenolide III a sesquiterpenoid, induces apoptosis in human lung carcinoma A549 cells via mitochondria-mediated death pathway. Food. Chem. Toxicol 2011, 49, 514–519. [Google Scholar]
- Kim, H.K.; Yun, Y.K.; Ahn, Y.J. Toxicity of atractylon and atractylenolide III identified in Atractylodes ovata rhizome to Dermatophagoides farinae and Dermatophagoides pteronyssinus. J. Agric. Food. Chem 2007, 55, 6027–6031. [Google Scholar]
- Zou, X.X. A pharmacophylogenetic study of Atractylodes DC (in Chinese). In Ph.D. thesis; Beijing University of Chinese Medicine: Beijing, China, May 2010. [Google Scholar]
- Zhang, H.C.; Hu, C.Y.; Hu, X.Q.; Chen, A.Z. The biological property and planting technology of Atractylodes macrocephala (in Chinese). Forest Prod. China 2005, 2, 8–9. [Google Scholar]
- Manifesto, M.M.; Schlatter, A.R.; Hopp, H.E.; Suarez, E.Y.; Dubcovsky, J. Quantitative evaluation of genetic diversity in wheat germplasm using molecular markers. Crop. Sci 2001, 41, 682–690. [Google Scholar]
- Liu, Y.H.; Chen, B.L.; Li, P.; Qiu, Y.X.; Fu, C.X. Studies on the genetic diversity of cultivated populations of Atractylodes macrocephala by ISSR (in Chinese). China J. Chin. Mater. Med 2008, 33, 2756–2760. [Google Scholar]
- Xu, X.H.; Wan, Y.; Qi, Z.C.; Qiu, Y.X.; Fu, C.X. Isolation of compound microsatellite markers for the common Mediterranean shrub Smilax aspera (Smilacaceae). Am. J. Bot 2011, 98, e64–e66. [Google Scholar]
- Lian, C.L.; Wadud, M.A.; Geng, Q.; Shimatani, K.; Hogetsu, T. An improved technique for isolating codominant compound microsatellite markers. J. Plant Res 2006, 119, 415–417. [Google Scholar]
- Doyle, J.J. DNA Protocols for Plants-CTAB Total DNA Isolation. In Molecular Techniques in Taxonomy; Hewittand, G.M., Johnston, A., Eds.; Springer-Verlag: Berlin, Germany, 1991; pp. 283–293. [Google Scholar]
- Zhai, S.N.; Yan, X.L.; Nakamura, K.; Mishima, M.; Qiu, Y.X. Isolation of compound microsatelite markers for the endangered plant Neolitsea sericea (Lauraceae). Am. J. Bot 2010, 97, e139–e141. [Google Scholar]
- Yuan, N.; Sun, Y.; Nakamura, K.; Qiu, Y.X. Development of microsatellite markers in heterostylous Hedyotis chrysotricha (Rubiaceae). Am. J. Bot 2012, 99, e43–e45. [Google Scholar]
- Clarke, K.R.; Gorley, R.N. Primer v5: User Manual/Tutorial; Primer-E Ltd: Plymouth, UK, 2001. [Google Scholar]
- Kallnowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol 2007, 16, 1099–1106. [Google Scholar]
- Rousset, F. Genepop’007: A complete re-implementation of the Genepop software for Windows and Linux. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 536–538. [Google Scholar]
Locus | Repeat motif | Primer sequence (5′ to 3′) | Ta(°C) | Size range (bp) | Na | GenBank Accesion no. |
---|---|---|---|---|---|---|
Am1 | (AC)6(AG)7 | F: (AC)6(AG)5 R: TTACCACGATGAGCAAAAC | 54 | 77–89 | 5 | JX242500 |
Am2 | (AC)6(AG)5GG(AG)4 | F: (AC)6(AG)5 R: CTATTGCCACCTTCTTGC | 52 | 225–275 | 18 | JX242501 |
Am3 | (AC)6(AG)6 | F: (AC)6(AG)5 R: TATCGGGTACATCAGAGCA | 50 | 166–172 | 2 | JX242502 |
Am4 | (TC)6(AC)8AT(AC)2 | F: (TC)6(AC)5 R: ATACGCAAAACTCGAACC | 58 | 123–149 | 12 | JX242503 |
Am5 | (TC)6(AC)8AT(AC)2 | F: (TC)6(AC)5 R: AAGGTGGAGCTAGGAAATC | 50 | 159–173 | 5 | JX242504 |
Am6 | (TC)6(AC)9ATAC | F: (TC)6(AC)5 R: TGGAATCGAATCCCTAAA | 52 | 90–106 | 7 | JX242505 |
Am7 | (TC)6(AC)11AT(AC)12 | F: (TC)6(AC)5 R: TTGAACCCTGTTGACCATA | 56 | 232–264 | 16 | JX242506 |
Am8 | (TC)6(AC)5AT(AC)4 | F: (TC)6(AC)5 R: GGTAGTAGAACCCAAGCAA | 54 | 163–189 | 5 | JX242507 |
Am9 | (TC)6(AC)19 | F: (TC)6(AC)5 R: CAGAAATATCGGAACTCCTT | 52 | 206–242 | 18 | JX242508 |
Am10 | (TC)6(AC)7 | F: (TC)6(AC)5 R: GGCAGCCATTACAACTCA | 56 | 83–89 | 6 | JX242509 |
Am11 | (TC)6(AC)14TC(AC)2 | F: (TC)6(AC)5 R: TATCCTTACTCGGACATTACA | 50 | 260–290 | 12 | JX242510 |
Am12 | (TC)6(AC)10 | F: (TC)6(AC)5 R: TCGAAATTCTTACCGTCAA | 54 | 251–297 | 20 | JX242511 |
Am13 | (TC)6(AC)5 | F: (TC)6(AC)5 R: ACGTTATCGTCCGAAATG | 52 | 154–160 | 4 | JX242512 |
Am14 | (TC)6(AC)5(AT)3 | F: (TC)6(AC)5 R: GGTAGTGGCTATTGGGACT | 52 | 197–199 | 2 | JX242513 |
Am15 | (TC)6(AC)10AT(AC)5 | F: (TC)6(AC)5 R: CTATGTTAGAAGGCTGGTGTT | 50 | 205–241 | 17 | JX242514 |
Am16 | (AC)6(AG)5 | F: (AC)6(AG)5 R: CCGTATCATGGGAGGTAA | 52 | 132 | 1 | JX964787 |
Am17 | (AC)6(AG)5 | F: (AC)6(AG)5 R: TTACCTTTGAGTTCTTTACACC | 54 | 85 | 1 | JX964788 |
Am18 | (AC)6(AG)5 | F: (AC)6(AG)5 R: CTATACCCACCAAGTCACAA | 50 | 194 | 1 | JX964789 |
Am19 | (TC)6(AC)7 | F: (TC)6(AC)5 R: CCAAGTAGGGTCCAGATTC | 56 | 176 | 1 | JX964790 |
Am20 | (TC)6(AC)5 | F: (TC)6(AC)5 R: AAAGCGGAATATGGTTTC | 56 | 165 | 1 | JX964791 |
Locus | Population PA( N = 24 ) | Population PJ( N = 24 ) | Population JL (N = 20 ) | Population MC(N = 15 ) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Na | Ho | He | Na | Ho | He | Na | Ho | He | Na | Ho | He | |
Am1 | 4 | 0.333 | 0.472 n.s. | 4 | 0.375 | 0.332 n.s. | 3 | 0.300 | 0.273 n.s. | 3 | 0.533 | 0.577 n.s. |
Am2 | 12 | 0.792 | 0.846 n.s. | 11 | 0.875 | 0.841 ** | 13 | 1.000 | 0.923 n.s. | 11 | 0.667 | 0.899 n.s. |
Am3 | 2 | 0.750 | 0.511 * | 2 | 0.792 | 0.511 * | 2 | 0.350 | 0.481 n.s. | 2 | 0.533 | 0.497 n.s. |
Am4 | 8 | 0.417 | 0.703 *** | 9 | 0.917 | 0.847 n.s. | 7 | 0.700 | 0.817 n.s. | 10 | 0.800 | 0.853 n.s. |
Am5 | 4 | 0.292 | 0.502 * | 5 | 0.167 | 0.428 *** | 3 | 0.350 | 0.606 * | 3 | 0.333 | 0.297 n.s. |
Am6 | 2 | 0.542 | 0.403 n.s. | 5 | 0.667 | 0.569 n.s. | 6 | 0.700 | 0.728 n.s. | 4 | 0.600 | 0.646 n.s. |
Am7 | 12 | 0.625 | 0.878 *** | 9 | 0.583 | 0.846 *** | 10 | 0.550 | 0.869 *** | 10 | 0.667 | 0.814 n.s. |
Am8 | 5 | 0.625 | 0.738 * | 5 | 0.375 | 0.590 ** | 3 | 0.300 | 0.456 * | 5 | 0.333 | 0.361 n.s. |
Am9 | 12 | 0.875 | 0.847 n.s. | 10 | 0.958 | 0.818 n.s. | 9 | 0.800 | 0.864 n.s. | 12 | 0.867 | 0.910 n.s. |
Am10 | 4 | 0.750 | 0.724 n.s. | 4 | 0.917 | 0.766 n.s. | 5 | 0.800 | 0.792 n.s. | 5 | 0.600 | 0.706 n.s. |
Am11 | 10 | 0.500 | 0.854 *** | 7 | 0.542 | 0.811 ** | 8 | 0.300 | 0.864 *** | 6 | 0.600 | 0.823 * |
Am12 | 11 | 0.917 | 0.882 n.s. | 12 | 0.792 | 0.869 n.s. | 13 | 0.750 | 0.904 * | 13 | 0.667 | 0.938 * |
Am13 | 3 | 0.083 | 0.194 * | 4 | 0.333 | 0.535 * | 2 | 0.100 | 0.097 n.s. | 3 | 0.200 | 0.191 n.s. |
Am14 | 2 | 0.333 | 0.383 n.s. | 2 | 0.250 | 0.223 n.s. | 2 | 0.150 | 0.296 * | 2 | 0.400 | 0.460 n.s. |
Am15 | 13 | 0.458 | 0.910 *** | 9 | 0.292 | 0.885 *** | 11 | 0.300 | 0.859 *** | 12 | 0.467 | 0.924 *** |
Mean | 6.9 | 0.553 | 0.656 | 6.5 | 0.603 | 0.658 | 6.5 | 0.497 | 0.655 | 6.7 | 0.551 | 0.660 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zheng, L.; Shao, Z.-D.; Wang, Z.-C.; Fu, C.-X. Isolation and Characterization of Polymorphic Microsatellite Markers from the Chinese Medicinal Herb Atractylodes macrocephala (Asteraceae). Int. J. Mol. Sci. 2012, 13, 16046-16052. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms131216046
Zheng L, Shao Z-D, Wang Z-C, Fu C-X. Isolation and Characterization of Polymorphic Microsatellite Markers from the Chinese Medicinal Herb Atractylodes macrocephala (Asteraceae). International Journal of Molecular Sciences. 2012; 13(12):16046-16052. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms131216046
Chicago/Turabian StyleZheng, Li, Zhong-Da Shao, Zong-Chao Wang, and Cheng-Xin Fu. 2012. "Isolation and Characterization of Polymorphic Microsatellite Markers from the Chinese Medicinal Herb Atractylodes macrocephala (Asteraceae)" International Journal of Molecular Sciences 13, no. 12: 16046-16052. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms131216046