Emerging Roles of Small Epstein-Barr Virus Derived Non-Coding RNAs in Epithelial Malignancy
Abstract
:1. Introduction
2. EBV Infection in Epithelial Carcinoma
2.1. Nasopharyngeal Carcinoma (NPC)
2.2. EBV-Associated Gastric Carcinoma (EBVaGC)
2.3. Lymphoepithelioma-Like Carcinomas (LELCs)
3. EBV Non Protein-Coding RNAs
3.1. Epstein-Barr Virus-Encoded RNAs (EBERs)
3.2. Bam HI A Rightward Transcripts (BARTs)
3.3. Discovery of BART-Encoded miRNAs
3.4. Discovery of Viral-Encoded snoRNA
4. Expression of Viral miRNAs in Epithelial Cancers
4.1. Ebv-miR-BHRF1s
4.2. Ebv-miR-BARTs
5. Recent Research Development of Viral Small Nucleolar RNA (v-snoRNA1)
5.1. Expression of v-snoRNA1 in NPC
5.2. Nucleotide Polymorphism Is Important for v-snoRNA1 Production
6. Functional Roles of miR-BARTs in Cancer Development
6.1. Methods for miRNA Targets Identification
6.2. Regulation of Viral Gene Expression
6.3. Regulation of Cellular Gene Expression
7. Conclusions and Future Perspectives
Acknowledgments
Appendix
Materials and Methods
Patient Samples
RNA Extraction and Quantitative Reverse Transcription PCR (QRT-PCR)
Expression of BHRF1 and Northern Blot
AGO2 Co-Immunoprecipitation
Induction of Viral Lytic Cycle in NPC Cell Lines
Plasmid Constructs
In Vitro Processing Assay
miRNA | Specific forward primer | Chimeric miRNA mimic | Annealing temp. |
---|---|---|---|
BART1-3p | AGCACCGCTATCCACTATGT | TAGCACCGCTATCCACTATrGrUrC | 55 |
BART1-5p | TCTTAGTGGAAGTGACGTGCT | TCTTAGTGGAAGTGACGTGCTrGrUrG | 60 |
BART2-3p | AGGAGCGATTTGGAGAAAATAA | AAGGAGCGATTTGGAGAAAATrArArA | 60 |
BART2-5p | TATTTTCTGCATTCGCCCTTGC | TATTTTCTGCATTCGCCCTrUrGrC | 60 |
BART3 | CACCACTAGTCACCAGGTGT | CGCACCACTAGTCACCAGGrUrGrU | 60 |
BART4 | ACCTGATGCTGCTGGTGTGC | GACCTGATGCTGCTGGTGTrGrCrU | 64 |
BART5 | AAGGTGAATATAGCTGCCCAT | CAAGGTGAATATAGCTGCCCArUrCrG | 55 |
BART6-3p | GGGATCGGACTAGCCTTAGA | CGGGGATCGGACTAGCCTTrArGrA | 55 |
BART6-5p | TAAGGTTGGTCCAATCCATAGG | TAAGGTTGGTCCAATCCATrArGrG | 55 |
BART7 | CATCATAGTCCAGTGTCCAGGG | CATCATAGTCCAGTGTCCArGrGrG | 60 |
BART8 | TACGGTTTCCTAGATTGTACAG | TACGGTTTCCTAGATTGTArCrArG | 55 |
BART9 | TAACACTTCATGGGTCCCGTAGT | TAACACTTCATGGGTCCCGTrArGrU | 55 |
BART10 | TACATAACCATGGAGTTGGCTGT | TACATAACCATGGAGTTGGCrUrGrU | 60 |
BART11-3p | ACGCACACCAGGCTGACTG | ACGCACACCAGGCTGACTrGrCrC | 62 |
BART11-5p | AGACAGTTTGGTGCGCTAGT | TCAGACAGTTTGGTGCGCTAGrUrUrG | 55 |
BART12 | CTGTGGTGTTTGGTGTGGTT | TCCTGTGGTGTTTGGTGTGrGrUrU | 62 |
BART13 | ACACTCCAGCTGGGTGTAACTTGCCAGGGA | TGTAACTTGCCAGGGACGGCrUrGrA | 62 |
BART14 | TAAATGCTGCAGTAGTAGGGA | TAAATGCTGCAGTAGTAGGrGrArU | 55 |
BART15 | TCAGTGGTTTTGTTTCCTTGA | GTCAGTGGTTTTGTTTCCTrUrGrA | 60 |
BART16 | TAGATAGAGTGGGTGTGTGCTC | TTAGATAGAGTGGGTGTGTGCrUrCrU | 64 |
BART17-3p | GTATGCCTGGTGTTCCCCTTA | TGTATGCCTGGTGTCCCCTTrArGrU | 60 |
BART17-5p | TAAGAGGACGCAGGCATACA | TAAGAGGACGCAGCATACrArArG | 55 |
BART18-3p | TATCGGAAGTTTGGGCTTCGT | TATCGGAAGTTTGGGCTTCrGrUrC | 60 |
BART18-5p | TCAAGTTCGCACTTCCTATAC | TCAAGTTCGCACTTCCTATrArCrA | 55 |
BART19-3p | ACACTCCAGCTGGGUUUUGUUUGCUUGGGA | TTTTGTTTGCTTGGGAATrGrCrU | 55 |
BART19-5p | ACATTCCCCGCAAACATGACAT | ACATTCCCCGCAAACATGACrArUrG | 55 |
BART20-3p | CATGAAGGCACAGCCTGTTAC | CATGAAGGCACAGCCTGTTrArCrC | 60 |
BART20-5p | TAGCAGGCATGTCTTCATTCC | TAGCAGGCATGTCTTCATrUrCrC | 60 |
BART21-5p | CACTAGTGAAGGCAACTAAC | TCACTAGTGAAGGCAACTrArArC | 55 |
BART22 | TTACAAAGTCATGGTCTAGTAGT | TTACAAAGTCATGGTCTAGTrArGrU | 55 |
Lack of association between novel EBER end terminal fragments and AGO2: (A) Expression of small EBER fragments in NPCs was validated by Northern blot analysis. Locations of the EBER1-5p and −3p fragments are indicated with arrow; (B) Western blot analysis of hAGO2 protein from C666-1 whole cell lysate before (Input) and after immunoprecipitation (IP) with anti-AGO2 antibody (left panel). Monoclonal antibody against FLAG tag (lane 2) and against hAGO2 4 (lane 3) were used for IP from C666-1 cell lysate (lane 1). AGO-2 associated miRNAs were analyzed by Northern blot analysis with synthetic oligonucleotide probe for the specific small EBV fragments listed below the figure. Locations of the probed fragments are indicated with arrows. RNA loading was visualized by SYBR Gold stained PAGE. BART22 IP was included as positive control. The information of EBER1-5p and 3p were described in a previous publication [23].
Conflicts of Interest
References
- Epstein, M.A.; Barr, Y.M.; Achong, B.G. A second virus-carrying tissue culture strain (Eb2) of lymphoblasts from burkitt’s lymphoma. Pathol. Biol 1964, 12, 1233–1234. [Google Scholar]
- Zur Hausen, H.; Schulte-Holthausen, H. Presence of EB virus nucleic acid homology in a “virus-free” line of Burkitt tumour cells. Nature 1970, 227, 245–248. [Google Scholar]
- Sitki-Green, D.L.; Edwards, R.H.; Covington, M.M.; Raab-Traub, N. Biology of Epstein-Barr virus during infectious mononucleosis. J. Infect. Dis 2004, 189, 483–492. [Google Scholar]
- Kutok, J.L.; Wang, F. Spectrum of Epstein-Barr virus-associated diseases. Annu. Rev. Pathol 2006, 1, 375–404. [Google Scholar]
- Babcock, G.J.; Decker, L.L.; Volk, M.; Thorley-Lawson, D.A. EBV persistence in memory B cells in vivo. Immunity 1998, 9, 395–404. [Google Scholar]
- Young, L.S.; Rickinson, A.B. Epstein-Barr virus: 40 years on. Nat. Rev. Cancer 2004, 4, 757–768. [Google Scholar]
- Gregory, C.D.; Rowe, M.; Rickinson, A.B. Different Epstein-Barr virus-B cell interactions in phenotypically distinct clones of a Burkitt’s lymphoma cell line. J. Gen. Virol 1990, 71, 1481–1495. [Google Scholar]
- Timms, J.M.; Bell, A.; Flavell, J.R.; Murray, P.G.; Rickinson, A.B.; Traverse-Glehen, A.; Berger, F.; Delecluse, H.J. Target cells of Epstein-Barr-virus (EBV)-positive post-transplant lymphoproliferative disease: Similarities to EBV-positive Hodgkin’s lymphoma. Lancet 2003, 361, 217–223. [Google Scholar]
- Brooks, L.; Yao, Q.Y.; Rickinson, A.B.; Young, L.S. Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: Coexpression of EBNA1, LMP1, and LMP2 transcripts. J. Virol 1992, 66, 2689–2697. [Google Scholar]
- Qu, L.; Rowe, D.T. Epstein-Barr virus latent gene expression in uncultured peripheral blood lymphocytes. J. Virol 1992, 66, 3715–3724. [Google Scholar]
- Shaknovich, R.; Basso, K.; Bhagat, G.; Mansukhani, M.; Hatzivassiliou, G.; Murty, V.V.; Buettner, M.; Niedobitek, G.; Alobeid, B.; Cattoretti, G. Identification of rare Epstein-Barr virus infected memory B cells and plasma cells in non-monomorphic post-transplant lymphoproliferative disorders and the signature of viral signaling. Haematologica 2006, 91, 1313–1320. [Google Scholar]
- Kieff, E.; Johannsen, E.; Calderwood, M.A. Epstein-Barr Virus: Latency and Transformation; Robertson, E.S., Ed.; Caister Academic Press: Norfolk, UK, 2010; pp. 1–24. [Google Scholar]
- Lo, K.W.; To, K.F.; Huang, D.P. Focus on nasopharyngeal carcinoma. Cancer Cell 2004, 5, 423–428. [Google Scholar]
- Hong Kong Cancer Registry. Available online: http://www3.ha.org.hk/cancereg/Statistics.html accessed on 30 June 2013.Hong Kong Cancer Registry. 2010. (accessed on 20 August 2013).
- Marks, J.E.; Phillips, J.L.; Menck, H.R. The national cancer data base report on the relationship of race and national origin to the histology of nasopharyngeal carcinoma. Cancer 1998, 83, 582–588. [Google Scholar]
- Imai, S.; Nishikawa, J.; Takada, K. Cell-to-cell contact as an efficient mode of Epstein-Barr virus infection of diverse human epithelial cells. J. Virol. 1998, 72, 4371–4378. [Google Scholar]
- Iizasa, H.; Nanbo, A.; Nishikawa, J.; Jinushi, M.; Yoshiyama, H. Epstein-Barr Virus (EBV)-associated gastric carcinoma. Viruses 2012, 4, 3420–3439. [Google Scholar]
- Raab-Traub, N. Epstein-Barr virus in the pathogenesis of NPC. Semin. Cancer Biol 2002, 12, 431–441. [Google Scholar]
- Dawson, C.W.; Port, R.J.; Young, L.S. The role of the EBV-encoded latent membrane proteins LMP1 and LMP2 in the pathogenesis of nasopharyngeal carcinoma (NPC). Semin. Cancer Biol 2012, 22, 144–153. [Google Scholar]
- Lo, A.K.; Lo, K.W.; Ko, C.W.; Young, L.S.; Dawson, C.W. Inhibition of the LKB1-AMPK pathway by the Epstein-Barr virus-encoded LMP1 promotes proliferation and transformation of human nasopharyngeal epithelial cells. J. Pathol 2013, 230, 336–346. [Google Scholar]
- Lee, S.P. Nasopharyngeal carcinoma and the EBV-specific T cell response: Prospects for immunotherapy. Semin. Cancer Biol 2002, 12, 463–471. [Google Scholar]
- Gottschalk, S.; Heslop, H.E.; Rooney, C.M. Adoptive immunotherapy for EBV-associated malignancies. Leuk. Lymphoma 2005, 46, 1–10. [Google Scholar]
- Lung, R.W.; Tong, J.H.; Sung, Y.M.; Leung, P.S.; Ng, D.C.; Chau, S.L.; Chan, A.W.; Ng, E.K.; Lo, K.W.; To, K.F. Modulation of LMP2A expression by a newly identified Epstein-Barr virus-encoded microRNA miR-BART22. Neoplasia 2009, 11, 1174–1184. [Google Scholar]
- Chen, S.J.; Chen, G.H.; Chen, Y.H.; Liu, C.Y.; Chang, K.P.; Chang, Y.S.; Chen, H.C. Characterization of Epstein-Barr virus miRNAome in nasopharyngeal carcinoma by deep sequencing. PLoS One 2010, 5, e12745. [Google Scholar]
- Burke, A.P.; Yen, T.S.; Shekitka, K.M.; Sobin, L.H. Lymphoepithelial carcinoma of the stomach with Epstein-Barr virus demonstrated by polymerase chain reaction. Mod. Pathol 1990, 3, 377–380. [Google Scholar]
- Shibata, D.; Tokunaga, M.; Uemura, Y.; Sato, E.; Tanaka, S.; Weiss, L.M. Association of Epstein-Barr virus with undifferentiated gastric carcinomas with intense lymphoid infiltration. Lymphoepithelioma-like carcinoma. Am. J. Pathol 1991, 139, 469–474. [Google Scholar]
- Osato, T.; Imai, S. Epstein-Barr virus and gastric carcinoma. Semin. Cancer Biol 1996, 7, 175–182. [Google Scholar]
- Shibata, D.; Weiss, L.M. Epstein-Barr virus-associated gastric adenocarcinoma. Am. J. Pathol 1992, 140, 769–774. [Google Scholar]
- Takada, K. Epstein-Barr virus and gastric carcinoma. Mol. Pathol 2000, 53, 255–261. [Google Scholar]
- Lee, J.H.; Kim, S.H.; Han, S.H.; An, J.S.; Lee, E.S.; Kim, Y.S. Clinicopathological and molecular characteristics of Epstein-Barr virus-associated gastric carcinoma: A meta-analysis. J. Gastroenterol. Hepatol 2009, 24, 354–365. [Google Scholar]
- Murphy, G.; Pfeiffer, R.; Camargo, M.C.; Rabkin, C.S. Meta-analysis shows that prevalence of Epstein-Barr virus-positive gastric cancer differs based on sex and anatomic location. Gastroenterology 2009, 137, 824–833. [Google Scholar]
- Chen, J.N.; He, D.; Tang, F.; Shao, C.K. Epstein-Barr virus-associated gastric carcinoma: A newly defined entity. J. Clin. Gastroenterol 2012, 46, 262–271. [Google Scholar]
- Imai, S.; Koizumi, S.; Sugiura, M.; Tokunaga, M.; Uemura, Y.; Yamamoto, N.; Tanaka, S.; Sato, E.; Osato, T. Gastric carcinoma: Monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein. Proc. Natl. Acad. Sci. USA 1994, 91, 9131–9135. [Google Scholar]
- Luo, B.; Wang, Y.; Wang, X.F.; Liang, H.; Yan, L.P.; Huang, B.H.; Zhao, P. Expression of Epstein-Barr virus genes in EBV-associated gastric carcinomas. World J. Gastroenterol 2005, 11, 629–633. [Google Scholar]
- Zhao, J.; Liang, Q.; Cheung, K.F.; Kang, W.; Lung, R.W.; Tong, J.H.; To, K.F.; Sung, J.J.; Yu, J. Genome-wide identification of Epstein-Barr virus-driven promoter methylation profiles of human genes in gastric cancer cells. Cancer 2013, 119, 304–312. [Google Scholar]
- Zhao, J.; Jin, H.; Cheung, K.F.; Tong, J.H.; Zhang, S.; Go, M.Y.; Tian, L.; Kang, W.; Leung, P.P.; Zeng, Z.; et al. Zinc finger E-box binding factor 1 plays a central role in regulating Epstein-Barr virus (EBV) latent-lytic switch and acts as a therapeutic target in EBV-associated gastric cancer. Cancer 2012, 118, 924–936. [Google Scholar]
- Zhao, J.; Liang, Q.; Cheung, K.F.; Kang, W.; Dong, Y.; Lung, R.W.; Tong, J.H.; To, K.F.; Sung, J.J.; Yu, J. Somatostatin receptor 1, a novel EBV-associated CpG hypermethylated gene, contributes to the pathogenesis of EBV-associated gastric cancer. Br. J. Cancer 2013, 108, 2557–2564. [Google Scholar]
- Kim do, N.; Chae, H.S.; Oh, S.T.; Kang, J.H.; Park, C.H.; Park, W.S.; Takada, K.; Lee, J.M.; Lee, W.K.; Lee, S.K. Expression of viral microRNAs in Epstein-Barr virus-associated gastric carcinoma. J. Virol 2007, 81, 1033–1036. [Google Scholar]
- Marquitz, A.R.; Mathur, A.; Shair, K.H.; Raab-Traub, N. Infection of Epstein-Barr virus in a gastric carcinoma cell line induces anchorage independence and global changes in gene expression. Proc. Natl. Acad. Sci. USA 2012, 109, 9593–9598. [Google Scholar]
- Iezzoni, J.C.; Gaffey, M.J.; Weiss, L.M. The role of Epstein-Barr virus in lymphoepithelioma-like carcinomas. Am. J. Clin. Pathol 1995, 103, 308–315. [Google Scholar]
- Xiao, P.; Shi, H.; Zhang, H.; Meng, F.; Peng, J.; Ke, Z.; Wang, K.; Liu, Y.; Han, A. Epstein-Barr virus-associated intrahepatic cholangiocarcinoma bearing an intense lymphoplasmacytic infiltration. J. Clin. Pathol 2012, 65, 570–573. [Google Scholar]
- Hsu, J.L.; Glaser, S.L. Epstein-Barr virus-associated malignancies: Epidemiologic patterns and etiologic implications. Crit. Rev. Oncol. Hematol 2000, 34, 27–53. [Google Scholar]
- Hippocrate, A.; Oussaief, L.; Joab, I. Possible role of EBV in breast cancer and other unusually EBV-associated cancers. Cancer Lett 2011, 305, 144–149. [Google Scholar]
- Begin, L.R.; Eskandari, J.; Joncas, J.; Panasci, L. Epstein-Barr virus related lymphoepithelioma-like carcinoma of lung. J. Surg. Oncol 1987, 36, 280–283. [Google Scholar]
- Han, A.J.; Xiong, M.; Zong, Y.S. Association of Epstein-Barr virus with lymphoepithelioma-like carcinoma of the lung in southern China. Am. J. Clin. Pathol 2000, 114, 220–226. [Google Scholar]
- Lerner, M.R.; Andrews, N.C.; Miller, G.; Steitz, J.A. Two small RNAs encoded by Epstein-Barr virus and complexed with protein are precipitated by antibodies from patients with systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA 1981, 78, 805–809. [Google Scholar]
- Takada, K. Role of EBER and BARF1 in nasopharyngeal carcinoma (NPC) tumorigenesis. Semin. Cancer Biol 2012, 22, 162–165. [Google Scholar]
- Sample, J.; Kieff, E. Transcription of the Epstein-Barr virus genome during latency in growth-transformed lymphocytes. J. Virol 1990, 64, 1667–1674. [Google Scholar]
- Howe, J.G.; Shu, M.D. Epstein-Barr virus small RNA (EBER) genes: Unique transcription units that combine RNA polymerase II and III promoter elements. Cell 1989, 57, 825–834. [Google Scholar]
- Schwemmle, M.; Clemens, M.J.; Hilse, K.; Pfeifer, K.; Troster, H.; Muller, W.E.; Bachmann, M. Localization of Epstein-Barr virus-encoded RNAs EBER-1 and EBER-2 in interphase and mitotic Burkitt lymphoma cells. Proc. Natl. Acad. Sci. USA 1992, 89, 10292–10296. [Google Scholar]
- Gourzones, C.; Busson, P.; Raab-Traub, N. Nasopharyngeal Carcinoma: Keys for Translational Medicine and Biology; Busson, P., Ed.; Landes Bioscience and Springer Science: Villejuif, France, 2012; pp. 42–60. [Google Scholar]
- Fok, V.; Mitton-Fry, R.M.; Grech, A.; Steitz, J.A. Multiple domains of EBER 1, an Epstein-Barr virus noncoding RNA, recruit human ribosomal protein L22. RNA 2006, 12, 872–882. [Google Scholar]
- Toczyski, D.P.; Steitz, J.A. EAP, a highly conserved cellular protein associated with Epstein-Barr virus small RNAs (EBERs). EMBO J 1991, 10, 459–466. [Google Scholar]
- Toczyski, D.P.; Matera, A.G.; Ward, D.C.; Steitz, J.A. The Epstein-Barr virus (EBV) small RNA EBER1 binds and relocalizes ribosomal protein L22 in EBV-infected human B lymphocytes. Proc. Natl. Acad. Sci. USA 1994, 91, 3463–3467. [Google Scholar]
- Clarke, P.A.; Schwemmle, M.; Schickinger, J.; Hilse, K.; Clemens, M.J. Binding of Epstein-Barr virus small RNA EBER-1 to the double-stranded RNA-activated protein kinase DAI. Nucleic Acids Res 1991, 19, 243–248. [Google Scholar]
- Samanta, M.; Iwakiri, D.; Kanda, T.; Imaizumi, T.; Takada, K. EB virus-encoded RNAs are recognized by RIG-I and activate signaling to induce type I IFN. EMBO J 2006, 25, 4207–4214. [Google Scholar]
- Wong, H.L.; Wang, X.; Chang, R.C.; Jin, D.Y.; Feng, H.; Wang, Q.; Lo, K.W.; Huang, D.P.; Yuen, P.W.; Takada, K.; et al. Stable expression of EBERs in immortalized nasopharyngeal epithelial cells confers resistance to apoptotic stress. Mol. Carcinog 2005, 44, 92–101. [Google Scholar]
- Iwakiri, D.; Sheen, T.S.; Chen, J.Y.; Huang, D.P.; Takada, K. Epstein-Barr virus-encoded small RNA induces insulin-like growth factor 1 and supports growth of nasopharyngeal carcinoma-derived cell lines. Oncogene 2005, 24, 1767–1773. [Google Scholar]
- Iwakiri, D.; Eizuru, Y.; Tokunaga, M.; Takada, K. Autocrine growth of Epstein-Barr virus-positive gastric carcinoma cells mediated by an Epstein-Barr virus-encoded small RNA. Cancer Res 2003, 63, 7062–7067. [Google Scholar]
- Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII. Mol. Cell Biol 1981, 1, 785–796. [Google Scholar]
- Glickman, J.N.; Howe, J.G.; Steitz, J.A. Structural analyses of EBER1 and EBER2 ribonucleoprotein particles present in Epstein-Barr virus-infected cells. J. Virol 1988, 62, 902–911. [Google Scholar]
- Bhat, R.A.; Thimmappaya, B. Two small RNAs encoded by Epstein-Barr virus can functionally substitute for the virus-associated RNAs in the lytic growth of adenovirus 5. Proc. Natl. Acad. Sci. USA 1983, 80, 4789–4793. [Google Scholar]
- Wang, Y.; Xue, S.A.; Hallden, G.; Francis, J.; Yuan, M.; Griffin, B.E.; Lemoine, N.R. Virus-associated RNA I-deleted adenovirus, a potential oncolytic agent targeting EBV-associated tumors. Cancer Res 2005, 65, 1523–1531. [Google Scholar]
- Aparicio, O.; Razquin, N.; Zaratiegui, M.; Narvaiza, I.; Fortes, P. Adenovirus virus-associated RNA is processed to functional interfering RNAs involved in virus production. J. Virol 2006, 80, 1376–1384. [Google Scholar]
- Sano, M.; Kato, Y.; Taira, K. Sequence-specific interference by small RNAs derived from adenovirus VAI RNA. FEBS Lett 2006, 580, 1553–1564. [Google Scholar]
- Han, J.; Lee, Y.; Yeom, K.H.; Nam, J.W.; Heo, I.; Rhee, J.K.; Sohn, S.Y.; Cho, Y.; Zhang, B.T.; Kim, V.N. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell 2006, 125, 887–901. [Google Scholar]
- Fok, V.; Friend, K.; Steitz, J.A. Epstein-Barr virus noncoding RNAs are confined to the nucleus, whereas their partner, the human La protein, undergoes nucleocytoplasmic shuttling. J. Cell Biol 2006, 173, 319–325. [Google Scholar]
- Gilligan, K.; Sato, H.; Rajadurai, P.; Busson, P.; Young, L.; Rickinson, A.; Tursz, T.; Raab-Traub, N. Novel transcription from the Epstein-Barr virus terminal EcoRI fragment, DIJhet, in a nasopharyngeal carcinoma. J. Virol 1990, 64, 4948–4956. [Google Scholar]
- Gilligan, K.J.; Rajadurai, P.; Lin, J.C.; Busson, P.; Abdel-Hamid, M.; Prasad, U.; Tursz, T.; Raab-Traub, N. Expression of the Epstein-Barr virus BamHI A fragment in nasopharyngeal carcinoma: Evidence for a viral protein expressed in vivo. J. Virol 1991, 65, 6252–6259. [Google Scholar]
- Robertson, E.S.; Tomkinson, B.; Kieff, E. An Epstein-Barr virus with a 58-kilobase-pair deletion that includes BARF0 transforms B lymphocytes in vitro. J. Virol 1994, 68, 1449–1458. [Google Scholar]
- Al-Mozaini, M.; Bodelon, G.; Karstegl, C.E.; Jin, B.; Al-Ahdal, M.; Farrell, P.J. Epstein-Barr virus BART gene expression. J. Gen. Virol 2009, 90, 307–316. [Google Scholar]
- Smith, P.R.; de Jesus, O.; Turner, D.; Hollyoake, M.; Karstegl, C.E.; Griffin, B.E.; Karran, L.; Wang, Y.; Hayward, S.D.; Farrell, P.J. Structure and coding content of CST (BART) family RNAs of Epstein-Barr virus. J. Virol 2000, 74, 3082–3092. [Google Scholar]
- Pfeffer, S.; Zavolan, M.; Grasser, F.A.; Chien, M.; Russo, J.J.; Ju, J.; John, B.; Enright, A.J.; Marks, D.; Sander, C.; et al. Identification of virus-encoded microRNAs. Science 2004, 304, 734–736. [Google Scholar]
- Cai, X.; Schafer, A.; Lu, S.; Bilello, J.P.; Desrosiers, R.C.; Edwards, R.; Raab-Traub, N.; Cullen, B.R. Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS Pathog 2006, 2, e23. [Google Scholar]
- Grundhoff, A.; Sullivan, C.S.; Ganem, D. A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses. RNA 2006, 12, 733–750. [Google Scholar]
- Hutzinger, R.; Feederle, R.; Mrazek, J.; Schiefermeier, N.; Balwierz, P.J.; Zavolan, M.; Polacek, N.; Delecluse, H.J.; Huttenhofer, A. Expression and processing of a small nucleolar RNA from the Epstein-Barr virus genome. PLoS Pathog 2009, 5, e1000547. [Google Scholar]
- Hammond, S.M.; Boettcher, S.; Caudy, A.A.; Kobayashi, R.; Hannon, G.J. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 2001, 293, 1146–1150. [Google Scholar]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar]
- Carthew, R.W.; Sontheimer, E.J. Origins and mechanisms of miRNAs and siRNAs. Cell 2009, 136, 642–655. [Google Scholar]
- Zhu, J.Y.; Pfuhl, T.; Motsch, N.; Barth, S.; Nicholls, J.; Grasser, F.; Meister, G. Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas. J. Virol 2009, 83, 3333–3341. [Google Scholar]
- Matera, A.G.; Terns, R.M.; Terns, M.P. Non-coding RNAs: Lessons from the small nuclear and small nucleolar RNAs. Nat. Rev. Mol. Cell Biol 2007, 8, 209–220. [Google Scholar]
- Ender, C.; Krek, A.; Friedlander, M.R.; Beitzinger, M.; Weinmann, L.; Chen, W.; Pfeffer, S.; Rajewsky, N.; Meister, G. A human snoRNA with microRNA-like functions. Mol. Cell 2008, 32, 519–528. [Google Scholar]
- Saraiya, A.A.; Wang, C.C. snoRNA, a novel precursor of microRNA in Giardia lamblia. PLoS Pathog 2008, 4, e1000224. [Google Scholar]
- Xing, L.; Kieff, E. Epstein-Barr virus BHRF1 micro- and stable RNAs during latency III and after induction of replication. J. Virol 2007, 81, 9967–9975. [Google Scholar]
- Imig, J.; Motsch, N.; Zhu, J.Y.; Barth, S.; Okoniewski, M.; Reineke, T.; Tinguely, M.; Faggioni, A.; Trivedi, P.; Meister, G.; et al. microRNA profiling in Epstein-Barr virus-associated B-cell lymphoma. Nucleic Acids Res 2011, 39, 1880–1893. [Google Scholar]
- Amoroso, R.; Fitzsimmons, L.; Thomas, W.A.; Kelly, G.L.; Rowe, M.; Bell, A.I. Quantitative studies of Epstein-Barr virus-encoded microRNAs provide novel insights into their regulation. J. Virol 2011, 85, 996–1010. [Google Scholar]
- Qiu, J.; Cosmopoulos, K.; Pegtel, M.; Hopmans, E.; Murray, P.; Middeldorp, J.; Shapiro, M.; Thorley-Lawson, D.A. A novel persistence associated EBV miRNA expression profile is disrupted in neoplasia. PLoS Pathog 2011, 7, e1002193. [Google Scholar]
- Cosmopoulos, K.; Pegtel, M.; Hawkins, J.; Moffett, H.; Novina, C.; Middeldorp, J.; Thorley-Lawson, D.A. Comprehensive profiling of Epstein-Barr virus microRNAs in nasopharyngeal carcinoma. J. Virol 2009, 83, 2357–2367. [Google Scholar]
- Chatterjee, S.; Fasler, M.; Bussing, I.; Grosshans, H. Target-mediated protection of endogenous microRNAs in C. elegans. Dev. Cell 2011, 20, 388–396. [Google Scholar]
- Chen, H.; Huang, J.; Wu, F.Y.; Liao, G.; Hutt-Fletcher, L.; Hayward, S.D. Regulation of expression of the Epstein-Barr virus BamHI-A rightward transcripts. J. Virol 2005, 79, 1724–1733. [Google Scholar]
- Gourzones, C.; Jimenez, A.S.; Busson, P. Profiling of Epstein-Barr virus-encoded microRNAs in nasopharyngeal carcinoma reveals potential biomarkers and oncomirs. Cancer 2012, 118. [Google Scholar] [CrossRef]
- Wong, A.M.; Kong, K.L.; Tsang, J.W.; Kwong, D.L.; Guan, X.Y. Profiling of Epstein-Barr virus-encoded microRNAs in nasopharyngeal carcinoma reveals potential biomarkers and oncomirs. Cancer 2012, 118, 698–710. [Google Scholar]
- Choy, E.Y.; Siu, K.L.; Kok, K.H.; Lung, R.W.; Tsang, C.M.; To, K.F.; Kwong, D.L.; Tsao, S.W.; Jin, D.Y. An Epstein-Barr virus-encoded microRNA targets PUMA to promote host cell survival. J. Exp. Med 2008, 205, 2551–2560. [Google Scholar] [Green Version]
- Lung, R.W.; Wang, X.; Tong, J.H.; Chau, S.L.; Lau, K.M.; Cheng, S.H.; Woo, J.K.; Woo, J.; Leung, P.C.; Ng, M.H.; et al. A single nucleotide polymorphism in microRNA-146a is associated with the risk for nasopharyngeal carcinoma. Mol. Carcinog. 2012. [Google Scholar] [CrossRef]
- Cazalla, D.; Xie, M.; Steitz, J.A. A primate herpesvirus uses the integrator complex to generate viral microRNAs. Mol. Cell 2011, 43, 982–992. [Google Scholar]
- Chi, S.W.; Zang, J.B.; Mele, A.; Darnell, R.B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 2009, 460, 479–486. [Google Scholar]
- Ascano, M.; Hafner, M.; Cekan, P.; Gerstberger, S.; Tuschl, T. Identification of RNA-protein interaction networks using PAR-CLIP. Wiley Interdiscip. Rev. RNA 2012, 3, 159–177. [Google Scholar]
- Hafner, M.; Lianoglou, S.; Tuschl, T.; Betel, D. Genome-wide identification of miRNA targets by PAR-CLIP. Methods 2012, 58, 94–105. [Google Scholar]
- Gottwein, E.; Corcoran, D.L.; Mukherjee, N.; Skalsky, R.L.; Hafner, M.; Nusbaum, J.D.; Shamulailatpam, P.; Love, C.L.; Dave, S.S.; Tuschl, T.; et al. Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe 2011, 10, 515–526. [Google Scholar]
- Skalsky, R.L.; Corcoran, D.L.; Gottwein, E.; Frank, C.L.; Kang, D.; Hafner, M.; Nusbaum, J.D.; Feederle, R.; Delecluse, H.J.; Luftig, M.A.; et al. The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog 2012, 8, e1002484. [Google Scholar]
- Riley, K.J.; Rabinowitz, G.S.; Yario, T.A.; Luna, J.M.; Darnell, R.B.; Steitz, J.A. EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J 2012, 31, 2207–2221. [Google Scholar]
- Barth, S.; Pfuhl, T.; Mamiani, A.; Ehses, C.; Roemer, K.; Kremmer, E.; Jaker, C.; Hock, J.; Meister, G.; Grasser, F.A. Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5. Nucleic Acids Res 2008, 36, 666–675. [Google Scholar]
- Lo, A.K.; To, K.F.; Lo, K.W.; Lung, R.W.; Hui, J.W.; Liao, G.; Hayward, S.D. Modulation of LMP1 protein expression by EBV-encoded microRNAs. Proc. Natl. Acad. Sci. USA 2007, 104, 16164–16169. [Google Scholar]
- Hislop, A.D.; Taylor, G.S.; Sauce, D.; Rickinson, A.B. Cellular responses to viral infection in humans: Lessons from Epstein-Barr virus. Annu. Rev. Immunol 2007, 25, 587–617. [Google Scholar]
- Straathof, K.C.; Leen, A.M.; Buza, E.L.; Taylor, G.; Huls, M.H.; Heslop, H.E.; Rooney, C.M.; Bollard, C.M. Characterization of latent membrane protein 2 specificity in CTL lines from patients with EBV-positive nasopharyngeal carcinoma and lymphoma. J. Immunol 2005, 175, 4137–4147. [Google Scholar]
- Eliopoulos, A.G.; Dawson, C.W.; Mosialos, G.; Floettmann, J.E.; Rowe, M.; Armitage, R.J.; Dawson, J.; Zapata, J.M.; Kerr, D.J.; Wakelam, M.J.; et al. CD40-induced growth inhibition in epithelial cells is mimicked by Epstein-Barr virus-encoded LMP1: Involvement of TRAF3 as a common mediator. Oncogene 1996, 13, 2243–2254. [Google Scholar]
- Dirmeier, U.; Hoffmann, R.; Kilger, E.; Schultheiss, U.; Briseno, C.; Gires, O.; Kieser, A.; Eick, D.; Sugden, B.; Hammerschmidt, W. Latent membrane protein 1 of Epstein-Barr virus coordinately regulates proliferation with control of apoptosis. Oncogene 2005, 24, 1711–1717. [Google Scholar]
- Ramakrishnan, R.; Donahue, H.; Garcia, D.; Tan, J.; Shimizu, N.; Rice, A.P.; Ling, P.D. Epstein-Barr virus BART9 miRNA modulates LMP1 levels and affects growth rate of nasal NK T cell lymphomas. PLoS One 2011, 6, e27271. [Google Scholar]
- Lomonosova, E.; Chinnadurai, G. BH3-only proteins in apoptosis and beyond: An overview. Oncogene 2008, 27, S2–S19. [Google Scholar]
- Marquitz, A.R.; Mathur, A.; Nam, C.S.; Raab-Traub, N. The Epstein-Barr virus BART microRNAs target the pro-apoptotic protein Bim. Virology 2011, 412, 392–400. [Google Scholar]
- Lin, T.C.; Liu, T.Y.; Hsu, S.M.; Lin, C.W. Epstein-Barr virus-encoded miR-BART20-5p inhibits T-bet translation with secondary suppression of p53 in invasive nasal NK/T-cell lymphoma. Am. J. Pathol 2013, 182, 1865–1875. [Google Scholar]
- Dolken, L.; Malterer, G.; Erhard, F.; Kothe, S.; Friedel, C.C.; Suffert, G.; Marcinowski, L.; Motsch, N.; Barth, S.; Beitzinger, M.; et al. Systematic analysis of viral and cellular microRNA targets in cells latently infected with human gamma-herpesviruses by RISC immunoprecipitation assay. Cell Host Microbe 2010, 7, 324–334. [Google Scholar]
- Bellot, G.; Cartron, P.F.; Er, E.; Oliver, L.; Juin, P.; Armstrong, L.C.; Bornstein, P.; Mihara, K.; Manon, S.; Vallette, F.M. TOM22, a core component of the mitochondria outer membrane protein translocation pore, is a mitochondrial receptor for the proapoptotic protein Bax. Cell Death Differ 2007, 14, 785–794. [Google Scholar]
- Vereide, D.T.; Seto, E.; Chiu, Y.F.; Hayes, M.; Tagawa, T.; Grundhoff, A.; Hammerschmidt, W.; Sugden, B. Epstein-Barr virus maintains lymphomas via its miRNAs. Oncogene 2013. [Google Scholar] [CrossRef]
- Ding, Y.; Xi, Y.; Chen, T.; Wang, J.Y.; Tao, D.L.; Wu, Z.L.; Li, Y.P.; Li, C.; Zeng, R.; Li, L. Caprin-2 enhances canonical Wnt signaling through regulating LRP5/6 phosphorylation. J. Cell Biol 2008, 182, 865–872. [Google Scholar]
- Aerbajinai, W.; Lee, Y.T.; Wojda, U.; Barr, V.A.; Miller, J.L. Cloning and characterization of a gene expressed during terminal differentiation that encodes a novel inhibitor of growth. J. Biol. Chem 2004, 279, 1916–1921. [Google Scholar]
- Choi, H.; Lee, H.; Kim, S.R.; Gho, Y.S.; Lee, S.K. EBV encoded miR-BART15-3p promotes cell apoptosis partially by targeting BRUCE. J. Virol. 2013. [Google Scholar] [CrossRef]
- Chen, Z.; Naito, M.; Hori, S.; Mashima, T.; Yamori, T.; Tsuruo, T. A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem. Biophys. Res. Commun 1999, 264, 847–854. [Google Scholar]
- Verhagen, A.M.; Coulson, E.J.; Vaux, D.L. Inhibitor of apoptosis proteins and their relatives: IAPs and other BIRPs. Genome Biol. 2001, 2, REVIEWS3009.1–REVIEWS3009.10. [Google Scholar]
- Haneklaus, M.; Gerlic, M.; Kurowska-Stolarska, M.; Rainey, A.A.; Pich, D.; McInnes, I.B.; Hammerschmidt, W.; O’Neill, L.A.; Masters, S.L. Cutting edge: miR-223 and EBV miR-BART15 regulate the NLRP3 inflammasome and IL-1beta production. J. Immunol 2012, 189, 3795–3799. [Google Scholar]
- Kang, W.; Tong, J.H.; Chan, A.W.; Lee, T.L.; Lung, R.W.; Leung, P.P.; So, K.K.; Wu, K.; Fan, D.; Yu, J.; et al. Yes-associated protein 1 exhibits oncogenic property in gastric cancer and its nuclear accumulation associates with poor prognosis. Clin. Cancer Res 2011, 17, 2130–2139. [Google Scholar]
- Wong, Q.W.; Lung, R.W.; Law, P.T.; Lai, P.B.; Chan, K.Y.; To, K.F.; Wong, N. MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology 2008, 135, 257–269. [Google Scholar]
- Pegtel, D.M.; Cosmopoulos, K.; Thorley-Lawson, D.A.; van Eijndhoven, M.A.; Hopmans, E.S.; Lindenberg, J.L.; de Gruijl, T.D.; Wurdinger, T.; Middeldorp, J.M. Functional delivery of viral miRNAs via exosomes. Proc. Natl. Acad. Sci. USA 2010, 107, 6328–6333. [Google Scholar]
- Meckes, D.G., Jr; Shair, K.H.; Marquitz, A.R.; Kung, C.P.; Edwards, R.H.; Raab-Traub, N. Human tumor virus utilizes exosomes for intercellular communication. Proc. Natl. Acad. Sci. USA 2010, 107, 20370–20375. [Google Scholar]
- Nachmani, D.; Stern-Ginossar, N.; Sarid, R.; Mandelboim, O. Diverse herpesvirus microRNAs target the stress-induced immune ligand MICB to escape recognition by natural killer cells. Cell Host Microbe 2009, 5, 376–385. [Google Scholar]
- Yang, I.V.; Wade, C.M.; Kang, H.M.; Alper, S.; Rutledge, H.; Lackford, B.; Eskin, E.; Daly, M.J.; Schwartz, D.A. Identification of novel genes that mediate innate immunity using inbred mice. Genetics 2009, 183, 1535–1544. [Google Scholar]
- Ullman, K.S.; Powers, M.A.; Forbes, D.J. Nuclear export receptors: From importin to exportin. Cell 1997, 90, 967–970. [Google Scholar]
- Lei, T.; Yuen, K.S.; Xu, R.; Tsao, S.W.; Chen, H.; Li, M.; Kok, K.H.; Jin, D.Y. Targeting of DICE1 tumor suppressor by Epstein-Barr virus-encoded miR-BART3* microRNA in nasopharyngeal carcinoma. Int. J. Cancer 2013, 133, 79–87. [Google Scholar]
- Ropke, A.; Buhtz, P.; Bohm, M.; Seger, J.; Wieland, I.; Allhoff, E.P.; Wieacker, P.F. Promoter CpG hypermethylation and downregulation of DICE1 expression in prostate cancer. Oncogene 2005, 24, 6667–6675. [Google Scholar]
- Li, W.J.; Hu, N.; Su, H.; Wang, C.; Goldstein, A.M.; Wang, Y.; Emmert-Buck, M.R.; Roth, M.J.; Guo, W.J.; Taylor, P.R. Allelic loss on chromosome 13q14 and mutation in deleted in cancer 1 gene in esophageal squamous cell carcinoma. Oncogene 2003, 22, 314–318. [Google Scholar]
- Wieland, I.; Arden, K.C.; Michels, D.; Klein-Hitpass, L.; Bohm, M.; Viars, C.S.; Weidle, U.H. Isolation of DICE1: A gene frequently affected by LOH and downregulated in lung carcinomas. Oncogene 1999, 18, 4530–4537. [Google Scholar]
- Godshalk, S.E.; Bhaduri-McIntosh, S.; Slack, F.J. Epstein-Barr virus-mediated dysregulation of human microRNA expression. Cell Cycle 2008, 7, 3595–3600. [Google Scholar]
- Iizasa, H.; Wulff, B.E.; Alla, N.R.; Maragkakis, M.; Megraw, M.; Hatzigeorgiou, A.; Iwakiri, D.; Takada, K.; Wiedmer, A.; Showe, L.; et al. Editing of Epstein-Barr virus-encoded BART6 microRNAs controls their dicer targeting and consequently affects viral latency. J. Biol. Chem 2010, 285, 33358–33370. [Google Scholar]
- ClinicalTrials.gov. Available online: http://clinicaltrials.gov/show/NCT01200420 (accessed on 20 August 2013).
- Janssen, H.L.; Reesink, H.W.; Lawitz, E.J.; Zeuzem, S.; Rodriguez-Torres, M.; Patel, K.; van der Meer, A.J.; Patick, A.K.; Chen, A.; Zhou, Y.; et al. Treatment of HCV infection by targeting microRNA. N. Engl. J. Med 2013, 368, 1685–1694. [Google Scholar]
- Muthiah, M.; Park, I.K.; Cho, C.S. Nanoparticle-mediated delivery of therapeutic genes: Focus on miRNA therapeutics. Expert. Opin. Drug. Deliv. 2013. [Google Scholar] [CrossRef]
- Garzon, R.; Marcucci, G.; Croce, C.M. Targeting microRNAs in cancer: Rationale, strategies and challenges. Nat. Rev. Drug Discov 2010, 9, 775–789. [Google Scholar]
- Lo, A.K.; Dawson, C.W.; Jin, D.Y.; Lo, K.W. The pathological roles of BART miRNAs in nasopharyngeal carcinoma. J. Pathol 2012, 227, 392–403. [Google Scholar]
- Babu, S.G.; Ponia, S.S.; Kumar, D.; Saxena, S. Cellular oncomiR orthologue in EBV oncogenesis. Comput. Biol. Med 2011, 41, 891–898. [Google Scholar]
- Keryer-Bibens, C.; Pioche-Durieu, C.; Villemant, C.; Souquere, S.; Nishi, N.; Hirashima, M.; Middeldorp, J.; Busson, P. Exosomes released by EBV-infected nasopharyngeal carcinoma cells convey the viral latent membrane protein 1 and the immunomodulatory protein galectin 9. BMC Cancer 2006, 6, 283. [Google Scholar]
- Gourzones, C.; Gelin, A.; Bombik, I.; Klibi, J.; Verillaud, B.; Guigay, J.; Lang, P.; Temam, S.; Schneider, V.; Amiel, C.; et al. Extra-cellular release and blood diffusion of BART viral micro-RNAs produced by EBV-infected nasopharyngeal carcinoma cells. Virol. J 2010, 7, 271. [Google Scholar]
- Rechavi, O.; Erlich, Y.; Amram, H.; Flomenblit, L.; Karginov, F.V.; Goldstein, I.; Hannon, G.J.; Kloog, Y. Cell contact-dependent acquisition of cellular and viral nonautonomously encoded small RNAs. Genes Dev 2009, 23, 1971–1979. [Google Scholar]
- Verweij, F.J.; van Eijndhoven, M.A.; Hopmans, E.S.; Vendrig, T.; Wurdinger, T.; Cahir-McFarland, E.; Kieff, E.; Geerts, D.; van der Kant, R.; Neefjes, J.; et al. LMP1 association with CD63 in endosomes and secretion via exosomes limits constitutive NF-kappaB activation. EMBO J 2011, 30, 2115–2129. [Google Scholar]
- Pegtel, D.M.; van de Garde, M.D.; Middeldorp, J.M. Viral miRNAs exploiting the endosomal-exosomal pathway for intercellular cross-talk and immune evasion. Biochim. Biophys. Acta 2011, 1809, 715–721. [Google Scholar]
- Gourzones, C.; Ferrand, F.R.; Amiel, C.; Verillaud, B.; Barat, A.; Guerin, M.; Gattolliat, C.H.; Gelin, A.; Klibi, J.; Chaaben, A.B.; et al. Consistent high concentration of the viral microRNA BART17 in plasma samples from nasopharyngeal carcinoma patients-evidence of non-exosomal transport. Virol. J 2013, 10, 119. [Google Scholar]
- Bala, S.; Petrasek, J.; Mundkur, S.; Catalano, D.; Levin, I.; Ward, J.; Alao, H.; Kodys, K.; Szabo, G. Circulating microRNAs in exosomes indicate hepatocyte injury and inflammation in alcoholic, drug-induced, and inflammatory liver diseases. Hepatology 2012, 56, 1946–1957. [Google Scholar]
- Arroyo, J.D.; Chevillet, J.R.; Kroh, E.M.; Ruf, I.K.; Pritchard, C.C.; Gibson, D.F.; Mitchell, P.S.; Bennett, C.F.; Pogosova-Agadjanyan, E.L.; Stirewalt, D.L.; et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci. USA 2011, 108, 5003–5008. [Google Scholar]
- Chan, J.Y.; Gao, W.; Ho, W.K.; Wei, W.I.; Wong, T.S. Overexpression of Epstein-Barr virus-encoded microRNA-BART7 in undifferentiated nasopharyngeal carcinoma. Anticancer Res 2012, 32, 3201–3210. [Google Scholar]
- Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol 2000, 25, 169–193. [Google Scholar]
- Oudejans, J.J.; van den Brule, A.J.; Jiwa, N.M.; de Bruin, P.C.; Ossenkoppele, G.J.; van der Valk, P.; Walboomers, J.M.; Meijer, C.J. BHRF1, the Epstein-Barr virus (EBV) homologue of the BCL-2 protooncogene, is transcribed in EBV-associated B-cell lymphomas and in reactive lymphocytes. Blood 1995, 86, 1893–1902. [Google Scholar]
miRNA | Target | Function | miRNA effect | References |
---|---|---|---|---|
v-snoRNA24pp | BALF5 | DNA polymerase | Maintain latency | [76] |
BART2-5p | BALF5 | DNA polymerase | Maintain latency | [73,102] |
BART1-5p/BART16/BART17-5p | LMP1 | Transforming factor | Anti-apoptosis | [103] |
BART19-5p/BART5 | LMP1 | Transforming factor | Immune evasion; | [101] |
BART9 | LMP1 | Transforming factor | Promote cell growth (NK/T cells) | [108] |
BART22 | LMP2A | Signaling molecule | Immune evasion | [23] |
BART10-3p | BHRF1 | Homolog of Bcl2 | Unknown | [101] |
miRNA | Target | Function | miRNA effect | References |
---|---|---|---|---|
BART5-5p | PUMA | Proapoptotic protein | Anti-apoptosis | [93] |
BARTs cluster 1 | Bim | Proapoptotic protein | Anti-apoptosis | [110] |
BART20-5p | T-bet (TBX21) | T-box transcription factor | Anti-apoptosis | [111] |
BART16 | TOMM22 | Mitochondrial receptor for proapoptotic protein BAX | Anti-apoptosis | [112] |
BART1-3p + BART16 | CASP3 | Proapoptotic protein | Anti-apoptosis | [114] |
BART13-3p | CAPRIN2 | Wnt-signaling enhancer | Anti-apoptosis | [101] |
BART15 | BRUCE | Anti-apoptotic protein | [117] | |
BART15 | NLPR3 | Regulation of inflammation | Immune evasion | [120] |
BART2-5p | MICB | NK cell ligand | Immune evasion | [125] |
BART3 | IPO7 | Nuclear importer protein | Immune evasion | [112] |
BART3 + BART16 | IPO7 | Nuclear importer protein | Immune evasion | [114] |
BART19-3p | WIF1 | Wnt inhibitor | Oncogenic properties | [92] |
BART19-3p, 7 and 17-5p | APC | Wnt inhibitor | Oncogenic properties | [92] |
BART19-3p, 14 and 18-5p | NLK | Wnt inhibitor | Oncogenic properties | [92] |
BART3* | DICE1 | Tumor suppressor | Oncogenic properties | [128] |
BART6-5p | DICER | miRNA biogenesis | Unknown | [133] |
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Lung, R.W.-M.; Tong, J.H.-M.; To, K.-F. Emerging Roles of Small Epstein-Barr Virus Derived Non-Coding RNAs in Epithelial Malignancy. Int. J. Mol. Sci. 2013, 14, 17378-17409. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140917378
Lung RW-M, Tong JH-M, To K-F. Emerging Roles of Small Epstein-Barr Virus Derived Non-Coding RNAs in Epithelial Malignancy. International Journal of Molecular Sciences. 2013; 14(9):17378-17409. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140917378
Chicago/Turabian StyleLung, Raymond Wai-Ming, Joanna Hung-Man Tong, and Ka-Fai To. 2013. "Emerging Roles of Small Epstein-Barr Virus Derived Non-Coding RNAs in Epithelial Malignancy" International Journal of Molecular Sciences 14, no. 9: 17378-17409. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140917378