Enhanced Chemosensitivity by Targeting Nanog in Head and Neck Squamous Cell Carcinomas
Abstract
:1. Introduction
2. Results and Discussion
2.1. The Upregulation of Nanog Expression in HNSCC (Head and Neck Squamous Cell Carcinomas Cell Lines and HNSCC Patients
2.2. Reduction of CSCs (Cancer Stem Cells) Properties by Targeting Nanog
2.3. Silencing Nanog Enhances the Sensitivity of Chemotherapy and Decreases Drug-Resistant Markers
2.4. Co-Administration of Targeting Nanog with a Combination of Cisplatin Treatment Decreased Oncogenicity and Enhanced the Apoptosis Capability of HNSCC-SC
2.5. Discussion
3. Experimental Section
3.1. HNSCC Tissues Acquirement and Preparation
3.2. Quantitative Real-Time Reverse-Transcriptase (RT)-PCR
Gene (Accession No.) | Primer Sequence (5' to 3') | Product Size (bp) | Tm (°C) |
---|---|---|---|
Nanog (NM_024865) | F: ATTCAGGACAGCCCTGATTCTTC R: TTTTTGCGACACTCTTCTCTGC | 76 | 60 |
GAPDH (NM_002046) | F: CATCATCCCTGCCTCTACTG R: GCCTGCTTCACCACCTTC | 180 | 60 |
3.4. Assays for Cell Proliferation
3.5. Identification of Cell Phenotypic Markers by Fluorescence-Activated Cell Sorting (FACS)
3.6. In Vitro Cell Invasion Assay
3.7. Tumorsphere-Forming Assay
3.8. Soft Agar Colony Forming Assay
3.9. Subcutaneous Xenografts in Nude Mice
3.10. Apoptotic Assay
3.11. Statistical Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Yu, C.C.; Chang, Y.C. Enhancement of cancer stem-like and epithelial-mesenchymal transdifferentiation property in oral epithelial cells with long-term nicotine exposure: Reversal by targeting SNAIL. Toxicol. Appl. Pharmacol. 2013, 266, 459–469. [Google Scholar]
- Visvader, J.E.; Lindeman, G.J. Cancer stem cells in solid tumours: Accumulating evidence and unresolved questions. Nat. Rev. Cancer 2008, 8, 755–768. [Google Scholar]
- Chang, W.W.; Hu, F.W.; Yu, C.C.; Wang, H.H.; Feng, H.P.; Lan, C.; Tsai, L.L.; Chang, Y.C. Quercetin in elimination of tumor initiating stem-like and mesenchymal transformation property in head and neck cancer. Head Neck 2013, 35, 413–419. [Google Scholar]
- Yu, C.C.; Tsai, L.L.; Wang, M.L.; Yu, C.H.; Lo, W.L.; Chang, Y.C.; Chiou, G.Y.; Chou, M.Y.; Chiou, S.H. miR145 targets the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6-mediated paracrine effects in head and neck cancer. Cancer Res. 2013, 73, 3425–3440. [Google Scholar]
- Wang, J.; Rao, S.; Chu, J.; Shen, X.; Levasseur, D.N.; Theunissen, T.W.; Orkin, S.H. A protein interaction network for pluripotency of embryonic stem cells. Nature 2006, 444, 364–368. [Google Scholar]
- Theunissen, T.W.; Costa, Y.; Radzisheuskaya, A.; van Oosten, A.L.; Lavial, F.; Pain, B.; Castro, L.F.; Silva, J.C. Reprogramming capacity of Nanog is functionally conserved in vertebrates and resides in a unique homeodomain. Development 2011, 138, 4853–4865. [Google Scholar]
- Amsterdam, A.; Raanan, C.; Schreiber, L.; Freyhan, O.; Schechtman, L.; Givol, D. Localization of the stem cell markers LGR5 and Nanog in the normal and the cancerous human ovary and their inter-relationship. Acta Histochem. 2012. [Google Scholar] [CrossRef]
- Chiou, S.H.; Wang, M.L.; Chou, Y.T.; Chen, C.J.; Hong, C.F.; Hsieh, W.J.; Chang, H.T.; Chen, Y.S.; Lin, T.W.; Hsu, H.S.; et al. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010, 70, 10433–10444. [Google Scholar] [CrossRef]
- Ezeh, U.I.; Turek, P.J.; Reijo, R.A.; Clark, A.T. Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer 2005, 104, 2255–2265. [Google Scholar] [CrossRef]
- Hart, A.H.; Hartley, L.; Parker, K.; Ibrahim, M.; Looijenga, L.H.; Pauchnik, M.; Chow, C.W.; Robb, L. The pluripotency homeobox gene NANOG is expressed in human germ cell tumors. Cancer 2005, 104, 2092–2098. [Google Scholar] [CrossRef]
- Hoei-Hansen, C.E.; Almstrup, K.; Nielsen, J.E.; Brask Sonne, S.; Graem, N.; Skakkebaek, N.E.; Leffers, H.; Rajpert-De Meyts, E. Stem cell pluripotency factor NANOG is expressed in human fetal gonocytes, testicular carcinoma in situ and germ cell tumours. Histopathology 2005, 47, 48–56. [Google Scholar] [CrossRef]
- Lin, T.; Ding, Y.Q.; Li, J.M. Overexpression of Nanog protein is associated with poor prognosis in gastric adenocarcinoma. Med. Oncol. 2012, 29, 878–885. [Google Scholar]
- Bussolati, B.; Bruno, S.; Grange, C.; Ferrando, U.; Camussi, G. Identification of a tumor-initiating stem cell population in human renal carcinomas. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2008, 22, 3696–3705. [Google Scholar]
- Guo, Y.; Liu, S.; Wang, P.; Zhao, S.; Wang, F.; Bing, L.; Zhang, Y.; Ling, E.A.; Gao, J.; Hao, A. Expression profile of embryonic stem cell-associated genes Oct4, Sox2 and Nanog in human gliomas. Histopathology 2011, 59, 763–775. [Google Scholar] [CrossRef]
- Pan, Y.; Jiao, J.; Zhou, C.; Cheng, Q.; Hu, Y.; Chen, H. Nanog is highly expressed in ovarian serous cystadenocarcinoma and correlated with clinical stage and pathological grade. Pathobiol. J. Immunopathol. Mol. Cell. Biol. 2010, 77, 283–288. [Google Scholar] [CrossRef]
- Wen, J.; Park, J.Y.; Park, K.H.; Chung, H.W.; Bang, S.; Park, S.W.; Song, S.Y. Oct4 and Nanog expression is associated with early stages of pancreatic carcinogenesis. Pancreas 2010, 39, 622–626. [Google Scholar] [CrossRef]
- Chiou, S.H.; Yu, C.C.; Huang, C.Y.; Lin, S.C.; Liu, C.J.; Tsai, T.H.; Chou, S.H.; Chien, C.S.; Ku, H.H.; Lo, J.F. Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinoma. Clin.Cancer Res. 2008, 14, 4085–4095. [Google Scholar] [CrossRef]
- Gillis, A.J.; Stoop, H.; Biermann, K.; van Gurp, R.J.; Swartzman, E.; Cribbes, S.; Ferlinz, A.; Shannon, M.; Oosterhuis, J.W.; Looijenga, L.H. Expression and interdependencies of pluripotency factors LIN28, OCT3/4, NANOG and SOX2 in human testicular germ cells and tumours of the testis. Int. J. Androl. 2011, 34, e160–e174. [Google Scholar] [CrossRef]
- Zhou, X.; Zhou, Y.P.; Huang, G.R.; Gong, B.L.; Yang, B.; Zhang, D.X.; Hu, P.; Xu, S.R. Expression of the stem cell marker, Nanog, in human endometrial adenocarcinoma. Int. J. Gynecol. Pathol. Off. J. Int. Soc. Gynecol. Pathol. 2011, 30, 262–270. [Google Scholar]
- Schreiber, C.; Kuch, V.; Umansky, V.; Sleeman, J.P. Autochthonous mouse melanoma and mammary tumors do not express the pluripotency genes Oct4 and Nanog. PLoS One 2013, 8, e57465. [Google Scholar]
- Nagata, T.; Shimada, Y.; Sekine, S.; Hori, R.; Matsui, K.; Okumura, T.; Sawada, S.; Fukuoka, J.; Tsukada, K. Prognostic significance of NANOG and KLF4 for breast cancer. Breast Cancer 2012. [Google Scholar] [CrossRef]
- Lee, M.; Nam, E.J.; Kim, S.W.; Kim, S.; Kim, J.H.; Kim, Y.T. Prognostic impact of the cancer stem cell-related marker NANOG in ovarian serous carcinoma. Int. J. Gynecol. Cancer 2012, 22, 1489–1496. [Google Scholar]
- Meng, H.M.; Zheng, P.; Wang, X.Y.; Liu, C.; Sui, H.M.; Wu, S.J.; Zhou, J.; Ding, Y.Q.; Li, J.M. Overexpression of nanog predicts tumor progression and poor prognosis in colorectal cancer. Cancer Biol.Ther. 2010, 9, 295–302. [Google Scholar]
- Galli, R.; Binda, E.; Orfanelli, U.; Cipelletti, B.; Gritti, A.; de Vitis, S.; Fiocco, R.; Foroni, C.; Dimeco, F.; Vescovi, A. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res. 2004, 64, 7011–7021. [Google Scholar]
- Fang, D.; Nguyen, T.K.; Leishear, K.; Finko, R.; Kulp, A.N.; Hotz, S.; van Belle, P.A.; Xu, X.; Elder, D.E.; Herlyn, M. A tumorigenic subpopulation with stem cell properties in melanomas. Cancer Res. 2005, 65, 9328–9337. [Google Scholar]
- Wang, X.Q.; Ongkeko, W.M.; Chen, L.; Yang, Z.F.; Lu, P.; Chen, K.K.; Lopez, J.P.; Poon, R.T.; Fan, S.T. Octamer 4 (Oct4) mediates chemotherapeutic drug resistance in liver cancer cells through a potential Oct4-AKT-ATP-binding cassette G2 pathway. Hepatology 2010, 52, 528–539. [Google Scholar]
- Xu, F.; Dai, C.; Zhang, R.; Zhao, Y.; Peng, S.; Jia, C. Nanog: A potential biomarker for liver metastasis of colorectal cancer. Dig. Dis. Sci. 2012, 57, 2340–2346. [Google Scholar]
- He, A.; Qi, W.; Huang, Y.; Feng, T.; Chen, J.; Sun, Y.; Shen, Z.; Yao, Y. CD133 expression predicts lung metastasis and poor prognosis in osteosarcoma patients: A clinical and experimental study. Exp. Ther. Med. 2012, 4, 435–441. [Google Scholar]
- Leung, E.L.; Fiscus, R.R.; Tung, J.W.; Tin, V.P.; Cheng, L.C.; Sihoe, A.D.; Fink, L.M.; Ma, Y.; Wong, M.P. Non-Small cell lung cancer cells expressing CD44 are enriched for stem cell-like properties. PLoS One 2010, 5, e14062. [Google Scholar]
- Jeter, C.R.; Liu, B.; Liu, X.; Chen, X.; Liu, C.; Calhoun-Davis, T.; Repass, J.; Zaehres, H.; Shen, J.J.; Tang, D.G. NANOG promotes cancer stem cell characteristics and prostate cancer resistance to androgen deprivation. Oncogene 2011, 30, 3833–3845. [Google Scholar]
- Tsai, L.L.; Yu, C.C.; Chang, Y.C.; Yu, C.H.; Chou, M.Y. Markedly increased Oct4 and Nanog expression correlates with cisplatin resistance in oral squamous cell carcinoma. J. Oral Pathol. Med. 2011, 40, 621–628. [Google Scholar]
- Polyak, K.; Weinberg, R.A. Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. Nat. Rev. Cancer 2009, 9, 265–273. [Google Scholar]
- Siu, M.K.; Wong, E.S.; Kong, D.S.; Chan, H.Y.; Jiang, L.; Wong, O.G.; Lam, E.W.; Chan, K.K.; Ngan, H.Y.; Le, X.F.; et al. Stem cell transcription factor NANOG controls cell migration and invasion via dysregulation of E-cadherin and FoxJ1 and contributes to adverse clinical outcome in ovarian cancers. Oncogene 2012. [Google Scholar] [CrossRef] [Green Version]
- Garzia, L.; Andolfo, I.; Cusanelli, E.; Marino, N.; Petrosino, G.; de Martino, D.; Esposito, V.; Galeone, A.; Navas, L.; Esposito, S.; et al. MicroRNA-199b-5p impairs cancer stem cells through negative regulation of HES1 in medulloblastoma. PLoS One 2009, 4, e4998. [Google Scholar] [CrossRef] [Green Version]
- Ji, J.; Yamashita, T.; Budhu, A.; Forgues, M.; Jia, H.L.; Li, C.; Deng, C.; Wauthier, E.; Reid, L.M.; Ye, Q.H.; et al. Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology 2009, 50, 472–480. [Google Scholar]
- Ji, Q.; Hao, X.; Zhang, M.; Tang, W.; Yang, M.; Li, L.; Xiang, D.; Desano, J.T.; Bommer, G.T.; Fan, D.; et al. MicroRNA miR-34 inhibits human pancreatic cancer tumor-initiating cells. PLoS One 2009, 4, e6816. [Google Scholar] [CrossRef]
- Silber, J.; Lim, D.A.; Petritsch, C.; Persson, A.I.; Maunakea, A.K.; Yu, M.; Vandenberg, S.R.; Ginzinger, D.G.; James, C.D.; Costello, J.F.; et al. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC Med. 2008, 6. [Google Scholar] [CrossRef]
- Iliopoulos, D.; Lindahl-Allen, M.; Polytarchou, C.; Hirsch, H.A.; Tsichlis, P.N.; Struhl, K. Loss of miR-200 inhibition of Suz12 leads to polycomb-mediated repression required for the formation and maintenance of cancer stem cells. Mol. Cell 2010, 39, 761–772. [Google Scholar]
- Xia, H.; Cheung, W.K.; Sze, J.; Lu, G.; Jiang, S.; Yao, H.; Bian, X.W.; Poon, W.S.; Kung, H.F.; Lin, M.C. miR-200a regulates epithelial-mesenchymal to stem-like transition via ZEB2 and beta-catenin signaling. J. Biol. Chem. 2010, 285, 36995–37004. [Google Scholar]
- Liu, C.; Kelnar, K.; Liu, B.; Chen, X.; Calhoun-Davis, T.; Li, H.; Patrawala, L.; Yan, H.; Jeter, C.; Honorio, S.; et al. The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat. Med. 2011, 17, 211–215. [Google Scholar] [CrossRef]
- Lo, W.L.; Yu, C.C.; Chiou, G.Y.; Chen, Y.W.; Huang, P.I.; Chien, C.S.; Tseng, L.M.; Chu, P.Y.; Lu, K.H.; Chang, K.W.; et al. MicroRNA-200c attenuates tumour growth and metastasis of presumptive head and neck squamous cell carcinoma stem cells. J. Pathol. 2011, 223, 482–495. [Google Scholar] [CrossRef]
- Wu, M.J.; Jan, C.I.; Tsay, Y.G.; Yu, Y.H.; Huang, C.Y.; Lin, S.C.; Liu, C.J.; Chen, Y.S.; Lo, J.F.; Yu, C.C. Elimination of head and neck cancer initiating cells through targeting glucose regulated protein78 signaling. Mol. Cancer 2010, 9. [Google Scholar] [CrossRef]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Huang, C.-E.; Yu, C.-C.; Hu, F.-W.; Chou, M.-Y.; Tsai, L.-L. Enhanced Chemosensitivity by Targeting Nanog in Head and Neck Squamous Cell Carcinomas. Int. J. Mol. Sci. 2014, 15, 14935-14948. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150914935
Huang C-E, Yu C-C, Hu F-W, Chou M-Y, Tsai L-L. Enhanced Chemosensitivity by Targeting Nanog in Head and Neck Squamous Cell Carcinomas. International Journal of Molecular Sciences. 2014; 15(9):14935-14948. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150914935
Chicago/Turabian StyleHuang, Chuan-En, Cheng-Chia Yu, Fang-Wei Hu, Ming-Yung Chou, and Lo-Lin Tsai. 2014. "Enhanced Chemosensitivity by Targeting Nanog in Head and Neck Squamous Cell Carcinomas" International Journal of Molecular Sciences 15, no. 9: 14935-14948. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150914935