Indole-3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21
Abstract
:1. Introduction
2. Results
2.1. Whole-Genome Sequencing of A. pascens ZZ21 and Screening for Genes Likely Involved in IAA Biosynthesis
2.2. Identification of Candidate Genes Involved in Tryptophan-Dependent IAA Biosynthesis in A. pascens ZZ21 Based on Their Transcriptional Responses to Tryptophan
2.3. Detection of Intermediates in the IAA Biosynthesis Pathway in A. pascens ZZ21 by Metabolomic Analysis
2.4. Identification of Candidate Intermediates Involved in IAA Biosynthesis in A. pascens ZZ21 by HPLC-MS
3. Discussion
4. Materials and Methods
4.1. Chemicals and Materials
4.2. Bacterial Strain and Growth Conditions
4.3. Quantification of IAA Levels
4.4. Analysis of Genes Involved in IAA Production
4.5. Quantitative Reverse-Transcription PCR Analysis of Genes Involved in IAA Biosynthesis
4.6. Metabolomic Analysis of the IAA Biosynthesis Pathway in ZZ21
4.7. Identification of the Intermediates in the IAA Biosynthesis Pathway of ZZ21 by HPLC-MS
4.8. Statistical Analyses
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
IAA | Indole-3-aectic acid |
IAM | Indole-3-acetamide |
IPyA | Indole-3-pyruvic acid |
IAN | Indole-3-acetonitrile |
ILA | Indole-3-lactic acid |
IAAld | Indole-3-acetaldehyde |
TOL | Indole-3-ethanol |
TSO | Tryptophan side-chain oxidase |
TAM | Tryptamine |
IPDC | Indole-3-pyruvate decarboxylase |
Trp | Tryptophan |
TIC | Total ion current |
EIC | Extracted ion chromatography |
HPLC-MS | High-performance liquid chromatography-mass spectrometry |
qRT-PCR | Quantitative reverse-transcription PCR |
MRM | Multiple reaction monitoring |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
NCBI | National Center for Biotechnology Information |
LB | Luria-Bertani |
CK | Control check |
KO | KEGG Orthology |
NIST | National Institute of Standards and Technology |
References
- Woodward, A.W.; Bartel, B. Auxin: Regulation, action, and interaction. Ann. Bot. 2005, 95, 707–735. [Google Scholar] [CrossRef] [PubMed]
- Teale, W.D.; Paponov, I.A.; Palme, K. Auxin in action: Signalling, transport and the control of plant growth and development. Nat. Rev. Mol. Cell Biol. 2006, 7, 847–859. [Google Scholar] [CrossRef] [PubMed]
- Halliday, K.J.; Martínez-García, J.F.; Josse, E.M. Integration of light and auxin signaling. Cold Spring Harb. Perspect. Biol. 2009, 1, A001586. [Google Scholar] [CrossRef] [PubMed]
- Spaepen, S.; Vanderleyden, J.; Remans, R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol. Rev. 2007, 31, 425–448. [Google Scholar] [CrossRef] [PubMed]
- Patten, C.L.; Glick, B.R. Bacterial biosynthesis of indole-3-acetic acid. Can. J. Microbiol. 1996, 42, 207–220. [Google Scholar] [CrossRef] [PubMed]
- Sessitsch, A.; Reiter, B.; Berg, G. Endophytic bacterial communities of field-grown potato plants and their plant-growth-promoting and antagonistic abilities. Can. J. Microbiol. 2004, 50, 239–249. [Google Scholar] [CrossRef] [PubMed]
- Carreño-Lopez, R.; Campos-Reales, N.; Elmerich, C.; Baca, B.E. Physiological evidence for differently regulated tryptophan-dependent pathways for indole-3-acetic acid synthesis in Azospirillum brasilense. Mol. Gen. Genet. 2000, 264, 521–530. [Google Scholar] [CrossRef] [PubMed]
- Duca, D.; Lorv, J.; Patten, C.L.; Rose, D.; Glick, B.R. Indole-3-acetic acid in plant-microbe interactions. Antonie Van Leeuwenhoek 2014, 106, 85–125. [Google Scholar] [CrossRef] [PubMed]
- Prinsen, E.; Costacurta, A.; Michiels, K.; Vanderleyden, J.; Van Onckelen, H. Azospirillum brasilense indole-3-acetic acid biosynthesis: Evidence for a non-tryptophan dependent pathway. Mol. Plant Microbe Interact. 1993, 6, 609. [Google Scholar] [CrossRef]
- Phi, Q.T.; Park, Y.M.; Ryu, C.M.; Park, S.H.; Ghim, S.Y. Functional identification and expression of indole-3-pyruvate decarboxylase from Paenibacillus polymyxa E681. J. Microbiol. Biotechnol. 2008, 18, 1235–1244. [Google Scholar] [PubMed]
- Vandeputte, O.; Öden, S.; Mol, A.; Vereecke, D.; Goethals, K.; El Jaziri, M.; Prinsen, E. Biosynthesis of auxin by the gram-positive phytopathogen Rhodococcus fascians is controlled by compounds specific to infected plant tissues. Appl. Environ. Microbiol. 2005, 71, 1169–1177. [Google Scholar] [CrossRef] [PubMed]
- Shao, J.; Li, S.; Zhang, N.; Cui, X.; Zhou, X.; Zhang, G.; Zhang, R. Analysis and cloning of the synthetic pathway of the phytohormone indole-3-acetic acid in the plant-beneficial Bacillus amyloliquefaciens SQR9. Microb. Cell Factories 2015, 14, 130. [Google Scholar] [CrossRef] [PubMed]
- Katznelson, H.; Sirois, J.C. Auxin production by species of Arthrobacter. Nature 1961, 191, 1323–1324. [Google Scholar] [CrossRef] [PubMed]
- Forni, C.; Riov, J.; Grilli, M.G.; Tel-Or, E. Indole-3-acetic acid (IAA) production by Arthrobacter species isolated from Azolla. Microbiology 1992, 138, 377–381. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.N.; Sachan, S.G.; Verma, P.; Tyagi, S.P.; Kaushik, R.; Saxena, A.K. Culturable diversity and functional annotation of psychrotrophic bacteria from cold desert of Leh Ladakh (India). World J. Microbiol. Biotechnol. 2015, 31, 95–108. [Google Scholar] [CrossRef] [PubMed]
- Ozdal, M.; Ozdal, O.G.; Sezen, A.; Algur, O.F.; Kurbanoglu, E.B. Continuous production of indole-3-acetic acid by immobilized cells of Arthrobacter agilis. Biotech 2017, 7, 23. [Google Scholar] [CrossRef] [PubMed]
- Mino, Y. Studies on the Destruction of Indole-3-acetic Acid by a Species of Arthrobacter. V. Indole-3-acetic Acid Production from Tryptophan. Physiol. Plant. 1970, 23, 971–980. [Google Scholar] [CrossRef]
- Zhang, Z.; Li, H.; Chen, X.; Li, W.M.; Li, F.H.; Xu, L. Isolation and characterization and fluoranthene degrading of an IAA secreting bacterial strain. Chin. J. Environ. Eng. 2014, 8, 5041–5048. [Google Scholar]
- Zhang, Z. IAA-Secreting Bacteria, Flu-Degrading Bacteria Enhanced the Remediation of Flu in Soil by Plant; Nanjing Agricultural University: Nanjing, China, 2014. [Google Scholar]
- Patten, C.L.; Blakney, A.J.; Coulson, T.J. Activity, distribution and function of indole-3-acetic acid biosynthetic pathways in bacteria. Crit. Rev. Microbiol. 2013, 39, 395–415. [Google Scholar] [CrossRef] [PubMed]
- Ernstsen, A.; Sandberg, G.; Crozier, A.; Wheeler, C.T. Endogenous indoles and the biosynthesis and metabolism of indole-3-acetic acid in cultures of Rhizobium phaseoli. Planta 1987, 171, 422–428. [Google Scholar] [CrossRef] [PubMed]
- Morris, R.O. Genes specifying auxin and cytokinin biosynthesis in prokaryotes. In Plant Hormones; Springer: Dordrecht, The Netherlands, 1995; pp. 318–399. [Google Scholar]
- Sekine, M.; Watanabe, K.; Syono, K. Molecular cloning of a gene for indole-3-acetamide hydrolase from Bradyrhizobium japonicum. J. Bacteriol. 1989, 171, 1718–1724. [Google Scholar] [CrossRef] [PubMed]
- Comai, L.; Kosuge, T. Cloning characterization of iaaM, a virulence determinant of Pseudomonas savastanoi. J. Bacteriol. 1982, 149, 40–46. [Google Scholar] [PubMed]
- Clark, E.; Manulis, S.; Ophir, Y.; Barash, I.; Gafni, Y. Cloning and characterization of iaaM and iaaH from Erwinia herbicola pathovar gypsophilae. Phytopathology 1993, 83, 234–240. [Google Scholar] [CrossRef]
- Asano, Y.; Tachibana, M.; Tani, Y.; Yamada, H. Purification and characterization of amidase which participates in nitrile degradation. Agric. Biol. Chem. 1982, 46, 1175–1181. [Google Scholar]
- Kuo, T.T.; Kosuge, T. Factors influencing the production and further metabolism of indole-3-acetic acid by Pseudomonas savastanoi. J. Gen. Appl. Microbiol. 1969, 15, 51–63. [Google Scholar] [CrossRef]
- Gaffney, T.D.; e Silva, O.D.C.; Yamada, T.; Kosuge, T. Indoleacetic acid operon of Pseudomonas syringae subsp. savastanoi: Transcription analysis and promoter identification. J. Bacteriol. 1990, 172, 5593–5601. [Google Scholar] [CrossRef] [PubMed]
- Hutcheson, S.W.; Kosuge, T. Regulation of 3-indoleacetic acid production in Pseudomonas syringae pv. savastanoi. Purification and properties of tryptophan 2-monooxygenase. J. Biol. Chem. 1985, 260, 6281–6287. [Google Scholar] [PubMed]
- Kittell, B.L.; Helinski, D.R.; Ditta, G.S. Aromatic aminotransferase activity and indoleacetic acid production in Rhizobium meliloti. J. Bacteriol. 1989, 171, 5458–5466. [Google Scholar] [CrossRef] [PubMed]
- Koga, J.; Syono, K.; Ichikawa, T.; Adachi, T. Involvement of L-tryptophan aminotransferase in indole-3-acetic acid biosynthesis in Enterobacter cloacae. Biochim. Biophys. Acta 1994, 1209, 241–247. [Google Scholar] [CrossRef]
- Koga, J.; Adachi, T.; Hidaka, H. Molecular cloning of the gene for indolepyruvate decarboxylase from Enterobacter cloacae. Mol. Gen. Genet. 1991, 226, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Costacurta, A.; Keijers, V.; Vanderleyden, J. Molecular cloning and sequence analysis of an Azospirillum brasilense indole-3-pyruvate decarboxylase gene. Mol. Gen. Genet. 1994, 243, 463–472. [Google Scholar] [PubMed]
- Brandl, M.T.; Lindow, S.E. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola. Appl. Environ. Microbiol. 1996, 62, 4121–4128. [Google Scholar] [PubMed]
- Patten, C.L.; Glick, B.R. Role of Pseudomonas putida Indoleacetic Acid in Development of the Host Plant Root System. Appl. Environ. Microbiol. 2002, 68, 3795–3801. [Google Scholar] [CrossRef] [PubMed]
- Pollmann, S.; Müller, A.; Weiler, E.W. Many roads lead to “auxin”: Of nitrilases, synthases, and amidases. Plant Biol. 2006, 8, 326–333. [Google Scholar] [CrossRef] [PubMed]
- Rajagopal, R. Metabolism of Indole-3-acetaldehyde. III. Some Characteristics of the Aldehyde Oxidase of Avena Coleoptiles. Physiol. Plant. 1971, 24, 272–281. [Google Scholar] [CrossRef]
- Idris, E.E.; Iglesias, D.J.; Talon, M.; Borriss, R. Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol. Plant-Microbe Interact. 2007, 20, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, A.; Singh, M.; Klingmüller, W. Isolation and characterization of Azospirillum mutants excreting high amounts of indoleacetic acid. Can. J. Microbiol. 1983, 29, 916–923. [Google Scholar] [CrossRef]
- Perley, J.E.; Stowe, B.B. On the ability of Taphrina deformans to produce indoleacetic acid from tryptophan by way of tryptamine. Plant Physiol. 1966, 41, 234–237. [Google Scholar] [CrossRef] [PubMed]
- Oberhänsli, T.; Dfago, G.; Haas, D. Indole-3-acetic acid (IAA) synthesis in the biocontrol strain CHA0 of Pseudomonas fluorescens: Role of tryptophan side chain oxidase. Microbiology 1991, 137, 2273–2279. [Google Scholar] [CrossRef] [PubMed]
- Nelson, K.E.; Weinel, C.; Paulsen, I.T.; Dodson, R.J.; Hilbert, H.; Martins dos Santos, V.A.P.; Brinkac, L. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ. Microbiol. 2002, 4, 799–808. [Google Scholar] [CrossRef] [PubMed]
- Jo, J.E.; Raj, S.M.; Rathnasingh, C.; Selvakumar, E.; Jung, W.C.; Park, S. Cloning, expression, and characterization of an aldehyde dehydrogenase from Escherichia coli K-12 that utilizes 3-Hydroxypropionaldehyde as a substrate. Appl. Microbiol. Biotechnol. 2008, 81, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Turroni, F.; Bottacini, F.; Foroni, E.; Mulder, I.; Kim, J.H.; Zomer, A.; Delledonne, M. Genome analysis of Bifidobacterium bifidum PRL2010 reveals metabolic pathways for host-derived glycan foraging. Proc. Natl. Acad. Sci. USA 2010, 107, 19514–19519. [Google Scholar] [CrossRef] [PubMed]
- Moreno, B.; Nogales, R.; Sánchez, L.; Benítez, E. Re-start of olive waste vermicompost through addition of tryptophan and its effects on indole-3-acetic acid in pepper rhizosphere when used as soil amendment. Sci. Hortic. 2017, 221, 16–22. [Google Scholar] [CrossRef]
- Lindahl, R. Aldehyde dehydrogenases and their role in carcinogenesis. Crit. Rev. Biochem. Mol. Biol. 1992, 27, 283–335. [Google Scholar] [CrossRef] [PubMed]
- Perozich, J.; Nicholas, H.; Wang, B.C.; Lindahl, R.; Hempel, J. Relationships within the aldehyde dehydrogenase extended, family. Protein Sci. 1999, 8, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Hazelwood, L.A.; Daran, J.M.; van Maris, A.J.; Pronk, J.T.; Dickinson, J.R. The Ehrlich pathway for fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 2008, 74, 2259–2266. [Google Scholar] [CrossRef] [PubMed]
- Kato, Y.; Yoshida, S.; Asano, Y. Polymerase chain reaction for identification of aldoxime dehydratase in aldoxime- or nitrile-degrading microorganisms. FEMS Microbiol. Lett. 2005, 246, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Bartling, D.; Seedorf, M.; Mithöfer, A.; Weiler, E.W. Cloning and expression of an Arabidopsis, nitrilase which can convert indole-3-acetonitrile to the plant hormone, indole-3-acetic acid. FEBS J. 1992, 205, 417–424. [Google Scholar] [CrossRef]
- Zhao, Y. Auxin Biosynthesis: A Simple Two-Step Pathway Converts Tryptophan to Indole-3-Acetic Acid in Plants. Mol. Plant 2012, 5, 334–338. [Google Scholar] [CrossRef] [PubMed]
- Asano, Y.; Fujishiro, K.; Tani, Y.; Yamada, H. Aliphatic Nitrile Hydratase from Arthrobacter sp. J-1 Purification and Characterization. Agric. Biol. Chem. 1982, 46, 1165–1174. [Google Scholar] [CrossRef]
- Bandyopadhyay, A.K.; Nagasawa, T.; Asano, Y.; Fujishiro, K.; Tani, Y.; Yamada, H. Purification and Characterization of Benzonitrilases from Arthrobacter sp. Strain J-1. Appl. Environ. Microbiol. 1986, 51, 302–306. [Google Scholar] [PubMed]
- Zimmer, W.; Wesche, M.; Timmermans, L. Identification and isolation of the indole-3-pyruvate decarboxylase gene from Azospirillum brasilense Sp7: Sequencing and functional analysis of the gene locus. Curr. Microbiol. 1998, 36, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Patten, C.L.; Glick, B.R. Regulation of indoleacetic acid production in Pseudomonas putida GR12-2 by tryptophan and the stationary-phase sigma factor RpoS. Can. J. Microbiol. 2002, 48, 635–642. [Google Scholar] [CrossRef] [PubMed]
- Last, R.L.; Bissinger, P.H.; Mahoney, D.J.; Radwanski, E.R.; Fink, G.R. Tryptophan mutants in Arabidopsis: The consequences of duplicated tryptophan synthase beta genes. Plant Cell 1991, 3, 345–358. [Google Scholar] [CrossRef] [PubMed]
- Normanly, J.; Cohen, J.D.; Fink, G.R. Arabidopsis thaliana auxotrophs reveal a tryptophan-independent biosynthetic pathway for indole-3-acetic acid. Proc. Natl. Acad. Sci. USA 1993, 90, 10355–10359. [Google Scholar] [CrossRef] [PubMed]
- Müller, A.; Weiler, E.W. Indolic constituents and indole-3-acetic acid biosynthesis in the wild-type and a tryptophan auxotroph mutant of Arabidopsis thaliana. Planta 2000, 211, 855–863. [Google Scholar] [CrossRef] [PubMed]
- Gordon, S.A.; Weber, R.P. Colorimetric estimation of indoleacetic acid. Plant Physiol. 1951, 26, 192. [Google Scholar] [CrossRef] [PubMed]
- Goswami, D.; Dhandhukia, P.; Patel, P.; Thakker, J.N. Screening of PGPR from saline desert of Kutch: Growth promotion in Arachis hypogea by Bacillus licheniformis A2. Microbiol. Res. 2014, 169, 66–75. [Google Scholar] [CrossRef] [PubMed]
IAA Biosynthesis Pathways | ZZ21 GID | Products and Entry Numbers in KEGG | NCBI Refseq or GenBank | Identity (%) |
---|---|---|---|---|
IAM | iaaM (orf0652) | tryptophan 2-monooxygenase (EC 1.13.12.3) | SLJ94339.1 (Arthrobacter sp. P2b) | 88 |
aam (orf3469) | amidase (EC 3.5.1.4) | WP_056629692.1 (Arthrobacter sp. Soil736) | 90 | |
gatA (orf0389) | amidase (EC 3.5.1.4) | WP_087872787.1 (Arthrobacter globiformis) | 81 | |
IPyA/TAM/TSO | prr (orf1423) | aldehyde dehydrogenase (EC 1.2.1.3) | ELT45240.1 (Arthrobacter nitrophenolicus) | 96 |
puuC (orf2422) | aldehyde dehydrogenase (EC 1.2.1.3) | WP_003803492.1 (Arthrobacter globiformis) | 94 | |
aldH (orf3473) | aldehyde dehydrogenase (EC 1.2.1.3) | WP_026555119.1 (Arthrobacter sp. 35W) | 93 |
Primer Name | Sequence 5′–3′ a |
---|---|
gatAF | CGAAACCACCATCCGCTACG |
gatAR | TGGAACTGGCGAAGAAAGGC |
iaaMF | CCTGGAAAGCCGCTGTGA |
iaaMR | GCCGTAGAAGGTCTGCTCGTC |
prrF | ACTTCGGTCCGCTGAACAAC |
prrR | CATCTCCACGGCTTCCTGTT |
puuCF | GCCGCAGCAATCTCAAGC |
puuCR | CCAGCAACGCAGCGAAGT |
aamF | GCAACATTGTCGGCTTCAGG |
aamR | CGGACCGAAAGACCTGGG |
aldHF | GCAACACGGTGGTCTGGAAG |
aldHR | GCCCAACAGGAACGGAACC |
16sF | GGTTGCGATACTGTGAGGTG |
16sR | CTCCCACAAGGGTTAGGC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Guo, R.; Yu, F.; Chen, X.; Zhao, H.; Li, H.; Wu, J. Indole-3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21. Int. J. Mol. Sci. 2018, 19, 443. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19020443
Li M, Guo R, Yu F, Chen X, Zhao H, Li H, Wu J. Indole-3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21. International Journal of Molecular Sciences. 2018; 19(2):443. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19020443
Chicago/Turabian StyleLi, Mengsha, Rui Guo, Fei Yu, Xu Chen, Haiyan Zhao, Huixin Li, and Jun Wu. 2018. "Indole-3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21" International Journal of Molecular Sciences 19, no. 2: 443. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19020443