Pre-Harvest Treatment of Chitosan Oligosaccharides Improved Strawberry Fruit Quality
Abstract
:1. Introduction
2. Results and Discussion
2.1. Effect of COS Pre-Harvest Treatment on Strawberry Fruit Texture
2.2. Effect of COS Pre-Harvest Treatment on Strawberry Cell Wall Components
2.3. Effect of COS Pre-Harvest Treatment on Strawberry Quality and Taste
2.4. Effect of COS Pre-Harvest Treatment on Strawberry Antioxidant Activity
2.5. Effects of COS Pre-Harvest Treatment on Strawberry Gene Expression
3. Materials and Methods
3.1. Chemicals
3.2. Treatment of Strawberry
3.3. Texture Analyses
3.4. Preparation and Fractionation of Cell Wall
3.5. Lignin Analysis
3.6. Total Sugars (TS) Analysis
3.7. Soluble Solid Content (SSC) and Titratable Acidity (TA) Content
3.8. Antioxidant Activity
3.9. Vitamin C Content
3.10. Total Anthocyanins Content
3.11. Total Phenol Content (TPC)
3.12. Flavonoids Content
3.13. RNA Extraction, cDNA Preparation and Gene Expression Analysis
3.14. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Antunes, M.C.; Cuquel, F.L.; Zawadneak, M.A.C.; Mogor, Á.F.; Resende, J.T.V. Postharvest quality of strawberry produced during two consecutive seasons. Hortic. Bras. 2014, 32, 168–173. [Google Scholar] [CrossRef] [Green Version]
- Aaby, K.; Skrede, G.; Wrolstad, R.E. Phenolic composition and antioxidant activities in flesh and achenes of strawberries (Fragaria ananassa). J. Agric. Food Chem. 2005, 53, 4032–4040. [Google Scholar] [CrossRef] [PubMed]
- Giampieri, F.; Forbes-Hernandez, T.Y.; Gasparrini, M.; Alvarez-Suarez, J.M.; Afrin, S.; Bompadre, S.; Quiles, J.L.; Mezzetti, B.; Battino, M. Strawberry as a health promoter: An evidence based review. Food Funct. 2015, 6, 1386–1398. [Google Scholar] [CrossRef] [PubMed]
- Kevers, C.; Falkowski, M.; Tabart, J.; Defraigne, J.O.; Dommes, J.; Pincemail, J. Evolution of antioxidant capacity during storage of selected fruits and vegetables. J. Agric. Food Chem. 2007, 55, 8596–8603. [Google Scholar] [CrossRef] [PubMed]
- Saavedra, G.M.; Figueroa, N.E.; Poblete, L.A.; Cherian, S.; Figueroa, C.R. Effects of preharvest applications of methyl jasmonate and chitosan on postharvest decay, quality and chemical attributes of Fragaria chiloensis fruit. Food Chem. 2016, 190, 448–453. [Google Scholar] [CrossRef] [PubMed]
- Mattaveewong, T.; Wongkrasant, P.; Chanchai, S.; Pichyangkura, R.; Chatsudthipong, V.; Muanprasat, C. Chitosan oligosaccharide suppresses tumor progression in a mouse model of colitis-associated colorectal cancer through AMPK activation and suppression of NF-κB and mTOR signaling. Carbohydr. Polym. 2016, 145, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Van Hulten, M.; Pelser, M.; Van Loon, L.C.; Pieterse, C.M.J.; Ton, J. Costs and benefits of priming for defense in Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 5602–5607. [Google Scholar] [CrossRef] [PubMed]
- Munoz, Z.; Moret, A.; Garces, S. Assessment of chitosan for inhibition of Colletotrichum sp. on tomatoes and grapes. Crop. Prot. 2009, 28, 36–40. [Google Scholar] [CrossRef]
- Cabrera, J.C.; Messiaen, J.; Cambier, P.; Van Cutsem, P. Size, acetylation and concentration of chitooligosaccharide elicitors determine the switch from defence involving PAL activation to cell death and water peroxide production in Arabidopsis cell suspensions. Physiol. Plant 2006, 127, 44–56. [Google Scholar] [CrossRef]
- Falcon, A.B.; Cabrera, J.C.; Costales, D.; Ramırez, M.A.; Cabrera, G.; Toledo, V.; Martınez-Tellez, M.A. The effect of size and acetylation degree of chitosan derivatives on tobacco plant protection against Phytophthora parasitica nicotianae. World J. Microbiol. Biotechnol. 2008, 24, 103–112. [Google Scholar] [CrossRef]
- Wang, M.; Chen, Y.; Zhang, R.; Wang, W.; Zhao, X.; Du, Y.; Yin, H. Effects of chitosan oligosaccharides on the yield components and production quality of different wheat cultivars (Triticum aestivum L.) in Northwest China. Field Crops Res. 2015, 172, 11–20. [Google Scholar] [CrossRef]
- Aziz Eisa, A.A.; Sayed Aboelghar, G.E.; Ammar, I.M.; Metwally, H.G.; Aftrar, S.S. Teratogenic effects induced by chitosan oligosaccharide in Wistar female rat Rattus norvegicus. Environ. Sci. Pollut. Res. 2018, 25, 9371–9379. [Google Scholar] [CrossRef] [PubMed]
- Lodhi, G.; Kim, Y.S.; Hwnag, J.W.; Kim, S.K.; Jeon, Y.J.; Je, J.Y. Chitooligosaccharide and Its Derivatives: Preparation and Biological Applications. BioMed Res. Int. 2014, 14, 13. [Google Scholar] [CrossRef] [PubMed]
- Gol, N.B.; Patel, P.R.; Rao, T.V.R. Improvement of quality and shelf-life of strawberries with edible coatings enriched with chitosan. Postharvest Biol. Technol. 2013, 85, 185–195. [Google Scholar] [CrossRef]
- Yin, H.; Li, Y.; Zhang, H.Y.; Wang, W.X.; Lu, H.; Grevsen, K.; Zhao, X.; Du, Y. Chitosan oligosaccharides-triggered innate immunity contributes to oilseed rape resistance against Sclerotinia sclerotiorum. Int. J. Plant Sci. 2013, 174, 722–732. [Google Scholar] [CrossRef]
- Kerch, G.; Sabovics, M.; Kruma, Z.; Kampuse, S.; Straumite, E. Effect of chitosan and chitooligosaccharide on vitamin C and polyphenols contents in cherries and strawberries during refrigerated storage. Eur. Food Res. Technol. 2011, 233, 351–358. [Google Scholar] [CrossRef]
- Li, L.; Lichter, A.; Chalupowicz, D.; Porat, R. Effects of the ethylene-action inhibitor 1-methylcyclopropene on postharvest quality of non-climacteric fruit crops. Postharvest Biol. Technol. 2016, 111, 322–329. [Google Scholar] [CrossRef]
- Natalia, M.V.; Maria, M.; Cristina, F.N.; Pedro, M.C.; Gustavo, A.M. Novel insights of ethylene role in strawberry cell wall metabolism. Plant Sci. 2016, 252, 1–11. [Google Scholar]
- Brummell, D.A.; Dal, C.V.; Crisosto, C.H.; Labavitch, J.M. Cell wall metabolism during maturation, ripening and senescence of peach fruit. J. Exp. Bot. 2004, 55, 2029–2039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, J.; Cao, J.; Jiang, W.; Zhao, Y. Effects of preharvest oligochitosan sprays on postharvest fungal diseases, storage quality, and defense responses in jujube (Zizyphus jujuba Mill. cv. Dongzao) fruit. Sci. Hortic. 2012, 142, 196–204. [Google Scholar] [CrossRef]
- Notburga, G. New insights into plant cell walls by vibrational microspectroscopy. Appl. Spectrosc. Rev. 2017. [Google Scholar] [CrossRef]
- Paniagua, C.; Blanco-Portales, R.; Barcelo-Munoz, M.; Garcia-Gago, J.A.; Waldron, K.W.; Quesada, M.A.; Munoz-Blanco, J.; Mercado, J.A. Antisense down-regulation of the strawberry beta-galactosidase gene FabetaGal4 increases cell wall galactose levels and reduces fruit softening. J. Exp. Bot. 2016, 67, 619–631. [Google Scholar] [CrossRef] [PubMed]
- Pose, S.; Paniagua, C.; Matas, A.J.; Gunning, A.P.; Morris, V.J.; Quesada, M.A.; Mercado, J.A. A nanostructural view of the cell wall disassembly process during fruit ripening and postharvest storage by atomic force microscopy. Trend Food Sci. Technol. 2018. [Google Scholar] [CrossRef]
- Kafkas, E.; Kosar, M.; Paydas, S.; Kafkas, S.; Baser, K. Quality characteristics of strawberry genotypes at different maturation stages. Food Chem. 2007, 100, 1229–1236. [Google Scholar] [CrossRef]
- Meng, X.; Tian, S. Effects of preharvest application of antagonistic yeast combined with chitosan on decay and quality of harvested table grape fruit. J. Sci. Food Agric. 2009, 89, 1838–1842. [Google Scholar] [CrossRef]
- Ricardo, M.F.; Sonia, Z.V.; Mugridge, A.; Chaves, A.R. Growth and ripening season effects on antioxidant capacity of strawberry cultivar Selva. Sci. Hortic. 2007, 112, 27–32. [Google Scholar]
- Tulipani, S.; Mezzetti, B.; Capocasa, F.; Bompadre, S.; Beekwilder, J. Antioxidants, phenolic compounds, and nutritional quality of different strawberry genotypes. J. Agric. Food Chem. 2008, 56, 696–704. [Google Scholar] [CrossRef] [PubMed]
- Cheplick, S.; Kwon, Y.I.; Bhowmik, P.; Shetty, K. Phenolic-linked variation in strawberry cultivars for potential dietary management of hyperglycemia and related complications of hypertension. Bioresour. Technol. 2010, 101, 404–413. [Google Scholar] [CrossRef] [PubMed]
- Odriozola-Serrano, I.; Soliva-Fortuny, R.; Martin-Belloso, O. Influence of storage temperature on the kinetics of the changes in anthocyanins, vitamin C, and antioxidant capacity in fresh-cut strawberries stored under high-oxygen atmospheres. J. Food Sci. 2009, 74, 184–191. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Li, T.; Tang, K.; Liu, R.H. Effect of Germination on phytochemical profiles and antioxidant activity of Mung Bean sprouts (Vigna radiata). J. Agric. Food Chem. 2012, 60, 11050–11055. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Peng, H.; Yang, T.; Whitaker, B.; Huang, L.; Sun, J.; Chen, P. Effect of calcium on strawberry fruit flavonoid pathway gene expression and anthocyanin accumulation. Plant Physiol. Biochem. 2014, 82, 289–298. [Google Scholar] [CrossRef] [PubMed]
- Bursac Kovacevic, D.; Putnik, P.; Uzelac Verica, D.; Livaj, B. Influences of organically and conventionally grown strawberry cultivars on anthocyanins content and color in purees and low-sugar jams. Food Chem. 2015, 181, 94–100. [Google Scholar] [CrossRef] [PubMed]
- Flores, G.; Ruiz del Castillo, M.L. Influence of preharvest and postharvest methyl jasmonate treatments on flavonoid content and metabolomic enzymes in red raspberry. Postharvest Biol. Technol. 2014, 97, 77–82. [Google Scholar] [CrossRef] [Green Version]
- Vicente, A.R.; Saladie, M.; Rose, J.K.C.; Labavitch, J.M. The linkage between cell wall metabolism and fruit softening: Looking to the future. J. Sci. Food Agric. 2007, 87, 1435–1448. [Google Scholar] [CrossRef]
- Sun, J.H.; Luo, J.J.; Tian, L.; Li, C.L.; Xing, Y.; Shen, Y.Y. New evidence for the role of ethylene in strawberry fruit ripening. J. Plant Growth Regul. 2013, 32, 461–470. [Google Scholar] [CrossRef]
- Morrison, I.M. A Semi-micro method for the determination of lignin and its use in predicting the digestibility of forage crops. J. Sci. Food Agric. 1972, 23, 455–463. [Google Scholar] [CrossRef] [PubMed]
- Zeng, J.; Gao, J.M.; Chen, Y.P.; Yan, P.; Dong, Y.; Shen, Y.; Guo, J.S.; Zeng, N.; Zhang, P. Composition and aggregation of extracellular polymeric substances (EPS) in hyperhaline and municipal wastewater treatment plants. Sci. Rep. 2016, 6, 26721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, Y.; Mao, S.; Tu, K. Effect of preharvest spraying Cryptococcus laurentii on postharvest decay and quality of strawberry. Biol. Control 2014, 73, 68–74. [Google Scholar] [CrossRef]
- Patras, A.; Brunton, N.P.; Da Pieve, S.; Butler, F. Impact of high pressure processing on total antioxidant activity, phenolic, ascorbic acid, anthocyanin content and colour of strawberry and blackberry purées. Innov. Food Sci. Emerg. Technol. 2009, 10, 308–313. [Google Scholar] [CrossRef]
- Hartmann, A.; Patz, C.D.; Andlauer, W.; Dietrich, H.; Ludwig, M. Influence of processing on quality parameters of strawberries. J. Agric. Food Chem. 2008, 56, 9484–9489. [Google Scholar] [CrossRef] [PubMed]
- Meyers, K.J.; Watkins, C.B.; Pritts, M.P.; Liu, R.H. Antioxidant and antiproliferative activities of strawberries. J. Agric. Food Chem. 2003, 51, 6887–6892. [Google Scholar] [CrossRef] [PubMed]
- Landi, L.; Feliziani, E.; Romanazzi, G. Expression of defense genes in strawberry fruits treated with different resistance inducers. J. Agric. Food Chem. 2014, 62, 3047–3056. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Treatments | Fresh Weight (g) | Crude Cell Wall Extract | |||||
---|---|---|---|---|---|---|---|
Total Quantity (g) | A (%) | B (%) | C (%) | D (%) | E (%) | ||
CK | 5 | 0.09 | 9.85 ± 3.05 | 6.34 ± 1.93 | 7.37 ± 1.40 | 24.42 ± 2.69 | 20.06 ± 2.26 |
COS | 5 | 0.11* | 8.30 ± 2.38 | 7.41 ± 2.52 | 9.88 ± 3.31 * | 26.86 ± 1.78 | 24.24 ± 1.31 * |
Name Gene | Gene ID | Sequence of the 5–3 Primers, Forward/Reverse |
---|---|---|
FaPL | 101301735 | CTCGTTTGCGTATCGG TGCGTGCTCATTCCA |
FaPE | 101310153 | TTGGACCACATTTCGC GGTCGGCTCATCTTTGT |
FaACO | 101298627 | TACCTCAAGCACCTTCCTCGC TTAGTGCCAAAGGTAGGACTA |
FaACS | AY912491 | GAGAACACGAAACTCCAAG CCAAGAAGACATCAACCC |
FaEG | 101301481 | AACGAGTTTGGTTGGGATAA GCAGGAACGATAGCGAAG |
26S-18S | X58118 | ACCGTTGATTCGCACAATTGGTCATCG TACTGCGGGTCGGCAATCGGACG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Y.; Bose, S.K.; Wang, W.; Jia, X.; Lu, H.; Yin, H. Pre-Harvest Treatment of Chitosan Oligosaccharides Improved Strawberry Fruit Quality. Int. J. Mol. Sci. 2018, 19, 2194. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19082194
He Y, Bose SK, Wang W, Jia X, Lu H, Yin H. Pre-Harvest Treatment of Chitosan Oligosaccharides Improved Strawberry Fruit Quality. International Journal of Molecular Sciences. 2018; 19(8):2194. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19082194
Chicago/Turabian StyleHe, Yanqiu, Santosh Kumar Bose, Wenxia Wang, Xiaochen Jia, Hang Lu, and Heng Yin. 2018. "Pre-Harvest Treatment of Chitosan Oligosaccharides Improved Strawberry Fruit Quality" International Journal of Molecular Sciences 19, no. 8: 2194. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms19082194