Anti-Inflammatory Effects of Lasia spinosa Leaf Extract in Lipopolysaccharide-Induced RAW 264.7 Macrophages
Abstract
:1. Introduction
2. Results
2.1. Antioxidant Activity of LS Leaf Ethanol Extracts
2.2. Effect of LS Leaf Extract on RAW 264.7 Cells Viability
2.3. LS Leaf Extract Inhibits the Production of NO, ROS, and TNF-α in LPS-Stimulated RAW 264.7 Cells
2.4. LS Leaf Extract Inhibits the Expression of Inflammatory Genes in LPS-Stimulated RAW 264.7 Cells
2.5. LS Leaf Extract Inhibits Phosphorylation and Translocation of NF-ĸB in LPS-Stimulated RAW 264.7 Cells
2.6. LS Leaf Extract Inhibits the Phosphorylation of MAPKs and Akt in LPS-Stimulated RAW 264.7 Cells
2.7. LS Leaf Extract Promotes the Activation of Nrf2/HO-1 Pathway in LPS-Stimulated RAW 264.7 Cells
3. Discussion
4. Materials and Methods
4.1. Preparation of LS Leaf Ethanol Extracts
4.2. Radical Scavenging Activity and Total Polyphenolic Content
4.3. Cell Culture, Cell Viability, and LDH Activity
4.4. NO Production and ROS Accumulation
4.5. ELISA
4.6. Quantitative RT-PCR (qRT-PCR)
4.7. Western Blotting
4.8. Immunofluorescent Staining
4.9. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
LS | Lasia spinosa |
DMSO | Dimethyl sulfoxide |
ELISA | Enzyme-linked immunosorbent assay |
LPS | Lipopolysaccharide |
MAPK | Mitogen-activated protein kinase |
NF-κB | Nuclear factor-kappa B |
PI3K/Akt | Phosphoinositide-3-kinase–protein kinase B/Akt |
HO-1 | Heme oxygenase-1 |
L-NAME | N-Nitro-l-arginine methyl ester |
Nrf2 | Nuclear factor erythroid-2-related factor 2 |
ROS | Reactive oxygen species |
NO | Nitric oxide |
TLR-4 | Toll-like receptor 4 |
TRIF | TIR-domain-containing adapter-inducing interferon-β |
IRAK | Interleukin-1 (IL-1)-receptor-associated kinase |
IRF-3 | Interferon regulatory factor-3 |
PGE2 | Prostaglandin E2 |
References
- Fürst, R.; Zündorf, I. Plant-derived anti-inflammatory compounds: Hopes and disappointments regarding the translation of preclinical knowledge into clinical progress. Mediat. Inflamm. 2014, 9, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Scrivo, R.; Vasile, M.; Bartosiewicz, I.; Valesini, G. Inflammation as “common soil” of the multifactorial diseases. Autoimmun. Rev. 2011, 10, 369–374. [Google Scholar] [CrossRef]
- Ji, K.Y.; Kim, K.M.; Kim, Y.H.; Im, A.R.; Lee, J.Y.; Park, B.; Na, M.K.; Chae, S. The enhancing immune response and anti-inflammatory effects of Anemarrhena asphodeloides extract in RAW 264.7 cells. Phytomedicine 2019, 59, 1–9. [Google Scholar] [CrossRef]
- Modlin, H.D.B.; Modlin, R.L. Toll-like receptors: Molecular mechanisms of the mammalian immune response. Immunology 2000, 101, 1–10. [Google Scholar]
- Savva, A.; Roger, T. Targeting Toll-like receptors: Promising therapeutic strategies for the management of sepsis-associated pathology and infectious diseases. Front. Immunol. 2013, 4, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Choi, Y.H.; Kim, G.Y.; Lee, H.H. Anti-inflammatory effects of cordycepin in lipopolysaccharide-stimulated RAW 264.7 macrophages through Toll-like receptor 4-mediated suppression of mitogen-activated protein kinases and NF-κB signaling pathways. Drug Des. Dev. Ther. 2014, 8, 1941–1953. [Google Scholar] [CrossRef] [Green Version]
- Kwon, D.H.; Cha, H.J.; Choi, E.O.; Leem, S.H.; Kim, G.Y.; Moon, S.K.; Chang, Y.C.; Yun, S.J.; Hwang, H.J.; Kim, B.W.; et al. Schisandrin A suppresses lipopolysaccharide-induced inflammation and oxidative stress in RAW 264.7 macrophages by suppressing the NF-κB, MAPKs and PI3K/Akt pathways and activating Nrf2/HO-1 signaling. Int. J. Mol. Medicine 2018, 41, 264–274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leung, W.S.; Yang, M.L.; Lee, S.S.; Kuo, C.W.; Ho, Y.C.; Huang-Liu, R.; Lin, H.W.; Kuan, Y.H. Protective effect of zerumbone reduces lipopolysaccharide-induced acute lung injury via antioxidative enzymes and Nrf2/HO-1 pathway. Int. Immunopharmacol. 2017, 46, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.; Li, L.; Wang, Y.; Zhai, J.; Chen, G.; Hu, K. Gambogic acid induces heme oxygenase-1 through Nrf2 signaling pathway and inhibits NF-κB and MAPK activation to reduce inflammation in LPS-activated RAW264.7 cells. Biomed. Pharmacother. 2019, 109, 555–562. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Anti-inflammatory agents: Present and future. Cell 2010, 140, 935–950. [Google Scholar] [CrossRef] [Green Version]
- Bost, J.; Maroon, A.; Maroon, J. Natural anti-inflammatory agents for pain relief. Surg. Neurol. Int. 2010, 1, 1–2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hasan, M.N.; Munshi, M.; Rahman, M.H.; Alam, S.N.; Hirashima, A. Evaluation of antihyperglycemic activity of Lasia spinosa leaf extracts in Swiss albino mice. World J. Pharm. Pharm. Sci. 2014, 3, 118–124. [Google Scholar]
- Rahman, A.; Siddiqui, S.A.; Oke-Altuntas, F.; Okay, S.; Gül, F.; Demirtas, I. Phenolic profile, essential oil composition and bioactivity of Lasia spinosa (L.) thwaites. Braz. Arch. Biol. Technol. 2019, 62, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Muthukrishnan, S.; Sivakkumar, T. Physicochemical evaluation, preliminary phytochemical investigation, fluorescence and TLC analysis of leaves of Lasia spinosa (Lour.) thwaites. Int. J. Pharm. Pharm. Sci. 2013, 5, 306–310. [Google Scholar]
- Yadav, A.K. Temjenmongla. Efficacy of Lasia spinosa leaf extract in treating mice infected with Trichinella spiralis. Parasitol. Res. 2012, 110, 493–498. [Google Scholar] [CrossRef]
- Dai, B.; Wei, D.; Zheng, N.N.; Chi, Z.H.; Xin, N.; Ma, T.X.; Zheng, L.Y.; Sumi, R.; Sun, L. Coccomyxa gloeobotrydiformis polysaccharide inhibits lipopolysaccharide-induced inflammation in RAW 264.7 macrophages. Cell. Physiol. Biochem. 2019, 51, 2523–2535. [Google Scholar] [CrossRef] [Green Version]
- Sharma, J.N.; Al-Omran, A.; Parvathy, S.S. Role of nitric oxide in inflammatory diseases. Inflammopharmacology 2007, 15, 252–259. [Google Scholar] [CrossRef]
- Ruhee, R.T.; Ma, S.; Suzuki, K. Sulforaphane protects cells against lipopolysaccharide-stimulated inflammation in murine macrophages. Antioxidants 2019, 8, 577. [Google Scholar] [CrossRef] [Green Version]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Rogler, G.; Andus, T. Cytokines in inflammatory bowel disease. World J. Surgery 1998, 22, 382–389. [Google Scholar]
- Zong, Y.; Sun, L.; Liu, B.; Deng, Y.S.; Zhan, D.; Chen, Y.L.; He, Y.; Liu, J.; Zhang, Z.J.; Sun, J.; et al. Resveratrol inhibits LPS-induced MAPKs activation via activation of the phosphatidylinositol 3-kinase pathway in murine RAW 264.7 macrophage cells. PLoS ONE 2012, 7, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, H.; Ma, Q.; Ye, L.; Piao, G. The traditional medicine and modern medicine from natural products. Molecules 2016, 21, 559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beg, S.; Swain, S.; Hasan, H.; Barkat, M.A.; Hussain, M.S. Systematic review of herbals as potential anti-inflammatory agents: Recent advances, current clinical status and future perspectives. Pharmacogn. Rev. 2011, 5, 120–137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kankanamge, S.U.; Amarathunga, A.A.M.D.D.N. Phytochemical and ethno-pharmacological properties of Lasia spinosa (Kohila): A review. World J. Pharm. Res. 2017, 6, 1–9. [Google Scholar]
- Shafie, N.H.; Idris, S.L.; Hamdan, N.N.; Bakar, S.A.; Ishak, A.H.; Nai’mah, H.B.; Kadir, K.K.A. Nutritional composition, antioxidative and inhibitory effects against pancreatic lipase, α-amylase and α-glucosidase of Lasia spinosa. J. Eng. Appl. Sci. 2018, 13, 8898–8905. [Google Scholar]
- Dzoyem, J.P.; Eloff, J.N. Anti-inflammatory, anticholinesterase and antioxidant activity of leaf extracts of twelve plants used traditionally to alleviate pain and inflammation in South Africa. J. Ethnopharmacol. 2015, 160, 194–201. [Google Scholar] [CrossRef] [Green Version]
- Lin, D.; Xiao, M.; Zhao, J.; Li, Z.; Xing, B.; Li, X.; Kong, M.; Li, L.; Zhang, Q.; Liu, Y.; et al. An overview of plant phenolic compounds and their importance in human nutrition and management of type 2 diabetes. Molecules 2016, 21, 1374. [Google Scholar] [CrossRef]
- Wong, J.Y.; Matanjun, P.; Ooi, Y.B.H.; Chia, K.F. Evaluation of antioxidant activities in relation to total phenolics and flavonoids content of selected Malaysian wild edible plants by multivariate analysis. Int. J. Food Prop. 2014, 17, 1763–1778. [Google Scholar] [CrossRef]
- Ghasemian, M.; Owlia, S.; Owlia, M.B. Review of Anti-Inflammatory Herbal Medicines. Adv. Pharmacol. Sci. 2016, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Tohma, H.; Gülçin, İ.; Bursal, E.; Gören, A.C.; Alwasel, S.H.; Köksal, E. Antioxidant activity and phenolic compounds of ginger (Zingiber officinale Rosc.) determined by HPLC-MS/MS. J. Food Meas. Charact. 2017, 11, 556–566. [Google Scholar] [CrossRef]
- Akter, J.; Hossain, M.A.; Takara, K.; Islam, M.Z.; Hou, D.X. Antioxidant activity of different species and varieties of turmeric (Curcuma spp): Isolation of active compounds. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 215, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Li, H.; Hou, X.; Li, D.; He, S.; Wan, C.; Yin, P.; Liu, M.; Liu, F.; Xu, J. Punicalagin induces Nrf2/HO-1 expression via upregulation of PI3K/AKT pathway and inhibits LPS-induced oxidative stress in RAW264.7 macrophages. Mediat. Inflamm. 2015, 11, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Leon, L.R.; White, A.A.; Kluger, M.J. Role of IL-6 and TNF in thermoregulation and survival during sepsis in mice. Am. J. Physiol.-Regul. Integrative Comp. Physiol. 1998, 275, 269–277. [Google Scholar] [CrossRef] [PubMed]
- Baker, K.J.; Houston, A.; Brint, E. IL-1 family members in cancer; two sides to every story. Front. Immunol. 2019, 1, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Hovsepian, E.; Penas, F.; Siffo, S.; Mirkin, G.A.; Goren, N.B. IL-10 inhibits the NF-κB and ERK/MAPK-mediated production of pro-inflammatory mediators by up-regulation of SOCS-3 in Trypanosoma cruzi-infected cardiomyocytes. PLoS ONE 2013, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Asadullah, K.; Sterry, W.; Volk, H.D. Interleukin-10 therapy—Review of a new approach. Pharmacol. Rev. 2003, 55, 241–269. [Google Scholar] [CrossRef]
- Tsai, T.T.; Chuang, Y.J.; Lin, Y.S.; Wan, S.W.; Chen, C.L.; Lin, C.F. An emerging role for the anti-inflammatory cytokine interleukin-10 in dengue virus infection. J. Biomed. Sci. 2013, 20, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Anwar, M.A.; Basith, S.; Choi, S. Negative regulatory approaches to the attenuation of Toll-like receptor signaling. Exp. Mol. Med. 2013, 45, 1–14. [Google Scholar] [CrossRef]
- Liang, Y.; Zhou, Y.; Shen, P. NF-κB and its regulation on the immune system. Cell. Mol. Immunol. 2004, 1, 343–350. [Google Scholar]
- Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory diseases. J. Clin. Invest. 2001, 107, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Sign. Transduct. Target. Ther. 2017, 2, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lingappan, K. NF-κB in Oxidative Stress. Curr. Opin. Toxicol. 2018, 7, 8139–8186. [Google Scholar] [CrossRef] [PubMed]
- Akanda, M.R.; Kim, I.S.; Ahn, D.; Tae, H.J.; Nam, H.H.; Choo, B.K.; Kim, K.; Park, B.Y. Anti-inflammatory and gastroprotective roles of rabdosia inflexa through downregulation of pro-inflammatory cytokines and MAPK/NF-κB signaling pathways. Int. J. Mol. Sci. 2018, 19, 584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brubaker, S.W.; Bonham, K.S.; Zanoni, I.; Kagan, J.C. Innate Immune Pattern Recognition: A Cell Biological Perspective. Rev. Adv. 2015, 33, 257–290. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.S.; Choi, M.J.; Lee, Y.Y.; Moon, B.I.; Park, J.S.; Kim, H.S. Suppression of lipopolysaccharide-induced neuroinflammation by morin via MAPK, PI3K/Akt, and PKA/HO-1 signaling pathway modulation. J. Agric. Food Chem. 2017, 65, 373–382. [Google Scholar] [CrossRef]
- Huang, B.P.; Lin, C.H.; Chen, H.M.; Lin, J.T.; Cheng, Y.F.; Kao, S.H. AMPK activation inhibits expression of proinflammatory mediators through downregulation of PI3K/p38 MAPK and NF-κB signaling in murine macrophages. DNA Cell Biol. 2015, 34, 133–141. [Google Scholar] [CrossRef]
- Han, J.M.; Lee, E.K.; Gong, S.Y.; Sohng, J.K.; Kang, Y.J.; Jung, H.J. Sparassis crispa exerts anti-inflammatory activity via suppression of TLR-mediated NF-κB and MAPK signaling pathways in LPS-induced RAW264.7 macrophage cells. J. Ethnopharmacol. 2019, 231, 10–18. [Google Scholar] [CrossRef]
- Zheng, Y.; Ren, W.; Zhang, L.; Zhang, Y.; Liu, D.; Liu, Y. A Review of the Pharmacological Action of Astragalus Polysaccharide. Front. Pharmacol. 2020, 11, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Saponaro, C.; Cianciulli, A.; Calvello, R.; Dragone, T.; Iacobazzi, F.; Panaro, M.A. The PI3K/Akt pathway is required for LPS activation of microglial cells. Immunopharmacol. Immunotoxicol. 2012, 34, 858–865. [Google Scholar] [CrossRef]
- Zuo, L.; Prather, E.R.; Stetskiv, M.; Garrison, D.E.; Meade, J.R.; Peace, T.I.; Zhou, T. Inflammaging and oxidative stress in human diseases: From molecular mechanisms to novel treatments. Int. J. Mol. Sci. 2019, 20, 4472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, B.; Hirahashi, J.; Cullere, X.; Mayadas, T.N. Elucidation of molecular events leading to neutrophil apoptosis following phagocytosis. Cross-talk between caspase 8, reactive oxygen species, and MAPK/ERK activation. J. Biol. Chem. 2003, 278, 28443–28454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yao, Y.D.; Shen, X.Y.; Machado, J.; Luo, J.F.; Dai, Y.; Lio, C.K.; Yu, Y.; Xie, Y.; Luo, P.; Liu, J.X.; et al. Nardochinoid B inhibited the activation of RAW264.7 macrophages stimulated by lipopolysaccharide through activating the Nrf2/HO-1 pathway. Molecules 2019, 24, 2482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yahfoufi, N.; Alsadi, N.; Jambi, M.; Matar, C. The immunomodulatory and anti-inflammatory role of polyphenols. Nutrients 2018, 10, 1618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oblak, A.; Jerala, R. Toll-like receptor 4 activation in cancer progression and therapy. Clin. Dev. Immunol. 2011, 12, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Awasthi, S. Toll-like receptor-4 modulation for cancer immunotherapy. Front. Immunol. 2014, 5, 1–5. [Google Scholar] [CrossRef] [Green Version]
- Tailor Chandra Shekhar, G.A. Antioxidant Activity by DPPH Radical Scavenging Method of Ageratum conyzoides. Orient 2014, 1, 244–249. [Google Scholar]
- Roberta, R.; Nicoletta, P.; Anna, P.; Ananth, P.; Min, Y. Catherine Rice-Evans Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar]
- Singleton, V.L.; Rudof, O.; Rosa, M.L.R. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. METHODS Enzymol. 1999, 299, 152–178. [Google Scholar]
- Schmölz, L.; Wallert, M.; Lorkowski, S. Optimized incubation regime for nitric oxide measurements in murine macrophages using the Griess assay. J. Immunol. Methods 2017, 449, 68–70. [Google Scholar] [CrossRef]
- Chen, R. Immunoflurescence (Indirect Staining) Protocol for Adherent Cells. Bio-Protoc. 2012, 2, 3–5. [Google Scholar] [CrossRef]
Gene 1 | Primer Sequence | |
---|---|---|
Forward Primer (5′–3′) | Reverse Primer (5′–3′) | |
iNOS (NOS2) | GGAGCCTTTAGACCTCAACAGA | AAGGTGAGCTGAACGAGGAG |
IL-6 | GCTACCAAACTGGATATAATCAGGA | CCAGGTAGCTATGGTACTCCAGAA |
IL-1β | AGTTGACGGACCCCAAAAG | AGCTGGATGCTCTCATCAGG |
TNF-α | CTGTAGCCCACGTCGTAGC | TTGAGATCCATGCCGTTG |
IL-10 | CGCTTGGAATCCCGAATTA | CTCAGGTTGGTCACAGTGAAAT |
COX-2 | GATGCTCTTCCGAGCTGTG | GGATTGGAACAGCAAGGATTT |
HO-1 | AGGGTCAGGTGTCCAGAGAA | CTTCCAGGGCCGTGTAGATA |
Nrf2 | CATGATGGACTTGGAGTTGC | CCTCCAAAGGATGTCAATCAA |
β-Actin | GGAGGGGGTTGAGGTGTT | GTGTGCACTTTTATTGGTCTCAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen, T.Q.C.; Duy Binh, T.; Pham, T.L.A.; Nguyen, Y.D.H.; Thi Xuan Trang, D.; Nguyen, T.T.; Kanaori, K.; Kamei, K. Anti-Inflammatory Effects of Lasia spinosa Leaf Extract in Lipopolysaccharide-Induced RAW 264.7 Macrophages. Int. J. Mol. Sci. 2020, 21, 3439. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21103439
Nguyen TQC, Duy Binh T, Pham TLA, Nguyen YDH, Thi Xuan Trang D, Nguyen TT, Kanaori K, Kamei K. Anti-Inflammatory Effects of Lasia spinosa Leaf Extract in Lipopolysaccharide-Induced RAW 264.7 Macrophages. International Journal of Molecular Sciences. 2020; 21(10):3439. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21103439
Chicago/Turabian StyleNguyen, Thanh Q. C., Tran Duy Binh, Tuan L. A. Pham, Yen D. H. Nguyen, Dai Thi Xuan Trang, Trong Tuan Nguyen, Kenji Kanaori, and Kaeko Kamei. 2020. "Anti-Inflammatory Effects of Lasia spinosa Leaf Extract in Lipopolysaccharide-Induced RAW 264.7 Macrophages" International Journal of Molecular Sciences 21, no. 10: 3439. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21103439