Phenolic-Enriched Collagen Fibrillar Coatings on Titanium Alloy to Promote Osteogenic Differentiation and Reduce Inflammation
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of Collagen Hydrogels
2.2. Collagen Fibrils Coatings Characterization
2.3. In Vitro Studies
2.3.1. Osteogenic Differentiation
2.3.2. Inflammatory Response
2.3.3. Cell Morphology
3. Materials and Methods
3.1. Production of Ti6Al4V Samples
3.2. Preparation of Collagen Hydrogels and Coatings
3.3. Physicochemical Characterization of the Collagen Hydrogels and Coatings
3.4. In Vitro Studies
3.4.1. Cell Culture
3.4.2. RNA-Isolation and cDNA Reverse Transcription (RT)
3.4.3. Real-Time Polymerase Chain Reaction (PCR)
3.4.4. Statistical Analyses
4. Conclusions and Outlook
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AM | Additive manufacturing |
BGLAP | Bone gamma-carboxyglutamate protein (osteocalcin) |
CA | Contact angle |
CAD | Computer aided design |
COL1A1 | Collagen type I alpha 1 chain |
FTIR | Fourier transform infrared |
IL6 | Interleukin-6 |
MMP | Matrix metalloproteinases |
MRSA | Methicillin-resistant S.aureus |
OPG | Osteoprotegerin |
PCR | Polymerase chain reaction |
PG | Phloroglucinol |
RANKL | Receptor activator of nuclear factor-κB |
SEM | Scanning electron microscopy |
TCPS | Tissue culture polystyrene |
TNFA | Tumor necrosis factor-alpha |
XPS | X-ray photoelectron spectroscopy |
References
- Roehlecke, C.; Witt, M.; Kasper, M.; Schulze, E.; Wolf, C.; Hofer, A.; Funk, R.H.W. Synergistic effect of titanium alloy and collagen type I on cell adhesion, proliferation and differentiation of osteoblast-like cells. Cells Tissues Organs 2001, 168, 178–187. [Google Scholar] [CrossRef] [Green Version]
- Geißler, U.; Hempel, U.; Wolf, C.; Scharnweber, D.; Worch, H.; Wenzel, K.W. Collagen type I-coating of Ti6A14V promotes adhesion of osteoblasts. J. Biomed. Mater. Res. 2000, 51, 752–760. [Google Scholar] [CrossRef]
- Moroi, S.; Miura, T.; Tamura, T.; Zhang, X.; Ura, K.; Takagi, Y. Self-assembled collagen fibrils from the swim bladder of Bester sturgeon enable alignment of MC3T3-E1 cells and enhance osteogenic differentiation. Mater. Sci. Eng. C 2019, 104, 109925. [Google Scholar] [CrossRef] [PubMed]
- Bougas, K.; Jimbo, R.; Xue, Y.; Mustafa, K.; Wennerberg, A. Novel implant coating agent promotes gene expression of osteogenic markers in rats during early osseointegration. Int. J. Biomater. 2012, 2012. [Google Scholar] [CrossRef] [PubMed]
- Wolf-Brandstetter, C. Adsorptive Immobilisierung von Kollagen Typ I an Titanoxidoberflächen, Technische. Ph.D. Thesis, Universität Dresden, Dresden, Germany, 2004. [Google Scholar]
- Rammelt, S.; Schulze, E.; Bernhardt, R.; Hanisch, U.; Scharnweber, D.; Worch, H.; Zwipp, H.; Biewener, A. Coating of titanium implants with type-I collagen. J. Orthop. Res. 2004, 22, 1025–1034. [Google Scholar] [CrossRef]
- Sartori, M.; Giavaresi, G.; Parrilli, A.; Ferrari, A.; Aldini, N.N.; Morra, M.; Cassinelli, C.; Bollati, D.; Fini, M. Collagen type I coating stimulates bone regeneration and osteointegration of titanium implants in the osteopenic rat. Int. Orthop. 2015, 39, 2041–2052. [Google Scholar] [CrossRef]
- Chae, S.J.; Lee, J.U.; Kim, G.H. Skeletal myotube formation enhanced through fibrillated collagen nanofibers coated on a 3D-printed polycaprolactone surface. Colloids Surfaces B Biointerfaces 2019, 181, 408–415. [Google Scholar] [CrossRef]
- Douglas, T.; Heinemann, S.; Mietrach, C.; Hempel, U.; Bierbaum, S.; Scharnweber, D.; Worch, H. Interactions of collagen types I and II with chondroitin sulfates A-C and their effect on osteoblast adhesion. Biomacromolecules 2007, 8, 1085–1092. [Google Scholar] [CrossRef]
- Norris, K.; Mishukova, O.; Zykwinska, A.; Colliec-Jouault, S.; Sinquin, C.; Koptioug, A.; Cuenot, S.; Kerns, J.; Surmeneva, M.; Surmenev, R.; et al. Marine Polysaccharide-Collagen Coatings on Ti6Al4V Alloy Formed by Self-Assembly. Micromachines 2019, 10, 68. [Google Scholar] [CrossRef] [Green Version]
- Vandrovcova, M.; Douglas, T.E.L.; Heinemann, S.; Scharnweber, D.; Dubruel, P.; Bacakova, L. Collagen-lactoferrin fibrillar coatings enhance osteoblast proliferation and differentiation. J. Biomed. Mater. Res. Part A 2015, 103, 525–533. [Google Scholar] [CrossRef]
- Douglas, T.E.L.; Dokupil, A.; Reczyńska, K.; Brackman, G.; Krok-Borkowicz, M.; Keppler, J.K.; Božič, M.; Van Der Voort, P.; Pietryga, K.; Samal, S.K.; et al. Enrichment of enzymatically mineralized gellan gum hydrogels with phlorotannin-rich Ecklonia cava extract Seanol® to endow antibacterial properties and promote mineralization. Biomed. Mater. 2016, 11. [Google Scholar] [CrossRef] [PubMed]
- Eom, S.H.; Kim, Y.M.; Kim, S.K. Antimicrobial effect of phlorotannins from marine brown algae. Food Chem. Toxicol. 2012, 50, 3251–3255. [Google Scholar] [CrossRef] [PubMed]
- Lopes, G.; Sousa, C.; Silva, L.R.; Pinto, E.; Andrade, P.B.; Bernardo, J.; Mouga, T.; Valentão, P. Can phlorotannins purified extracts constitute a novel pharmacological alternative for microbial infections with associated inflammatory conditions? PLoS ONE 2012, 7, e31145. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.M.; Kim, S.K. Effect of phloroglucinol on oxidative stress and inflammation. Food Chem. Toxicol. 2010, 48, 2925–2933. [Google Scholar] [CrossRef]
- Mody, N.; Parhami, F.; Sarafian, T.A.; Demer, L.L. Oxidative stress modulates osteoblastic differentiation of vascular and bone cells. Free Radic. Biol. Med. 2001, 31, 509–519. [Google Scholar] [CrossRef]
- Bai, X.C.; Lu, D.; Bai, J.; Zheng, H.; Ke, Z.Y.; Li, X.M.; Luo, S.Q. Oxidative stress inhibits osteoblastic differentiation of bone cells by ERK and NF-κB. Biochem. Biophys. Res. Commun. 2004, 314, 197–207. [Google Scholar] [CrossRef]
- Kim, M.; Kim, G. Electrospun PCL/phlorotannin nanofibres for tissue engineering: Physical properties and cellular activities. Carbohydr. Polym. 2012, 90, 592–601. [Google Scholar] [CrossRef]
- Yeo, M.; Jung, W.K.; Kim, G. Fabrication, characterisation and biological activity of phlorotannin-conjugated PCL/β-TCP composite scaffolds for bone tissue regeneration. J. Mater. Chem. 2012, 22, 3568–3577. [Google Scholar] [CrossRef]
- Fraser, J.H.E.; Helfrich, M.H.; Wallace, H.M.; Ralston, S.H. Hydrogen peroxide, but not superoxide, stimulates bone resorption in mouse calvariae. Bone 1996, 19, 223–226. [Google Scholar] [CrossRef]
- Lišková, J.; Douglas, T.E.L.; Beranová, J.; Skwarczyńska, A.; Božič, M.; Samal, S.K.; Modrzejewska, Z.; Gorgieva, S.; Kokol, V.; Bačáková, L. Chitosan hydrogels enriched with polyphenols: Antibacterial activity, cell adhesion and growth and mineralization. Carbohydr. Polym. 2015, 129, 135–142. [Google Scholar] [CrossRef]
- Kong, J.; Yu, S. Fourier Transform Infrared Spectroscopic Analysis of Protein Secondary Structures. Acta Biochim. Biophys. Sin. 2007, 39, 549–559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stern, J.L.; Hagerman, A.E.; Steinberg, P.D.; Mason, P.K. Phlorotannin-protein interactions. J. Chem. Ecol. 1996, 22, 1877–1899. [Google Scholar] [CrossRef] [PubMed]
- Keppler, J.K.; Sönnichsen, F.D.; Lorenzen, P.C.; Schwarz, K. Differences in heat stability and ligand binding among β-lactoglobulin genetic variants A, B and C using 1H NMR and fluorescence quenching. Biochim. Biophys. Acta Proteins Proteom. 2014, 1844, 1083–1093. [Google Scholar] [CrossRef] [PubMed]
- Keppler, J.K.; Martin, D.; Garamus, V.M.; Schwarz, K. Differences in binding behavior of (−)-epigallocatechin gallate to β-lactoglobulin heterodimers (AB) compared to homodimers (A) and (B). J. Mol. Recognit. 2015, 28, 656–666. [Google Scholar] [CrossRef]
- Dobreva, M.A.; Frazier, R.A.; Mueller-Harvey, I.; Clifton, L.A.; Gea, A.; Green, R.J. Binding of pentagalloyl glucose to two globular proteins occurs via multiple surface sites. Biomacromolecules 2011, 12, 710–715. [Google Scholar] [CrossRef] [PubMed]
- Ozdal, T.; Capanoglu, E.; Altay, F. A review on protein-phenolic interactions and associated changes. Food Res. Int. 2013, 51, 954–970. [Google Scholar] [CrossRef]
- Karlsson, J.; Snis, A.; Engqvist, H.; Lausmaa, J. Characterization and comparison of materials produced by Electron Beam Melting (EBM) of two different Ti-6Al-4V powder fractions. J. Mater. Process. Technol. 2013, 213, 2109–2118. [Google Scholar] [CrossRef]
- Silvent, J.; Nassif, N.; Helary, C.; Azaïs, T.; Sire, J.-Y.; Guille, M.M.G. Collagen Osteoid-Like Model Allows Kinetic Gene Expression Studies of Non-Collagenous Proteins in Relation with Mineral Development to Understand Bone Biomineralization. PLoS ONE 2013, 8, e57344. [Google Scholar] [CrossRef] [Green Version]
- Surget, G.; Roberto, V.P.; Le Lann, K.; Mira, S.; Guérard, F.; Laizé, V.; Poupart, N.; Cancela, M.L.; Stiger-Pouvreau, V. Marine green macroalgae: A source of natural compounds with mineralogenic and antioxidant activities. J. Appl. Phycol. 2017, 29, 575–584. [Google Scholar] [CrossRef] [Green Version]
- Da Mello, A.S.S.; dos Santos, P.L.; Marquesi, A.; Queiroz, T.P.; Margonar, R.; de Souza Faloni, A.P. Some aspects of bone remodeling around dental implants. Rev. Clin. Periodoncia, Implantol. Rehabil. Oral 2016. [Google Scholar] [CrossRef] [Green Version]
- Meresta, A.; Folkert, J.; Gaber, T.; Miksch, K.; Buttgereit, F.; Detert, J.; Pischon, N.; Gurzawska, K. Plant-derived pectin nanocoatings to prevent inflammatory cellular response of osteoblasts following Porphyromonas gingivalis infection. Int. J. Nanomed. 2017, 12, 433–445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Folkert, J.; Meresta, A.; Gaber, T.; Miksch, K.; Buttgereit, F.; Detert, J.; Pischon, N.; Gurzawska, K. Nanocoating with plant-derived pectins activates osteoblast response in vitro. Int. J. Nanomed. 2017, 12, 239–249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elango, J.; Saravanakumar, K.; Rahman, S.U.; Henrotin, Y.; Regenstein, J.M.; Wu, W.; Bao, B. Chitosan-collagen 3d matrix mimics trabecular bone and regulates rankl-mediated paracrine cues of differentiated osteoblast and mesenchymal stem cells for bone marrow macrophage-derived osteoclastogenesis. Biomolecules 2019, 9, 173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciapetti, G. Biology of implant wear. In Wear of Orthopaedic Implants and Artificial Joints; Elsevier: Amsterdam, The Netherlands, 2013; pp. 27–55. [Google Scholar]
- Amengual-Peñafiel, L.; Brañes-Aroca, M.; Marchesani-Carrasco, F.; Jara-Sepúlveda, M.C.; Parada-Pozas, L.; Cartes-Velásquez, R. Coupling between Osseointegration and Mechanotransduction to Maintain Foreign Body Equilibrium in the Long-Term: A Comprehensive Overview. J. Clin. Med. 2019, 8, 139. [Google Scholar] [CrossRef] [Green Version]
- Yokota, K.; Sato, K.; Miyazaki, T.; Kitaura, H.; Kayama, H.; Miyoshi, F.; Araki, Y.; Akiyama, Y.; Takeda, K.; Mimura, T. Combination of tumor necrosis factor α and interleukin-6 induces mouse osteoclast-like cells with bone resorption activity both in vitro and in vivo. Arthritis Rheumatol. 2014, 66, 121–129. [Google Scholar] [CrossRef]
- Yoshii, N.; Hamatani, T.; Inagaki, N.; Hosaka, T.; Inoue, O.; Yamada, M.; Machiya, R.; Yoshimura, Y.; Odawara, Y. Successful implantation after reducing matrix metalloproteinase activity in the uterine cavity. Reprod. Biol. Endocrinol. 2013, 11, 37. [Google Scholar] [CrossRef] [Green Version]
- Liang, H.P.H.; Xu, J.; Xue, M.; Jackson, C. Matrix metalloproteinases in bone development and pathology: Current knowledge and potential clinical utility. Met. Med. 2016, 3, 93–102. [Google Scholar] [CrossRef] [Green Version]
- Nakamuta, M.; Kotoh, K.; Enjoji, M.; Nawata, H. Effects of fibril- or fixed-collagen on matrix metalloproteinase-1 and tissue inhibitor of matrix metalloproteinase-1 production in the human hepatocyte cell line HLE. World J. Gastroenterol. 2005, 11, 2264–2268. [Google Scholar] [CrossRef]
- Surmeneva, M.; Chudinova, E.; Syrtanov, M.; Koptioug, A.; Surmenev, R. Investigation of the HA film deposited on the porous Ti6Al4V alloy prepared via additive manufacturing. In Proceedings of the IOP Conference Series: Materials Science and Engineering, Tambov, Russia, 21–22 May 2015; Volume 98, p. 012025. [Google Scholar]
- Karamichos, D.; Brown, R.A.; Mudera, V. Complex dependence of substrate stiffness and serum concentration on cell-force generation. J. Biomed. Mater. Res. Part A 2006, 78, 407–415. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Solution | Collagen Type I Solution (3.33 mg/mL) | Double-Distilled Water | PG Solution (in Water) |
---|---|---|---|
1 | 400 μL | 50 μL | None |
2 | 400 μL | None | 50 μL (0.333 mg/mL) |
3 | 400 μL | None | 50 μL (1.0 mg/mL) |
Coating Type | |
---|---|
Ti | No coating |
Ti_Col_low | Collagen hydrogel containing low PG concentration |
Ti_Col_high | Collagen hydrogel containing high PG concentration |
Origin | Gene Name | Gene Abbreviation | Primer | Sequence 5′ to 3′ |
---|---|---|---|---|
Mouse | glyceraldehyde-3-Phosphate Dehydrogenase | Gapdh | Forward | CCCATCACCATCTTCCAGGAGC |
Reverse | CCAGTGAGCTTCCCGTTCAGC | |||
interleukin6 | Il6 | Forward | GAGGATACCACTCCCAACAGACC | |
Reverse | AAGTGCATCATCGTTGTTCATACA | |||
tumor necrosis factor-alpha | Tnfa | Forward | GATCTCAAAGACAACCAACATGTG | |
Reverse | CTCCAGCTGGAAGACTCCTCCCAG | |||
matrix metalloproteinase 2 | Mmp2 | Forward | AAGGATGGACTCCTGGCACATGCCTTT | |
Reverse | ACCTGTGGGCTTGTCACGTGGTGT | |||
Human | beta-actin | ACTB | Forward | CACCAACTGGGACGACAT |
Reverse | ACAGCCTGGATAGCAACG | |||
collagen 1 type 1 alpha | COL1A1 | Forward | GGTCAAGATGGTCGCCCC | |
Reverse | GGAACACCTCGCTCTCCAG | |||
bone gamma-carboxyglutamate protein (osteocalcin) | BGLAP | Forward | CGCTACCTGTATCAATGGCTGG | |
Reverse | CTCCTGAAAGCCGATGTGGTCA | |||
receptor activator for nuclear factor κ B ligand | RANKL | Forward | ACATATCGTTGGATCACAGCACAT | |
Reverse | CAAAAGGCTGAGCTTCAAGCTT | |||
Interleukin-6 | IL6 | Forward | TGTGAAAGCAGCAAAGAGGC | |
Reverse | TGATTTTCACCAGGCAAGTCTC | |||
tumor necrosis factor-alpha | TNFA | Forward | ATCCTGGGGGACCCAATGTA | |
Reverse | AAAAGAAGGCACAGAGGCCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mieszkowska, A.; Beaumont, H.; Martocq, L.; Koptyug, A.; Surmeneva, M.A.; Surmenev, R.A.; Naderi, J.; Douglas, T.E.L.; Gurzawska-Comis, K.A. Phenolic-Enriched Collagen Fibrillar Coatings on Titanium Alloy to Promote Osteogenic Differentiation and Reduce Inflammation. Int. J. Mol. Sci. 2020, 21, 6406. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21176406
Mieszkowska A, Beaumont H, Martocq L, Koptyug A, Surmeneva MA, Surmenev RA, Naderi J, Douglas TEL, Gurzawska-Comis KA. Phenolic-Enriched Collagen Fibrillar Coatings on Titanium Alloy to Promote Osteogenic Differentiation and Reduce Inflammation. International Journal of Molecular Sciences. 2020; 21(17):6406. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21176406
Chicago/Turabian StyleMieszkowska, Anna, Harrison Beaumont, Laurine Martocq, Andrey Koptyug, Maria A. Surmeneva, Roman A. Surmenev, Javad Naderi, Timothy E.L. Douglas, and Katarzyna A. Gurzawska-Comis. 2020. "Phenolic-Enriched Collagen Fibrillar Coatings on Titanium Alloy to Promote Osteogenic Differentiation and Reduce Inflammation" International Journal of Molecular Sciences 21, no. 17: 6406. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms21176406