Loss of Gene Information: Discrepancies between RNA Sequencing, cDNA Microarray, and qRT-PCR
Abstract
:1. Introduction
2. Results and Discussion
2.1. Correlation of RNA-Seq and cDNA Microarrays
2.2. Analysis of the Loss of SOX Genes with RNA-Seq
2.3. Analysis of Further Genes through Transcriptome Analysis
2.4. Discussion of Possible Causes of Gene Loss
2.5. Analysis of Mechanically Sheared RNA-Seq Datasets
3. Materials and Methods
3.1. Cell Lines and Culture Conditions
3.2. Protein Analysis (Western Blotting)
3.3. Analysis of Gene Expression with Quantitative Real-Time PCR (qRT-PCR)
3.4. Transcriptome Analysis with cDNA Microarrays
3.5. Transcriptome Analysis with Total RNA-Seq
3.6. Analysis of the RNA
3.7. Statistical Analysis
3.8. Accession Numbers
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Van Der Kloet, F.M.; Buurmans, J.; Jonker, M.J.; Smilde, A.K.; Westerhuis, J.A. Increased comparability between RNA-Seq and microarray data by utilization of gene sets. PLoS Comput. Biol. 2020, 16, e1008295. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, A.; Ahn, A.; Rodger, E.J.; Stockwell, P.A.; Eccles, M.R. A Guide for Designing and Analyzing RNA-Seq Data. In Methods in Molecular Biology; Humana Press Inc.: New York, NY, USA, 2018; Volume 1783, pp. 35–80. [Google Scholar] [CrossRef]
- Sayani, A.; Bueno-De-Mesquita, J.M.; Van De Vijver, M.J. Technology Insight: Tuning into the genetic orchestra using microarrays—limitations of DNA microarrays in clinical practice. Nat. Clin. Pr. Oncol. 2006, 3, 501–516. [Google Scholar] [CrossRef]
- Murphy, D. Gene Expression Studies Using Microarrays: Principles, Problems, and Prospects. Adv. Physiol. Educ. 2002, 26, 256–270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hung, J.H.; Weng, Z. Analysis of Microarray and RNA-Seq Expression Profiling Data. Cold Spring Harb. Protoc. 2017, 3, 191–196. [Google Scholar] [CrossRef]
- Hrdlickova, R.; Toloue, M.; Tian, B. RNA-Seq methods for transcriptome analysis. Wiley Interdiscip. Rev. RNA 2017, 8, e1364. [Google Scholar] [CrossRef] [Green Version]
- Everaert, C.; Luypaert, M.; Maag, J.L.V.; Cheng, Q.X.; Dinger, M.E.; Hellemans, J.; Mestdagh, P. Benchmarking of RNA-sequencing analysis workflows using whole-transcriptome RT-qPCR expression data. Sci. Rep. 2017, 7, 1559. [Google Scholar] [CrossRef] [Green Version]
- Shahjaman, M.; Manir Hossain Mollah, M.; Rahman, R.; Islam, S.S.; Mollah, N.H. Robust identification of differentially expressed genes from RNA-seq data. Genomics 2019, 112, 2000–2010. [Google Scholar] [CrossRef]
- Stark, R.; Grzelak, M.; Hadfield, J. RNA sequencing: The teenage years. Nat. Rev. Genet. 2019, 20, 631–656. [Google Scholar] [CrossRef]
- Murdock, D.R. Enhancing Diagnosis Through RNA Sequencing. Clin. Lab. Med. 2020, 40, 113–119. [Google Scholar] [CrossRef]
- Podnar, J.; Deiderick, H.; Huerta, G.; Hunicke-Smith, S. Next-Generation Sequencing RNA-Seq Library Construction. Curr. Protoc. Mol. Biol. 2014, 106, 4.21.1–4.21.19. [Google Scholar] [CrossRef]
- Wang, C.; Gong, B.; Bushel, P.R.; Thierry-Mieg, J.; Thierry-Mieg, D.; Xu, J.; Fang, H.; Hong, H.; Shen, J.; Su, Z.; et al. The concordance between RNA-seq and microarray data depends on chemical treatment and transcript abundance. Nat. Biotechnol. 2014, 32, 926–932. [Google Scholar] [CrossRef]
- Su, Z.; Łabaj, P.P.; Li, S.; Thierry-Mieg, J.; Thierry-Mieg, D.; Shi, W.; Wang, C.; Schroth, G.P.; Setterquist, R.A.; Thompson, J.F.; et al. A Comprehensive Assessment of RNA-Seq Accuracy, Reproducibility and Information Content by the Sequencing Quality Control Consortium. Nat. Biotechnol. 2014, 32, 903–914. [Google Scholar] [CrossRef]
- Fu, X.; Fu, N.; Guo, S.; Yan, Z.; Yixue, L.; Hu, H.; Menzel, C.; Chen, W.; Philipp, K.; Zeng, R.; et al. Estimating accuracy of RNA-Seq and microarrays with proteomics. BMC Genom. 2009, 10, 161. [Google Scholar] [CrossRef] [Green Version]
- Zhao, S.; Fung-Leung, W.-P.; Bittner, A.; Ngo, K.; Liu, X. Comparison of RNA-Seq and Microarray in Transcriptome Profiling of Activated T Cells. PLoS ONE 2014, 9, e78644. [Google Scholar] [CrossRef]
- Dobin, A.; Gingeras, T.R. Optimizing RNA-Seq Mapping with STAR. In Methods in Molecular Biology; Humana Press Inc.: New York, NY, USA, 2016; Volume 1415, pp. 245–262. [Google Scholar] [CrossRef]
- Xiong, T.-F.; Pan, F.-Q.; Li, D. Expression and clinical significance of S100 family genes in patients with melanoma. Melanoma Res. 2019, 29, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Bhalla, S.; Kaur, H.; Dhall, A.; Raghava, G.P.S. Prediction and Analysis of Skin Cancer Progression using Genomics Profiles of Patients. Sci. Rep. 2019, 9, 15790. [Google Scholar] [CrossRef] [Green Version]
- Soler-Cardona, A.; Forsthuber, A.; Lipp, K.; Ebersberger, S.; Heinz, M.; Schossleitner, K.; Buchberger, E.; Gröger, M.; Petzelbauer, P.; Hoeller, C.; et al. CXCL5 Facilitates Melanoma Cell–Neutrophil Interaction and Lymph Node Metastasis. J. Investig. Dermatol. 2018, 138, 1627–1635. [Google Scholar] [CrossRef] [Green Version]
- Price, A.; Garhyan, J.; Gibas, C. The impact of RNA secondary structure on read start locations on the Illumina sequencing platform. PLoS ONE 2017, 12, e0173023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onoa, B.; Tinoco, I. RNA folding and unfolding. Curr. Opin. Struct. Biol. 2004, 14, 374–379. [Google Scholar] [CrossRef] [PubMed]
- Zuker, M.; Stiegler, P. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 1981, 9, 133–148. [Google Scholar] [CrossRef]
- Roberts, A.; Trapnell, C.; Donaghey, J.; Rinn, J.L.; Pachter, L. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol. 2011, 12, R22. [Google Scholar] [CrossRef] [Green Version]
- Mayer, A.; Churchman, L.S. Genome-wide profiling of RNA polymerase transcription at nucleotide resolution in human cells with native elongating transcript sequencing. Nat. Protoc. 2016, 11, 813–833. [Google Scholar] [CrossRef] [PubMed]
- Kunz, M.; Löffler-Wirth, H.; Dannemann, M.; Willscher, E.; Doose, G.; Kelso, J.; Kottek, T.; Nickel, B.; Hopp, L.; Landsberg, J.; et al. RNA-seq analysis identifies different transcriptomic types and developmental trajectories of primary melanomas. Oncogene 2018, 37, 6136–6151. [Google Scholar] [CrossRef] [PubMed]
- Hoek, K.S.; Schlegel, N.C.; Brafford, P.; Sucker, A.; Ugurel, S.; Kumar, R.; Weber, B.L.; Nathanson, K.; Phillips, D.J.; Herlyn, M.; et al. Metastatic potential of melanomas defined by specific gene expression profiles with no BRAF signature. Pigment. Cell Res. 2006, 19, 290–302. [Google Scholar] [CrossRef]
- Griffith, M.; Walker, J.R.; Spies, N.C.; Ainscough, B.J.; Griffith, O.L. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud. PLoS Comput. Biol. 2015, 11, e1004393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacob, K.; Wach, F.; Holzapfel, U.; Hein, R.; Lengyel, E.; Buettner, R.; Bosserhoff, A.-K. In vitro modulation of human melanoma cell invasion and proliferation by all-frans-retinoic acid. Melanoma Res. 1998, 8, 211–219. [Google Scholar] [CrossRef]
- Mueller, D.W.; Bosserhoff, A. MicroRNA miR-196a controls melanoma-associated genes by regulating HOX-C8 expression. Int. J. Cancer 2011, 129, 1064–1074. [Google Scholar] [CrossRef]
- Arnold, J.; Engelmann, J.C.; Schneider, N.; Bosserhoff, A.K.; Kuphal, S. miR-488-5p and its role in melanoma. Exp. Mol. Pathol. 2020, 112, 104348. [Google Scholar] [CrossRef] [PubMed]
- Kappelmann-Fenzl, M.; Gebhard, C.; Matthies, A.O.; Kuphal, S.; Rehli, M.; Bosserhoff, A.K. C-Jun drives melanoma progression in PTEN wild type melanoma cells. Cell Death Dis. 2019, 10, 584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Böhme, I.; Bosserhoff, A. Extracellular acidosis triggers a senescence-like phenotype in human melanoma cells. Pigment. Cell Melanoma Res. 2020, 33, 41–51. [Google Scholar] [CrossRef] [Green Version]
- Schiffner, S.; Braunger, B.M.; de Jel, M.M.; Coupland, S.; Tamm, E.; Bosserhoff, A.K. Tg(Grm1) transgenic mice: A murine model that mimics spontaneous uveal melanoma in humans? Exp. Eye Res. 2014, 127, 59–68. [Google Scholar] [CrossRef]
- Kappelmann, M.; Kuphal, S.; Meister, G.; Vardimon, L.; Bosserhoff, A. MicroRNA miR-125b controls melanoma progression by direct regulation of c-Jun protein expression. Oncogene 2013, 32, 2984–2991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andersson, R.; The FANTOM Consortium; Gebhard, C.; Miguel-Escalada, I.; Hoof, I.; Bornholdt, J.; Boyd, M.; Chen, Y.; Zhao, X.; Schmidl, C.; et al. An atlas of active enhancers across human cell types and tissues. Nature 2014, 507, 455–461. [Google Scholar] [CrossRef] [PubMed]
- Kappelmann-Fenzl, M.; Schmidt, S.K.; Fischer, S.; Schmid, R.; Lämmerhirt, L.; Fischer, L.; Schrüfer, S.; Thievessen, I.; Schubert, D.W.; Matthies, A.; et al. Molecular Changes Induced in Melanoma by Cell Culturing in 3D Alginate Hydrogels. Cancers 2021, 13, 4111. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing. R Found. Stat. Comput. 2020, 2. Available online: http://www.r-project.org/ (accessed on 8 December 2020).
- RStudio Team. Integrated Development for R. In RStudio; RStudio PBC: Boston, MA, USA, 2020; p. 14. Available online: https://rstudio.com (accessed on 8 December 2020).
- Wickham, H. Ggplot2: Elegant Graphic for Data Analysis; Springer: New York, NY, USA, 2016; Available online: https://ggplot2.tidyverse.org (accessed on 8 December 2020).
Primer | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Product Size in bp | Melting Peak in °C |
---|---|---|---|---|
GAPDH | TGGGGAAGGTGAAGGTCGGA | TTGATGACAAGCTTCCCGTTC | 207 | 83 |
GAPDH | GGCTCTCCAGAACATCATCCCTGC | GGGTGTCGCTGTTGAAGTCAGAGG | 269 | 88 |
SOX21 | GGAGAACCCCAAGATGCACA | CCGGGAAGGCGAACTTGT | 202 | 89 |
SOX2 | GAACCAGCGCATGGACAGTT | AGCCGTTCATGTAGGTCTGC | 199 | 91 |
SOX3 | GATAAGCCTACCCTTCCCGC | GTGTCCCTACGGGGTTCTTG | 196 | 92 |
SOX4 | CAGCAAACCAACAATGCCGA | GATCTGCGACCACACCATGA | 209 | 93 |
SOX11 | GAGGGCGAATTCATGGCTTG | ATTTTCCAGCGCTTGCCCAG | 199 | 89 |
YAP1 | CCCTCGTTTTGCCATGAACC | ACCATCCTGCTCCAGTGTTG | 286 | 88 |
TAZ | TGGACCAAGTACATGAACCACC | AAATTCTGCTCCTCGGCACA | 278 | 88 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rachinger, N.; Fischer, S.; Böhme, I.; Linck-Paulus, L.; Kuphal, S.; Kappelmann-Fenzl, M.; Bosserhoff, A.K. Loss of Gene Information: Discrepancies between RNA Sequencing, cDNA Microarray, and qRT-PCR. Int. J. Mol. Sci. 2021, 22, 9349. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179349
Rachinger N, Fischer S, Böhme I, Linck-Paulus L, Kuphal S, Kappelmann-Fenzl M, Bosserhoff AK. Loss of Gene Information: Discrepancies between RNA Sequencing, cDNA Microarray, and qRT-PCR. International Journal of Molecular Sciences. 2021; 22(17):9349. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179349
Chicago/Turabian StyleRachinger, Nicole, Stefan Fischer, Ines Böhme, Lisa Linck-Paulus, Silke Kuphal, Melanie Kappelmann-Fenzl, and Anja K. Bosserhoff. 2021. "Loss of Gene Information: Discrepancies between RNA Sequencing, cDNA Microarray, and qRT-PCR" International Journal of Molecular Sciences 22, no. 17: 9349. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179349