Complement Factor B Mediates Ocular Angiogenesis through Regulating the VEGF Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. Cfb Expression Is Up-Regulated in Mouse Models of Neovascular Ocular Disease
2.2. CFB Promotes Angiogenesis in In Vitro Models of Angiogenesis
2.3. CFB Promotes Angiogenesis in Ex Vitro Models of Angiogenesis
2.4. CFB Mediates VEGF Signaling in HRECs
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Cell Culture
4.3. RNA Extraction and Quantitative Real-Time PCR
4.4. Protein Extraction and Western Blot Analysis
4.5. Molecular Biological Methods
4.6. Mouse Model of Laser-Induced Choroidal Neovascularisation
4.7. Mouse Model of Oxygen-Induced Retinopathy (OIR)
4.8. Aortic Ring Assay
4.9. Metatarsal Sprouting Assay
4.10. Viability Assay
4.11. Proliferation Assay
4.12. Matrigel Tube Formation Assay
4.13. Transwell Migration Assay
4.14. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
Abbreviations
CFB | Complement Factor B |
AP | Alternative Pathway |
CNV | Choroidal Neovascularization |
OIR | Oxygen Induced Retinopathy |
EC | Endothelial Cell |
ECM | Extracellular Matrix |
DR | Diabetic Retinopathy |
nAMD | Neovascular Age-Related Macular Degeneration |
ROP | Retinopathy of Prematurity |
VEGF | Vascular Endothelial Growth Factor |
CFD | Complement Factor D |
CFH | Complement Factor H |
P | Postnatal Day |
SEM | Standard Error of Mean |
rhCFB | Recombinant CFB |
siCFB | Small Interfering RNA-Mediated CFB Knockdown |
HREC | Human Retinal Endothelial Cell |
PBS | Phosphate Buffered Saline |
siControl | Small Interfering RNA-mediated Scrambled Control |
DAPI | 4′,6-Diamidino-2-Phenylindole |
VEGFR2 | Vascular Endothelial Growth Factor Receptor-2 |
p-ERK | Phosphorylated ERK |
p-AKT | Phosphorylated AKT |
MAC | Membrane Attack Complex |
RPE | Retinal Pigment Epithelium |
IACUC | Institutional Animal Care and Use Committee |
A*STAR | Agency for Science Technology and Research |
EGM-2TM | Endothelial Growth Media-2TM |
FBS | Fetal Bovine Serum |
P/S | Penicillin Streptomycin |
HEK293F | Freestyle Human Embryonic Kidney 293 Cells |
DTT | Dithiothreitol |
PMSF | Phenylmethylsulfonyl Fluoride |
SDS-PAGE | Sodium Dodecyl Sulphate–Polyacrylamide Gel Electrophoresis |
PVDF | Polyvinylidene Fluoride |
HRP | Horseradish Peroxidase |
IMAC | Immobilized Metal ion Affinity Chromatography |
IB4 | Isolectin B4 |
EBM-2TM | Endothelial Basal Media-2TM |
References
- Carmeliet, P. Mechanisms of angiogenesis and arteriogenesis. Nat. Med. 2000, 6, 389–395. [Google Scholar] [CrossRef] [PubMed]
- Patan, S. Vasculogenesis and angiogenesis as mechanisms of vascular network formation, growth and remodeling. J. Neuro-Oncol. 2000, 50, 1–15. [Google Scholar] [CrossRef]
- Song, J.W.; Bazou, D.; Munn, L.L. Anastomosis of endothelial sprouts forms new vessels in a tissue analogue of angiogenesis. Integr. Biol. 2012, 4, 857–862. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ribatti, D.; Nico, B.; Crivellato, E. The role of pericytes in angiogenesis. Int. J. Dev. Biol. 2011, 55, 261–268. [Google Scholar] [CrossRef] [Green Version]
- van Hinsbergh, V.W.M.; Koolwijk, P. Endothelial sprouting and angiogenesis: Matrix metalloproteinases in the lead. Cardiovasc. Res. 2008, 78, 203–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, A.S.; Ferrara, N. Developmental and pathological angiogenesis. Annu. Rev. Cell Dev. Biol. 2011, 27, 563–584. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; LeBlanc, E.M.; Chen, X.; Chen, P.; Ji, Y.; Brewer, M.; Tian, H.; Spring, R.S.; Webster, A.K.; Li, W. Pathogenic role and therapeutic potential of pleiotrophin in mouse models of ocular vascular disease. Angiogenesis 2017, 20, 479–492. [Google Scholar] [CrossRef]
- Cabral, T.; Mello, L.G.M.; Lima, L.H.; Polid, J.; Regatieri, C.V.; Belfort, R., Jr.; Mahajan, V.B. Retinal and choroidal angiogenesis: A review of new targets. Int. J. Retin. Vitr. 2017, 3, 31. [Google Scholar] [CrossRef] [Green Version]
- Kokame, G.T.; DeCarlo, T.E.; Kaneko, K.N.; Omizo, J.N.; Lian, R. Anti-Vascular Endothelial Growth Factor Resistance in Exudative Macular Degeneration and Polypoidal Choroidal Vasculopathy. Ophthalmol. Retina 2019, 3, 744–752. [Google Scholar] [CrossRef]
- Nishijima, K.; Ng, Y.S.; Zhong, L.; Bradley, J.; Schubert, W.; Jo, N.; Akita, J.; Samuelsson, S.J.; Robinson, G.S.; Adamis, A.P.; et al. Vascular endothelial growth factor-A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. Am. J. Pathol. 2007, 171, 53–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoeben, A.; Landuyt, B.; Highley, M.S.; Wildiers, H.; Oosterom, A.T.V.; De Bruijn, E.A. Vascular endothelial growth factor and angiogenesis. Pharmacol. Rev. 2004, 56, 549–580. [Google Scholar] [CrossRef] [PubMed]
- Avery, R.L.; Castellarin, A.A.; Steinle, N.C.; Dhoot, D.S.; Pieramici, D.J.; see, R.; Couvillion, S.; Nasir, M.A.; Rabena, M.D.; Maia, M.; et al. Systemic Pharmacokinetics and Pharmacodynamics of Intravitreal Aflibercept, Bevacizumab, and Ranibizumab. Retina 2017, 37, 1847–1858. [Google Scholar] [CrossRef] [Green Version]
- Falavarjani, K.G.; Nguyen, Q.D. Adverse events and complications associated with intravitreal injection of anti-VEGF agents: A review of literature. Eye 2013, 27, 787–794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shima, C.; Sakaguchi, H.; Gomi, F.; Kamei, M.; Ikuno, Y.; Oshima, Y.; Sawa, M.; Tsujikawa, M.; Kuasaka, S.; Tano, Y. Complications in patients after intravitreal injection of bevacizumab. Acta Ophthalmol. 2008, 86, 372–376. [Google Scholar] [CrossRef]
- Ricklin, D.; Hajishengallis, G.; Yang, K.; Lambris, J.D. Complement: A key system for immune surveillance and homeostasis. Nat. Immunol. 2010, 11, 785–797. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ricklin, D.; Lambris, J.D. Complement in Immune and Inflammatory Disorders: Pathophysiological Mechanisms. J. Immunol. 2013, 190, 3831–3838. [Google Scholar] [CrossRef] [Green Version]
- Holers, V.M. The complement system as a therapeutic target in autoimmunity. Clin. Immunol. 2003, 107, 140–151. [Google Scholar] [CrossRef]
- Clark, S.J.; Bishop, P.N. The eye as a complement dysregulation hotspot. Semin. Immunopathol. 2018, 40, 65–74. [Google Scholar] [CrossRef] [PubMed]
- Janssen, B.J.; Gomes, L.; Koning, R.I.; Svergun, D.I.; Koster, A.J.; Fritzinger, D.C.; Vogel, C.W.; Gros, P. Insights into complement convertase formation based on the structure of the factor B-cobra venom factor complex. EMBO J. 2009, 28, 2469–2478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Edwards, A.O.; Ritter, R.; Abel, K.J.; Manning, A.; Panhuysen, C.; Farrer, L.A. Complement Factor H Polymorphism and Age-Related Macular Degeneration. Science 2005, 308, 421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hageman, G.S.; Anderson, D.H.; Johnson, L.V.; Hancox, L.S.; Taiber, A.J.; Hardisty, L.I.; Hageman, J.L.; Stockman, H.A.; Borchardt, J.D.; Gehrs, K.M.; et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc. Natl. Acad. Sci. USA 2005, 102, 7227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haines, J.L.; Huaser, M.A.; Schmidt, S.; Scott, W.K.; Olson, L.M.; Gallins, P.; Spencer, K.L.; Kwan, S.Y.; Noureddine, M.; Gilbert, J.R.; et al. Complement Factor H Variant Increases the Risk of Age-Related Macular Degeneration. Science 2005, 308, 419. [Google Scholar] [CrossRef] [Green Version]
- Klein, R.J.; Zeiss, C.; Cheew, E.Y.; Tsai, J.Y.; Sackler, R.S.; Haynes, C.; Kenning, A.K.; SanGiovanni, J.P.; Mane, S.M.; Mayne, S.T.; et al. Complement Factor H Polymorphism in Age-Related Macular Degeneration. Science 2005, 308, 385. [Google Scholar] [CrossRef] [PubMed]
- Gold, B.; Merriam, J.E.; Zernant, J.; Hancox, L.S.; Taiber, A.J.; Gehrs, K.; Cramer, K.; Neel, J.; Bergeron, J.; Barile, G.R.; et al. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat. Genet. 2006, 38, 458–462. [Google Scholar] [CrossRef] [Green Version]
- Spencer, K.L.; Hauser, M.A.; Olson, L.M.; Schmidt, S.; Scott, W.K.; Gallins, P.; Agarwal, A.; Postel, E.A.; Pericak-Vance, M.A.; Haines, J.L.; et al. Protective effect of complement factor B and complement component 2 variants in age-related macular degeneration. Hum. Mol. Genet. 2007, 16, 1986–1992. [Google Scholar] [CrossRef]
- Montes, T.; Tortajada, A.; Morgan, B.P.; de Cordoba, S.R.; Harris, C.L. Functional basis of protection against age-related macular degeneration conferred by a common polymorphism in complement factor B. Proc. Natl. Acad. Sci. USA 2009, 106, 4366–4371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rohrer, B.; Coughlin, B.; Kunchithapautham, K.; Long, Q.; Tomlinson, S.; Takahashi, K.; Holers, M.V. The alternative pathway is required, but not alone sufficient, for retinal pathology in mouse laser-induced choroidal neovascularization. Mol. Immunol. 2011, 48, e1–e8. [Google Scholar] [CrossRef] [Green Version]
- Schnabolk, G.; Coughlin, B.; Joseph, K.; Kunchithapautham, K.; Bandyopadhyay, M.; O’Quinn, E.C.; Nowling, T.; Rohrer, B. Local Production of the Alternative Pathway Component Factor B Is Sufficient to Promote Laser-Induced Choroidal Neovascularization. Investig. Ophthalmol. Vis. Sci. 2015, 56, 1850–1863. [Google Scholar] [CrossRef] [Green Version]
- Bora, P.S.; Sohn, J.H.; Cruz, J.M.C.; Jha, P.; Nishihori, H.; Wang, Y.; Kaliappan, S.; Kaplan, H.J.; Bora, N.S. Role of Complement and Complement Membrane Attack Complex in Laser-Induced Choroidal Neovascularization. J. Immunol. 2005, 174, 491–497. [Google Scholar] [CrossRef] [Green Version]
- Sweigard, J.H.; Yanai, R.; Gaissert, P.; Saint-Geniez, M.; Kataoka, K.; Thanos, A.; Stahl, G.L.; Lambris, J.D.; Connor, K.M. The alternative complement pathway regulates pathological angiogenesis in the retina. FASEB J. 2014, 28, 3171–3182. [Google Scholar] [CrossRef] [Green Version]
- Watson, M.G.; McDougall, S.R.; Chaplain, M.A.J.; Devlin, A.H.; Mitchell, C.A. Dynamics of angiogenesis during murine retinal development: A coupled in vivo and in silico study. J. R. Soc. Interface 2012, 9, 2351–2364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gariano, R.F.; Gardner, T.W. Retinal angiogenesis in development and disease. Nature 2005, 438, 960–966. [Google Scholar] [CrossRef]
- Stahl, A.; Connor, K.M.; Sapieha, P.; Chen, J.; Denninson, R.J.; Krah, N.M.; Seaward, M.R.; Willett, K.L.; Aderman, C.M.; Guerin, K.I.; et al. The Mouse Retina as an Angiogenesis Model. Investig. Ophthalmol. Vis. Sci. 2010, 51, 2813–2826. [Google Scholar] [CrossRef]
- Kim, C.B.; D’Amore, P.A.; Connor, K.M. Revisiting the mouse model of oxygen-induced retinopathy. Eye Brain 2016, 8, 67–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lambert, V.; Lecomte, J.; Hansen, S.; Blacher, S.; Gonzalez, M.A.; Struman, I.; Sounni, N.E.; Rozet, E.; Tuillo, P.; Foidart, J.M.; et al. Laser-induced choroidal neovascularization model to study age-related macular degeneration in mice. Nat. Protoc. 2013, 8, 2197–2211. [Google Scholar] [CrossRef]
- Liu, C.H.; Wang, Z.; Sun, Y.; Checn, J. Animal models of ocular angiogenesis: From development to pathologies. FASEB J. 2017, 31, 4665–4681. [Google Scholar] [CrossRef] [Green Version]
- Scholzen, T.; Gerdes, J. The Ki-67 protein: From the known and the unknown. J. Cell Physiol. 2000, 182, 311–322. [Google Scholar] [CrossRef]
- Ucuzian, A.A.; Gassman, A.A.; East, A.T.; Greisler, H.P. Molecular mediators of angiogenesis. J. Burn Care Res. 2010, 31, 158–175. [Google Scholar] [CrossRef] [PubMed]
- Carmeliet, P. Angiogenesis in life, disease and medicine. Nature 2005, 438, 932–936. [Google Scholar] [CrossRef] [PubMed]
- Arroyo, A.G.; Iruela-Arispe, M.L. Extracellular matrix, inflammation, and the angiogenic response. Cardiovasc. Res. 2010, 86, 226–235. [Google Scholar] [CrossRef] [Green Version]
- Al-Soudi, A.; Kaaij, M.H.; Tas, S.W. Endothelial cells: From innocent bystanders to active participants in immune responses. Autoimmun. Rev. 2017, 16, 951–962. [Google Scholar] [CrossRef]
- de Cordoba, S.R.; Tortajada, A.; Harris, C.L.; Morgan, P.B. Complement dysregulation and disease: From genes and proteins to diagnostics and drugs. Immunobiology 2012, 217, 1034–1046. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Yang, M.M.; Li, Y.B.; Liu, G.D.; Teng, Y.; Liu, X.M. Association of CFH and CFB gene polymorphisms with retinopathy in type 2 diabetic patients. Mediat. Inflamm. 2013, 2013, 748435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kunchithapautham, K.; Rohrer, B. Sublytic membrane-attack-complex (MAC) activation alters regulated rather than constitutive vascular endothelial growth factor (VEGF) secretion in retinal pigment epithelium monolayers. J. Biol. Chem. 2011, 286, 23717–23724. [Google Scholar] [CrossRef] [Green Version]
- Chen, M.; Muckersie, E.; Robertson, M.; Forrester, J.V.; Xu, H. Up-regulation of complement factor B in retinal pigment epithelial cells is accompanied by complement activation in the aged retina. Exp. Eye Res. 2008, 87, 543–550. [Google Scholar] [CrossRef]
- Wang, X.; Abraham, S.; McKenzie, J.A.G.; Jeffs, N.; Swire, M.; Tripathi, V.B.; Luhmann, U.F.O.; Lange, C.A.K.; Zhai, Z.; Arthur, H.; et al. LRG1 promotes angiogenesis by modulating endothelial TGF-beta signalling. Nature 2013, 499, 306–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, W.; Fhu, C.W.; Ang, K.H.; Liu, C.H.; Johari, N.A.B.; Lio, D.; Araham, S.; Hong, W.; Moss, S.E.; Greenwood, J.; et al. The fetal mouse metatarsal bone explant as a model of angiogenesis. Nat. Protoc. 2015, 10, 1459–1473. [Google Scholar] [PubMed]
Target (Mouse) | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
β-actin | CTGACGGCCAGGTCATCACT | TAGTTTCATGGATGCCACAGGAT |
Vegf-a | TAGAGTACATCTTCAAGCCG | TCTTTCTTTGGTCTGCATTC |
Cfb | GCATGGTGTGGGAGCATAAA | GGCTTGCCATGGTTGCTTA |
Target (Human) | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
RPLPO | CCTTCTCCTTTGGGCTGGTCATCCA | CAGACACTGGCAACATTGCGGACAC |
CFB | GGAAGGGAATGTGACCAGG | AAGGCAGGAGAGAAGCTGG |
VEGFR2 | CCAGCAAAAGCAGGGAGTCTGT | TGTCTGTGTCATCGGAGTGATATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Murray, H.; Qiu, B.; Ho, S.Y.; Wang, X. Complement Factor B Mediates Ocular Angiogenesis through Regulating the VEGF Signaling Pathway. Int. J. Mol. Sci. 2021, 22, 9580. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179580
Murray H, Qiu B, Ho SY, Wang X. Complement Factor B Mediates Ocular Angiogenesis through Regulating the VEGF Signaling Pathway. International Journal of Molecular Sciences. 2021; 22(17):9580. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179580
Chicago/Turabian StyleMurray, Hannah, Beiying Qiu, Sze Yuan Ho, and Xiaomeng Wang. 2021. "Complement Factor B Mediates Ocular Angiogenesis through Regulating the VEGF Signaling Pathway" International Journal of Molecular Sciences 22, no. 17: 9580. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22179580