Homophilic Interaction of CD147 Promotes IL-6-Mediated Cholangiocarcinoma Invasion via the NF-κB-Dependent Pathway
Abstract
:1. Introduction
2. Results
2.1. Expressions of CD147 in CCA Cell Lines and CD147 Knockout Clones (CD 147 KO)
2.2. Depletion of CD147-Alleviated Proinflammatory Cytokine Expressions in CCA CM
2.3. CD147-Related Cytokine-Potentiated CCA Cell Invasion
2.4. Soluble CD147-Mediated Cell Invasion and IL-6 Production
2.5. NF-kB, p38, and Akt Involved in CD147-Promoted Proinflammatory Cytokine Production
2.6. Inductions of BSG, IL-6, RELA, AKT1, and MAPK14 Observed in Clinical Samples
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Cell Culture
4.3. Conditioned Media (CM) Preparation, Total Protein Extraction, and Western Blot Analysis
4.4. Human Inflammatory Cytokine Profile
4.5. Cytokine Determination by Enzyme-Linked Immunosorbent Assay (ELISA)
4.6. Cytokine Treatment and Inhibitor Treatment
4.7. Cell Invasion by Boyden Chamber Assay
4.8. RNA Extraction and Reverse-Transcriptase-Polymerase Chain Reaction (RT-PCR)
4.9. In Silico Study
4.10. Statistical Analysis and Graphic Creation
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sripa, B.; Pairojkul, C. Cholangiocarcinoma: Lessons from Thailand. Curr. Opin. Gastroenterol. 2008, 24, 349–356. [Google Scholar] [CrossRef] [Green Version]
- Banales, J.M.; Marin, J.J.G.; Lamarca, A.; Rodrigues, P.M.; Khan, S.A.; Roberts, L.R.; Cardinale, V.; Carpino, G.; Andersen, J.B.; Braconi, C.; et al. Cholangiocarcinoma 2020: The next horizon in mechanisms and management. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 557–588. [Google Scholar] [CrossRef]
- Kamsa-Ard, S.; Luvira, V.; Suwanrungruang, K.; Kamsa-Ard, S.; Luvira, V.; Santong, C.; Srisuk, T.; Pugkhem, A.; Bhudhisawasdi, V.; Pairojkul, C. Cholangiocarcinoma Trends, Incidence, and Relative Survival in Khon Kaen, Thailand From 1989 Through 2013: A Population-Based Cancer Registry Study. J. Epidemiol. 2019, 29, 197–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Bahrani, R.; Abuetabh, Y.; Zeitouni, N.; Sergi, C. Cholangiocarcinoma: Risk factors, environmental influences and oncogenesis. Ann. Clin. Lab. Sci. 2013, 43, 195–210. [Google Scholar] [PubMed]
- Sripa, B.; Thinkhamrop, B.; Mairiang, E.; Laha, T.; Kaewkes, S.; Sithithaworn, P.; Periago, M.V.; Bhudhisawasdi, V.; Yonglitthipagon, P.; Mulvenna, J.; et al. Elevated plasma IL-6 associates with increased risk of advanced fibrosis and cholangiocarcinoma in individuals infected by Opisthorchis viverrini. PLoS Negl. Trop. Dis. 2012, 6, e1654. [Google Scholar] [CrossRef]
- Sun, Q.; Li, F.; Sun, F.; Niu, J. Interleukin-8 is a prognostic indicator in human hilar cholangiocarcinoma. Int. J. Clin. Exp. Pathol. 2015, 8, 8376–8384. [Google Scholar]
- Labib, P.L.; Goodchild, G.; Pereira, S.P. Molecular Pathogenesis of Cholangiocarcinoma. BMC Cancer 2019, 19, 185. [Google Scholar] [CrossRef]
- Braconi, C.; Patel, T. Cholangiocarcinoma: New insights into disease pathogenesis and biology. Infect. Dis. Clin. N. Am. 2010, 24, 871–884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carpino, G.; Cardinale, V.; Folseraas, T.; Overi, D.; Grzyb, K.; Costantini, D.; Berloco, P.B.; Di Matteo, S.; Karlsen, T.H.; Alvaro, D.; et al. Neoplastic Transformation of the Peribiliary Stem Cell Niche in Cholangiocarcinoma Arisen in Primary Sclerosing Cholangitis. Hepatology 2019, 69, 622–638. [Google Scholar] [CrossRef] [Green Version]
- Heits, N.; Heinze, T.; Bernsmeier, A.; Kerber, J.; Hauser, C.; Becker, T.; Kalthoff, H.; Egberts, J.H.; Braun, F. Influence of mTOR-inhibitors and mycophenolic acid on human cholangiocellular carcinoma and cancer associated fibroblasts. BMC Cancer 2016, 16, 322. [Google Scholar] [CrossRef] [Green Version]
- Vaeteewoottacharn, K.; Kariya, R.; Pothipan, P.; Fujikawa, S.; Pairojkul, C.; Waraasawapati, S.; Kuwahara, K.; Wongkham, C.; Wongkham, S.; Okada, S. Attenuation of CD47-SIRPalpha Signal in Cholangiocarcinoma Potentiates Tumor-Associated Macrophage-Mediated Phagocytosis and Suppresses Intrahepatic Metastasis. Transl. Oncol. 2019, 12, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Biswas, C.; Zhang, Y.; DeCastro, R.; Guo, H.; Nakamura, T.; Kataoka, H.; Nabeshima, K. The human tumor cell-derived collagenase stimulatory factor (renamed EMMPRIN) is a member of the immunoglobulin superfamily. Cancer Res. 1995, 55, 434–439. [Google Scholar]
- Landras, A.; Reger de Moura, C.; Jouenne, F.; Lebbe, C.; Menashi, S.; Mourah, S. CD147 Is a Promising Target of Tumor Progression and a Prognostic Biomarker. Cancers 2019, 11, 1803. [Google Scholar] [CrossRef] [Green Version]
- Jia, J.; Wang, C.; Shi, Z.; Zhao, J.; Jia, Y.; Zhao-Hui, Z.; Li, X.; Chen, Z.; Zhu, P. Inhibitory effect of CD147/HAb18 monoclonal antibody on cartilage erosion and synovitis in the SCID mouse model for rheumatoid arthritis. Rheumatology 2009, 48, 721–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, C.; Jin, R.; Zhu, X.; Yan, J.; Li, G. Function of CD147 in atherosclerosis and atherothrombosis. J. Cardiovasc. Transl. Res. 2015, 8, 59–66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dean, N.R.; Newman, J.R.; Helman, E.E.; Zhang, W.; Safavy, S.; Weeks, D.M.; Cunningham, M.; Snyder, L.A.; Tang, Y.; Yan, L.; et al. Anti-EMMPRIN monoclonal antibody as a novel agent for therapy of head and neck cancer. Clin. Cancer Res. 2009, 15, 4058–4065. [Google Scholar] [CrossRef] [Green Version]
- Dana, P.; Kariya, R.; Vaeteewoottacharn, K.; Sawanyawisuth, K.; Seubwai, W.; Matsuda, K.; Okada, S.; Wongkham, S. Upregulation of CD147 Promotes Metastasis of Cholangiocarcinoma by Modulating the Epithelial-to-Mesenchymal Transitional Process. Oncol. Res. 2017, 25, 1047–1059. [Google Scholar] [CrossRef]
- Dana, P.; Saisomboon, S.; Kariya, R.; Okada, S.; Obchoei, S.; Sawanyawisuth, K.; Wongkham, C.; Pairojkul, C.; Wongkham, S.; Vaeteewoottacharn, K. CD147 augmented monocarboxylate transporter-1/4 expression through modulation of the Akt-FoxO3-NF-kappaB pathway promotes cholangiocarcinoma migration and invasion. Cell Oncol. 2020, 43, 211–222. [Google Scholar] [CrossRef]
- Caudroy, S.; Polette, M.; Nawrocki-Raby, B.; Cao, J.; Toole, B.P.; Zucker, S.; Birembaut, P. EMMPRIN-mediated MMP regulation in tumor and endothelial cells. Clin. Exp. Metastasis 2002, 19, 697–702. [Google Scholar] [CrossRef]
- Schlegel, J.; Redzic, J.S.; Porter, C.C.; Yurchenko, V.; Bukrinsky, M.; Labeikovsky, W.; Armstrong, G.S.; Zhang, F.; Isern, N.G.; DeGregori, J.; et al. Solution characterization of the extracellular region of CD147 and its interaction with its enzyme ligand cyclophilin A. J. Mol. Biol. 2009, 391, 518–535. [Google Scholar] [CrossRef]
- Fadool, J.M.; Linser, P.J. Evidence for the formation of multimeric forms of the 5A11/HT7 antigen. Biochem. Biophys. Res. Commun. 1996, 229, 280–286. [Google Scholar] [CrossRef]
- Sun, J.; Hemler, M.E. Regulation of MMP-1 and MMP-2 production through CD147/extracellular matrix metalloproteinase inducer interactions. Cancer Res. 2001, 61, 2276–2281. [Google Scholar] [PubMed]
- Tuponchai, P.; Kukongviriyapan, V.; Prawan, A.; Kongpetch, S.; Senggunprai, L. Myricetin ameliorates cytokine-induced migration and invasion of cholangiocarcinoma cells via suppression of STAT3 pathway. J. Cancer Res. Ther. 2019, 15, 157–163. [Google Scholar] [CrossRef]
- Liu, B.; Yan, S.; Jia, Y.; Ma, J.; Wu, S.; Xu, Y.; Shang, M.; Mao, A. TLR2 promotes human intrahepatic cholangiocarcinoma cell migration and invasion by modulating NF-kappaB pathway-mediated inflammatory responses. FEBS J. 2016, 283, 3839–3850. [Google Scholar] [CrossRef]
- Taylor, P.M.; Woodfield, R.J.; Hodgkin, M.N.; Pettitt, T.R.; Martin, A.; Kerr, D.J.; Wakelam, M.J. Breast cancer cell-derived EMMPRIN stimulates fibroblast MMP2 release through a phospholipase A(2) and 5-lipoxygenase catalyzed pathway. Oncogene 2002, 21, 5765–5772. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Kesavan, P.; Nakada, M.T.; Yan, L. Tumor-stroma interaction: Positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol. Cancer Res. 2004, 2, 73–80. [Google Scholar]
- Egawa, N.; Koshikawa, N.; Tomari, T.; Nabeshima, K.; Isobe, T.; Seiki, M. Membrane type 1 matrix metalloproteinase (MT1-MMP/MMP-14) cleaves and releases a 22-kDa extracellular matrix metalloproteinase inducer (EMMPRIN) fragment from tumor cells. J. Biol. Chem. 2006, 281, 37576–37585. [Google Scholar] [CrossRef] [Green Version]
- Gao, M.; Liao, L.; Jia, X.; Kuang, Y.; Chen, X. Role of soluble CD147 in psoriatic patients: A preliminary study. J. Dermatol. 2018, 45, e266–e267. [Google Scholar] [CrossRef] [PubMed]
- Venkatesan, B.; Valente, A.J.; Reddy, V.S.; Siwik, D.A.; Chandrasekar, B. Resveratrol blocks interleukin-18-EMMPRIN cross-regulation and smooth muscle cell migration. Am. J. Physiol. Heart Circ. Physiol. 2009, 297, H874–H886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.Y.; Kim, H.; Suk, K.; Lee, W.H. Activation of CD147 with cyclophilin a induces the expression of IFITM1 through ERK and PI3K in THP-1 cells. Mediat. Inflamm. 2010, 2010, 821940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luvira, V.; Nilprapha, K.; Bhudhisawasdi, V.; Pugkhem, A.; Chamadol, N.; Kamsa-ard, S. Cholangiocarcinoma Patient Outcome in Northeastern Thailand: Single-Center Prospective Study. Asian Pac. J. Cancer Prev. APJCP 2016, 17, 401–406. [Google Scholar] [CrossRef] [Green Version]
- Rizvi, S.; Khan, S.A.; Hallemeier, C.L.; Kelley, R.K.; Gores, G.J. Cholangiocarcinoma—evolving concepts and therapeutic strategies. Nat. Rev. Clin. Oncol. 2018, 15, 95–111. [Google Scholar] [CrossRef] [Green Version]
- Li, H.W.; Yang, X.M.; Tang, J.; Wang, S.J.; Chen, Z.N.; Jiang, J.L. Effects of HAb18G/CD147 knockout on hepatocellular carcinoma cells in vitro using a novel zinc-finger nuclease-targeted gene knockout approach. Cell Biochem. Biophys. 2015, 71, 881–890. [Google Scholar] [CrossRef]
- Hanata, K.; Yamaguchi, N.; Yoshikawa, K.; Mezaki, Y.; Miura, M.; Suzuki, S.; Senoo, H.; Ishikawa, K. Soluble EMMPRIN (extra-cellular matrix metalloproteinase inducer) stimulates the migration of HEp-2 human laryngeal carcinoma cells, accompanied by increased MMP-2 production in fibroblasts. Arch. Histol. Cytol. 2007, 70, 267–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sasaki, M.; Tsuneyama, K.; Ishikawa, A.; Nakanuma, Y. Intrahepatic cholangiocarcinoma in cirrhosis presents granulocyte and granulocyte-macrophage colony-stimulating factor. Hum. Pathol. 2003, 34, 1337–1344. [Google Scholar] [CrossRef]
- Gutschalk, C.M.; Yanamandra, A.K.; Linde, N.; Meides, A.; Depner, S.; Mueller, M.M. GM-CSF enhances tumor invasion by elevated MMP-2, -9, and -26 expression. Cancer Med. 2013, 2, 117–129. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-kappaB signaling in inflammation. Signal Transduct Target Ther. 2017, 2, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Xia, Y.; Shen, S.; Verma, I.M. NF-kappaB, an active player in human cancers. Cancer Immunol. Res. 2014, 2, 823–830. [Google Scholar] [CrossRef] [Green Version]
- Seubwai, W.; Wongkham, C.; Puapairoj, A.; Khuntikeo, N.; Pugkhem, A.; Hahnvajanawong, C.; Chaiyagool, J.; Umezawa, K.; Okada, S.; Wongkham, S. Aberrant expression of NF-kappaB in liver fluke associated cholangiocarcinoma: Implications for targeted therapy. PLoS ONE 2014, 9, e106056. [Google Scholar] [CrossRef]
- Phoomak, C.; Vaeteewoottacharn, K.; Sawanyawisuth, K.; Seubwai, W.; Wongkham, C.; Silsirivanit, A.; Wongkham, S. Mechanistic insights of O-GlcNAcylation that promote progression of cholangiocarcinoma cells via nuclear translocation of NF-kappaB. Sci. Rep. 2016, 6, 27853. [Google Scholar] [CrossRef] [PubMed]
- Cahill, C.M.; Rogers, J.T. Interleukin (IL) 1beta induction of IL-6 is mediated by a novel phosphatidylinositol 3-kinase-dependent AKT/IkappaB kinase alpha pathway targeting activator protein-1. J. Biol. Chem. 2008, 283, 25900–25912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sinfield, J.K.; Das, A.; O’Regan, D.J.; Ball, S.G.; Porter, K.E.; Turner, N.A. p38 MAPK alpha mediates cytokine-induced IL-6 and MMP-3 expression in human cardiac fibroblasts. Biochem. Biophys. Res. Commun. 2013, 430, 419–424. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Nelson, L.J.; Avila, M.A.; Cubero, F.J. Mitogen-Activated Protein Kinases (MAPKs) and Cholangiocarcinoma: The Missing Link. Cells 2019, 8, 1172. [Google Scholar] [CrossRef] [Green Version]
- Sripa, B.; Seubwai, W.; Vaeteewoottacharn, K.; Sawanyawisuth, K.; Silsirivanit, A.; Kaewkong, W.; Muisuk, K.; Dana, P.; Phoomak, C.; Lert-Itthiporn, W.; et al. Functional and genetic characterization of three cell lines derived from a single tumor of an Opisthorchis viverrini-associated cholangiocarcinoma patient. Hum. Cell 2020, 33, 695–708. [Google Scholar] [CrossRef]
- Sripa, B.; Leungwattanawanit, S.; Nitta, T.; Wongkham, C.; Bhudhisawasdi, V.; Puapairoj, A.; Sripa, C.; Miwa, M. Establishment and characterization of an opisthorchiasis-associated cholangiocarcinoma cell line (KKU-100). World J. Gastroenterol. 2005, 11, 3392–3397. [Google Scholar] [CrossRef]
- Ariga, A.; Namekawa, J.; Matsumoto, N.; Inoue, J.; Umezawa, K. Inhibition of tumor necrosis factor-alpha -induced nuclear translocation and activation of NF-kappa B by dehydroxymethylepoxyquinomicin. J. Biol. Chem. 2002, 277, 24625–24630. [Google Scholar] [CrossRef] [Green Version]
- Davis, S.; Meltzer, P.S. GEOquery: A bridge between the Gene Expression Omnibus (GEO) and BioConductor. Bioinformatics 2007, 23, 1846–1847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, P.; Kibbe, W.A.; Lin, S.M. lumi: A pipeline for processing Illumina microarray. Bioinformatics 2008, 24, 1547–1548. [Google Scholar] [CrossRef] [Green Version]
- Miller, J.A.; Cai, C.; Langfelder, P.; Geschwind, D.H.; Kurian, S.M.; Salomon, D.R.; Horvath, S. Strategies for aggregating gene expression data: The collapseRows R function. BMC Bioinform. 2011, 12, 322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cancer Genome Atlas Research, N.; Weinstein, J.N.; Collisson, E.A.; Mills, G.B.; Shaw, K.R.; Ozenberger, B.A.; Ellrott, K.; Shmulevich, I.; Sander, C.; Stuart, J.M. The Cancer Genome Atlas Pan-Cancer analysis project. Nat. Genet. 2013, 45, 1113–1120. [Google Scholar] [CrossRef]
- Farshidfar, F.; Zheng, S.; Gingras, M.C.; Newton, Y.; Shih, J.; Robertson, A.G.; Hinoue, T.; Hoadley, K.A.; Gibb, E.A.; Roszik, J.; et al. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles. Cell Rep. 2017, 19, 2878–2880. [Google Scholar] [CrossRef]
- Wei, T.; Nie, J.; Larson, N.B.; Ye, Z.; Eckel Passow, J.E.; Robertson, K.D.; Kocher, J.A.; Wang, L. CpGtools: A Python Package for DNA Methylation Analysis. Bioinformatics 2019, 37, 1598–1599. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primers (5′→3′) | Reverse Primers (5′→3′) |
---|---|---|
IL-6R | CATTGCCATTGTTCTGAGGTTC | GTGCCACCCAGCCAGCTATC |
CXCR1 | CCTTCTTCCTTTTCCGCCAG | AAGTGTAGGAGGTAACACGATG |
CXCR2 | TTGGCTCTTCTTCAGGGCACACTT | CAGGGGCACAATCTCGGCTCAC |
GM-CSFR | GCAGACGTCCGCATCTTGA | CCGTCGTCAGAACCAAATTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dana, P.; Kariya, R.; Lert-itthiporn, W.; Seubwai, W.; Saisomboon, S.; Wongkham, C.; Okada, S.; Wongkham, S.; Vaeteewoottacharn, K. Homophilic Interaction of CD147 Promotes IL-6-Mediated Cholangiocarcinoma Invasion via the NF-κB-Dependent Pathway. Int. J. Mol. Sci. 2021, 22, 13496. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413496
Dana P, Kariya R, Lert-itthiporn W, Seubwai W, Saisomboon S, Wongkham C, Okada S, Wongkham S, Vaeteewoottacharn K. Homophilic Interaction of CD147 Promotes IL-6-Mediated Cholangiocarcinoma Invasion via the NF-κB-Dependent Pathway. International Journal of Molecular Sciences. 2021; 22(24):13496. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413496
Chicago/Turabian StyleDana, Paweena, Ryusho Kariya, Worachart Lert-itthiporn, Wunchana Seubwai, Saowaluk Saisomboon, Chaisiri Wongkham, Seiji Okada, Sopit Wongkham, and Kulthida Vaeteewoottacharn. 2021. "Homophilic Interaction of CD147 Promotes IL-6-Mediated Cholangiocarcinoma Invasion via the NF-κB-Dependent Pathway" International Journal of Molecular Sciences 22, no. 24: 13496. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222413496