Cytoprotective Activity of Polyamines Is Associated with the Alternative Splicing of RAD51A Pre-mRNA in Normal Human CD4+ T Lymphocytes
Abstract
:1. Introduction
2. Results
2.1. Polyamines Have Cytoprotective Activity against Normal CD4+ T Cells but Not against Malignant Cells
2.2. Polyamines Decrease DNA Damage Induced by Genotoxic Agents in Normal CD4+ T Cells
2.3. Putrescin Prevents the Progression of Apoptosis Induced by Cisplatin in Normal CD4+ T Cells
2.4. Cisplatin Induces RAD51A but No Other RAD51 Family Members in Cancer Cell Lines and Normal CD4+ T Cells
2.5. Putrescin Induces Alternative Splicing of RAD51A Pre-mRNA in Normal CD4+ T Cells but Not in Malignant Cells
2.6. Induction of the Full-Length RAD51A Splice Variant with Splice-Switching Oligonucleotides Leads to the Protection of CD4+ T Cells against Cisplatin
3. Discussion
4. Materials and Methods
4.1. Cell Purification and Cultivation
4.2. A. Poptosis Induction and Toxicity Assays
4.3. Cell Transfection with Splice-Switching Oligonucleotide
4.4. RNA Isolation and Real-Time RT-PCR
4.5. Western Blotting
4.6. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bronte, V.; Zanovello, P. Regulation of immune responses by L-arginine metabolism. Nat. Rev. Immunol. 2005, 5, 641–654. [Google Scholar] [CrossRef] [PubMed]
- Sagar, N.A.; Tarafdar, S.; Agarwal, S.; Tarafdar, A.; Sharma, S. Polyamines: Functions, Metabolism, and Role in Human Disease Management. Med. Sci. 2021, 9, 44. [Google Scholar] [CrossRef] [PubMed]
- Zarza, X.; Van Wijk, R.; Shabala, L.; Hunkeler, A.; Lefebvre, M.; Rodriguez-Villalón, A.; Shabala, S.; Tiburcio, A.F.; Heilmann, I.; Munnik, T. Lipid kinases PIP5K7 and PIP5K9 are required for polyamine-triggered K(+) efflux in Arabidopsis roots. Plant J. 2020, 104, 416–432. [Google Scholar] [CrossRef] [PubMed]
- Dhara, M.; Matta, J.A.; Lei, M.; Knowland, D.; Yu, H.; Gu, S.; Bredt, D.S. Polyamine regulation of ion channel assembly and implications for nicotinic acetylcholine receptor pharmacology. Nat. Commun. 2020, 11, 2799. [Google Scholar] [CrossRef]
- Prusov, A.N.; Smirnova, T.A.; Kolomijtseva, G.Y. Thermodynamic Study of Interactions of Distamycin A with Chromatin in Rat Liver Nuclei in the Presence of Polyamines. Biochemistry (Moscow) 2018, 83, 1231–1244. [Google Scholar] [CrossRef] [PubMed]
- Sakamoto, A.; Terui, Y.; Uemura, T.; Igarashi, K.; Kashiwagi, K. Polyamines regulate gene expression by stimulating translation of histone acetyltransferase mRNAs. J. Biol. Chem. 2020, 295, 8736–8745. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Alsaleh, G.; Feltham, J.; Sun, Y.; Napolitano, G.; Riffelmacher, T.; Charles, P.; Frau, L.; Hublitz, P.; Yu, Z.; et al. Polyamines Control eIF5A Hypusination, TFEB Translation, and Autophagy to Reverse B Cell Senescence. Mol. Cell 2019, 76, 110–125.e9. [Google Scholar] [CrossRef] [Green Version]
- Dever, T.E.; Ivanov, I.P. Roles of polyamines in translation. J. Biol. Chem. 2018, 293, 18719–18729. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, T.; Sakamoto, A.; Terui, Y.; Takao, K.; Sugita, Y.; Yamamoto, K.; Ishihama, A.; Igarashi, K.; Kashiwagi, K. Effect of Spermidine Analogues on Cell Growth of Escherichia coli Polyamine Requiring Mutant MA261. PLoS ONE 2016, 11, e0159494. [Google Scholar] [CrossRef] [Green Version]
- Igarashi, K.; Kashiwagi, K. Modulation of cellular function by polyamines. Int. J. Biochem. Cell Biol. 2010, 42, 39–51. [Google Scholar] [CrossRef]
- Lee, C.-Y.; Su, G.-C.; Huang, W.-Y.; Ko, M.-Y.; Yeh, H.-Y.; Chang, G.-D.; Lin, S.-J.; Chi, P. Promotion of homology-directed DNA repair by polyamines. Nat. Commun. 2019, 10, 65. [Google Scholar] [CrossRef] [PubMed]
- Snyder, R.D.; Sunkara, P.S. Effect of polyamine depletion on DNA damage and repair following UV irradiation of HeLa cells. Photochem. Photobiol. 1990, 52, 525–532. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, H.; Takeda, K.; Imai, A. Polyamines alleviate the inhibitory effect of the DNA cross-linking agent mitomycin C on root growth. Plant Signal. Behav. 2019, 14, 1659687. [Google Scholar] [CrossRef] [PubMed]
- Becciolini, A.; Porciani, S.; Lanini, A.; Balzi, M.; Cionini, L.; Bandettini, L. Polyamine levels in healthy and tumor tissues of patients with colon adenocarcinoma. Dis. Colon Rectum 1991, 34, 167–173. [Google Scholar] [CrossRef]
- Li, J.; Meng, Y.; Wu, X.; Sun, Y. Polyamines and related signaling pathways in cancer. Cancer Cell Int. 2020, 20, 539. [Google Scholar] [CrossRef]
- Nowotarski, S.L.; Woster, P.M.; Casero, R.A.J. Polyamines and cancer: Implications for chemotherapy and chemoprevention. Expert Rev. Mol. Med. 2013, 15, e3. [Google Scholar] [CrossRef] [Green Version]
- Casero, R.A.J.; Murray Stewart, T.; Pegg, A.E. Polyamine metabolism and cancer: Treatments, challenges and opportunities. Nat. Rev. Cancer 2018, 18, 681–695. [Google Scholar] [CrossRef]
- Hesterberg, R.S.; Cleveland, J.L.; Epling-Burnette, P.K. Role of Polyamines in Immune Cell Functions. Med. Sci. 2018, 6, 22. [Google Scholar] [CrossRef] [Green Version]
- Carriche, G.M.; Almeida, L.; Stüve, P.; Velasquez, L.; Dhillon-LaBrooy, A.; Roy, U.; Lindenberg, M.; Strowig, T.; Plaza-Sirvent, C.; Schmitz, I.; et al. Regulating T-cell differentiation through the polyamine spermidine. J. Allergy Clin. Immunol. 2021, 147, 335–348.e11. [Google Scholar] [CrossRef]
- Agostinelli, E.; Belli, F.; Molinari, A.; Condello, M.; Palmigiani, P.; Vedova, L.D.; Marra, M.; Seiler, N.; Arancia, G. Toxicity of enzymatic oxidation products of spermine to human melanoma cells (M14): Sensitization by heat and MDL 72527. Biochim. Biophys. Acta 2006, 1763, 1040–1050. [Google Scholar] [CrossRef] [Green Version]
- Murray Stewart, T.; Dunston, T.T.; Woster, P.M.; Casero, R.A.J. Polyamine catabolism and oxidative damage. J. Biol. Chem. 2018, 293, 18736–18745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Liu, Y.; Qi, C.; Shen, L.; Wang, J.; Liu, X.; Zhang, N.; Bing, T.; Shangguan, D. Oxidative degradation of polyamines by serum supplement causes cytotoxicity on cultured cells. Sci. Rep. 2018, 8, 10384. [Google Scholar] [CrossRef]
- Pegg, A.E. Toxicity of polyamines and their metabolic products. Chem. Res. Toxicol. 2013, 26, 1782–1800. [Google Scholar] [CrossRef] [PubMed]
- Tirtom, N.E.; Hsu, Y.; Li, H.-W. Polyamines stimulate RecA-mediated recombination by condensing duplex DNA and stabilizing intermediates. Phys. Chem. Chem. Phys. 2020, 22, 11928–11935. [Google Scholar] [CrossRef]
- Miller-Fleming, L.; Olin-Sandoval, V.; Campbell, K.; Ralser, M. Remaining Mysteries of Molecular Biology: The Role of Polyamines in the Cell. J. Mol. Biol. 2015, 427, 3389–3406. [Google Scholar] [CrossRef]
- Landau, G.; Bercovich, Z.; Park, M.H.; Kahana, C. The role of polyamines in supporting growth of mammalian cells is mediated through their requirement for translation initiation and elongation. J. Biol. Chem. 2010, 285, 12474–12481. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Marton, L.J.; Woster, P.M.; Casero, R.A. Polyamine analogues targeting epigenetic gene regulation. Essays Biochem. 2009, 46, 95–110. [Google Scholar] [CrossRef]
- Bonilla, B.; Hengel, S.R.; Grundy, M.K.; Bernstein, K.A. RAD51 Gene Family Structure and Function. Annu. Rev. Genet. 2020, 54, 25–46. [Google Scholar] [CrossRef]
- Smith, P.J.; Zhang, C.; Wang, J.; Chew, S.L.; Zhang, M.Q.; Krainer, A.R. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum. Mol. Genet. 2006, 15, 2490–2508. [Google Scholar] [CrossRef] [Green Version]
- Cartegni, L.; Wang, J.; Zhu, Z.; Zhang, M.Q.; Krainer, A.R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31, 3568–3571. [Google Scholar] [CrossRef] [Green Version]
- Jurica, M.S.; Moore, M.J. Pre-mRNA splicing: Awash in a sea of proteins. Mol. Cell 2003, 12, 5–14. [Google Scholar] [CrossRef]
- Lee, Y.; Rio, D.C. Mechanisms and Regulation of Alternative Pre-mRNA Splicing. Annu. Rev. Biochem. 2015, 84, 291–323. [Google Scholar] [CrossRef] [Green Version]
- Savisaar, R.; Hurst, L.D. Exonic splice regulation imposes strong selection at synonymous sites. Genome Res. 2018, 28, 1442–1454. [Google Scholar] [CrossRef] [Green Version]
- Sohail, M.; Xie, J. Diverse regulation of 3′ splice site usage. Cell. Mol. Life Sci. 2015, 72, 4771–4793. [Google Scholar] [CrossRef]
- Liu, L.F.; Rowe, T.C.; Yang, L.; Tewey, K.M.; Chen, G.L. Cleavage of DNA by mammalian DNA topoisomerase II. J. Biol. Chem. 1983, 258, 15365–15370. [Google Scholar] [CrossRef]
- Tewey, K.M.; Rowe, T.C.; Yang, L.; Halligan, B.D.; Liu, L.F. Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science 1984, 226, 466–468. [Google Scholar] [CrossRef] [PubMed]
- Sedletska, Y.; Giraud-Panis, M.-J.; Malinge, J.-M. Cisplatin is a DNA-damaging antitumour compound triggering multifactorial biochemical responses in cancer cells: Importance of apoptotic pathways. Curr. Med. Chem. Anticancer Agents 2005, 5, 251–265. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Vasina, D.A.; Orlova, V.S.; Orlova, E.V.; Grishin, D.V.; Gladilina, Y.A.; Pokrovskaya, M.V.; Aleksandrova, S.S.; Sokolov, N.N. Induction of Apoptotic Endonuclease EndoG with DNA-Damaging Agents Initiates Alternative Splicing of Telomerase Catalytic Subunit hTERT and Inhibition of Telomerase Activity hTERT in Human CD4+and CD8+T Lymphocytes. Biochem. (Moscow) Suppl. Ser. B Biomed. Chem. 2018, 12, 217–230. [Google Scholar] [CrossRef]
- Xu, Y.; Villalona-Calero, M.A. Irinotecan: Mechanisms of tumor resistance and novel strategies for modulating its activity. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2002, 13, 1841–1851. [Google Scholar] [CrossRef] [PubMed]
- Wood, J.P.; Smith, A.J.O.; Bowman, K.J.; Thomas, A.L.; Jones, G.D.D. Comet assay measures of DNA damage as biomarkers of irinotecan response in colorectal cancer in vitro and in vivo. Cancer Med. 2015, 4, 1309–1321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Douki, T.; Bretonniere, Y.; Cadet, J. Protection against radiation-induced degradation of DNA bases by polyamines. Radiat. Res. 2000, 153, 29–35. [Google Scholar] [CrossRef]
- Zahedi, K.; Bissler, J.J.; Wang, Z.; Josyula, A.; Lu, L.; Diegelman, P.; Kisiel, N.; Porter, C.W.; Soleimani, M. Spermidine/spermine N1-acetyltransferase overexpression in kidney epithelial cells disrupts polyamine homeostasis, leads to DNA damage, and causes G2 arrest. Am. J. Physiol. Cell Physiol. 2007, 292, C1204–C1215. [Google Scholar] [CrossRef]
- TABOR, H. The protective effect of spermine and other polyamines against heat denaturation of deoxyribonucleic acid. Biochemistry 1962, 1, 496–501. [Google Scholar] [CrossRef]
- Feuerstein, B.G.; Williams, L.D.; Basu, H.S.; Marton, L.J. Implications and concepts of polyamine-nucleic acid interactions. J. Cell. Biochem. 1991, 46, 37–47. [Google Scholar] [CrossRef]
- Warters, R.L.; Newton, G.L.; Olive, P.L.; Fahey, R.C. Radioprotection of human cell nuclear DNA by polyamines: Radiosensitivity of chromatin is influenced by tightly bound spermine. Radiat. Res. 1999, 151, 354–362. [Google Scholar] [CrossRef] [PubMed]
- Newton, G.L.; Aguilera, J.A.; Ward, J.F.; Fahey, R.C. Effect of polyamine-induced compaction and aggregation of DNA on the formation of radiation-induced strand breaks: Quantitative models for cellular radiation damage. Radiat. Res. 1997, 148, 272–284. [Google Scholar] [CrossRef] [PubMed]
- Park, J.-Y.; Yoo, H.-W.; Kim, B.-R.; Park, R.; Choi, S.-Y.; Kim, Y. Identification of a novel human Rad51 variant that promotes DNA strand exchange. Nucleic Acids Res. 2008, 36, 3226–3234. [Google Scholar] [CrossRef]
- Kawabata, M.; Akiyama, K.; Kawabata, T. Genomic structure and multiple alternative transcripts of the mouse TRAD/RAD51L3/RAD51D gene, a member of the recA/RAD51 gene family. Biochim. Biophys. Acta 2004, 1679, 107–116. [Google Scholar] [CrossRef]
- Wang, A.T.; Kim, T.; Wagner, J.E.; Conti, B.A.; Lach, F.P.; Huang, A.L.; Molina, H.; Sanborn, E.M.; Zierhut, H.; Cornes, B.K.; et al. A Dominant Mutation in Human RAD51 Reveals Its Function in DNA Interstrand Crosslink Repair Independent of Homologous Recombination. Mol. Cell 2015, 59, 478–490. [Google Scholar] [CrossRef] [Green Version]
- Matsuo, Y.; Sakane, I.; Takizawa, Y.; Takahashi, M.; Kurumizaka, H. Roles of the human Rad51 L1 and L2 loops in DNA binding. FEBS J. 2006, 273, 3148–3159. [Google Scholar] [CrossRef]
- Ameziane, N.; May, P.; Haitjema, A.; van de Vrugt, H.J.; van Rossum-Fikkert, S.E.; Ristic, D.; Williams, G.J.; Balk, J.; Rockx, D.; Li, H.; et al. A novel Fanconi anaemia subtype associated with a dominant-negative mutation in RAD51. Nat. Commun. 2015, 6, 8829. [Google Scholar] [CrossRef] [PubMed]
- Baldock, R.A.; Pressimone, C.A.; Baird, J.M.; Khodakov, A.; Luong, T.T.; Grundy, M.K.; Smith, C.M.; Karpenshif, Y.; Bratton-Palmer, D.S.; Prakash, R.; et al. RAD51D splice variants and cancer-associated mutations reveal XRCC2 interaction to be critical for homologous recombination. DNA Repair 2019, 76, 99–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalvala, A.; Gao, L.; Aguila, B.; Reese, T.; Otterson, G.A.; Villalona-Calero, M.A.; Duan, W. Overexpression of Rad51C splice variants in colorectal tumors. Oncotarget 2015, 6, 8777–8787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bueno-Martínez, E.; Sanoguera-Miralles, L.; Valenzuela-Palomo, A.; Lorca, V.; Gómez-Sanz, A.; Carvalho, S.; Allen, J.; Infante, M.; Pérez-Segura, P.; Lázaro, C.; et al. RAD51D Aberrant Splicing in Breast Cancer: Identification of Splicing Regulatory Elements and Minigene-Based Evaluation of 53 DNA Variants. Cancers 2021, 13, 2845. [Google Scholar] [CrossRef]
- Cáceres, J.F.; Krainer, A.R. Functional analysis of pre-mRNA splicing factor SF2/ASF structural domains. EMBO J. 1993, 12, 4715–4726. [Google Scholar] [CrossRef]
- Raderschall, E.; Stout, K.; Freier, S.; Suckow, V.; Schweiger, S.; Haaf, T. Elevated levels of Rad51 recombination protein in tumor cells. Cancer Res. 2002, 62, 219–225. [Google Scholar]
- Klein, H.L. The consequences of Rad51 overexpression for normal and tumor cells. DNA Repair 2008, 7, 686–693. [Google Scholar] [CrossRef] [Green Version]
- Richardson, C.; Stark, J.M.; Ommundsen, M.; Jasin, M. Rad51 overexpression promotes alternative double-strand break repair pathways and genome instability. Oncogene 2004, 23, 546–553. [Google Scholar] [CrossRef] [Green Version]
- Son, M.Y.; Hasty, P. Homologous recombination defects and how they affect replication fork maintenance. AIMS Genet. 2018, 5, 192–211. [Google Scholar] [CrossRef]
- Laurini, E.; Marson, D.; Fermeglia, A.; Aulic, S.; Fermeglia, M.; Pricl, S. Role of Rad51 and DNA repair in cancer: A molecular perspective. Pharmacol. Ther. 2020, 208, 107492. [Google Scholar] [CrossRef]
- van Zuylen, L.; Bridgewater, J.; Sparreboom, A.; Eskens, F.A.L.M.; de Bruijn, P.; Sklenar, I.; Planting, A.S.T.; Choi, L.; Bootle, D.; Mueller, C.; et al. Phase I and pharmacokinetic study of the polyamine synthesis inhibitor SAM486A in combination with 5-fluorouracil/leucovorin in metastatic colorectal cancer. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2004, 10, 1949–1955. [Google Scholar] [CrossRef] [Green Version]
- Hahm, H.A.; Dunn, V.R.; Butash, K.A.; Deveraux, W.L.; Woster, P.M.; Casero, R.A.J.; Davidson, N.E. Combination of standard cytotoxic agents with polyamine analogues in the treatment of breast cancer cell lines. Clin. cancer Res. Off. J. Am. Assoc. Cancer Res. 2001, 7, 391–399. [Google Scholar]
- Zhdanov, D.D.; Gladilina, Y.A.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Pokrovsky, V.S.; Sokolov, N.N. Contact-independent suppressive activity of regulatory T cells is associated with telomerase inhibition, telomere shortening and target lymphocyte apoptosis. Mol. Immunol. 2018, 101, 229–244. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Gladilina, Y.A.; Pokrovsky, V.S.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Sokolov, N.N. Murine regulatory T cells induce death of effector T, B, and NK lymphocytes through a contact-independent mechanism involving telomerase suppression and telomere-associated senescence. Cell. Immunol. 2018, 331, 146–160. [Google Scholar] [CrossRef] [PubMed]
- Denizot, F.; Lang, R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 1986, 89, 271–277. [Google Scholar] [CrossRef]
- Zhdanov, D.D.; Pokrovsky, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Eldarov, M.A.; Grishin, D.V.; Basharov, M.M.; Gladilina, Y.A.; Podobed, O.V.; Sokolov, N.N. Inhibition of telomerase activity and induction of apoptosis by Rhodospirillum rubrum L-asparaginase in cancer Jurkat cell line and normal human CD4+ T lymphocytes. Cancer Med. 2017, 6, 2697–2712. [Google Scholar] [CrossRef]
- Darzynkiewicz, Z.; Galkowski, D.; Zhao, H. Analysis of apoptosis by cytometry using TUNEL assay. Methods 2008, 44, 250–254. [Google Scholar] [CrossRef] [Green Version]
- Zhdanov, D.D.; Vasina, D.A.; Orlova, E.V.; Orlova, V.S.; Pokrovsky, V.S.; Pokrovskaya, M.V.; Aleksandrova, S.S.; Sokolov, N.N. Cisplatin-induced apoptotic endonuclease EndoG inhibits telomerase activity and causes malignant transformation of human CD4+ T lymphocytes. Biochem. (Moscow) Suppl. Ser. B Biomed. Chem. 2017, 11, 251–264. [Google Scholar] [CrossRef]
- Baker, B.F.; Lot, S.S.; Condon, T.P.; Cheng-Flournoy, S.; Lesnik, E.A.; Sasmor, H.M.; Bennett, C.F. 2′-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J. Biol. Chem. 1997, 272, 11994–12000. [Google Scholar] [CrossRef] [Green Version]
- Vasina, D.A.; Zhdanov, D.D.; Orlova, E.V.; Orlova, V.S.; Pokrovskaya, M.V.; Aleksandrova, S.S.; Sokolov, N.N. Apoptotic endonuclease EndoG inhibits telomerase activity and induces malignant transformation of human CD4+ T cells. Biochemistry (Moscow) 2017, 82, 24–37. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
- Hofnagel, O.; Luechtenborg, B.; Stolle, K.; Lorkowski, S.; Eschert, H.; Plenz, G.; Robenek, H. Proinflammatory cytokines regulate LOX-1 expression in vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 1789–1795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Target | Sequence (5′-3′) |
---|---|
SSO for RAD51A pre-mRNA | ATTCCTTACCACAGTGATCTTGATGG |
Control 26-mer oligonucleotide | AUGUGCCGUAGGUGAGGCCUCACGUU |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gladilina, Y.A.; Bey, L.; Hilal, A.; Neborak, E.V.; Blinova, V.G.; Zhdanov, D.D. Cytoprotective Activity of Polyamines Is Associated with the Alternative Splicing of RAD51A Pre-mRNA in Normal Human CD4+ T Lymphocytes. Int. J. Mol. Sci. 2022, 23, 1863. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031863
Gladilina YA, Bey L, Hilal A, Neborak EV, Blinova VG, Zhdanov DD. Cytoprotective Activity of Polyamines Is Associated with the Alternative Splicing of RAD51A Pre-mRNA in Normal Human CD4+ T Lymphocytes. International Journal of Molecular Sciences. 2022; 23(3):1863. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031863
Chicago/Turabian StyleGladilina, Yulia A., Lylia Bey, Abdullah Hilal, Ekaterina V. Neborak, Varvara G. Blinova, and Dmitry D. Zhdanov. 2022. "Cytoprotective Activity of Polyamines Is Associated with the Alternative Splicing of RAD51A Pre-mRNA in Normal Human CD4+ T Lymphocytes" International Journal of Molecular Sciences 23, no. 3: 1863. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031863