Light-Dependent Nitrate Removal Capacity of Green Microalgae
Abstract
:1. Introduction
2. Results
2.1. Effect of Various Light Conditions on the Growth of Chlamydomonas sp. MACC-216
2.2. Effect of Various Light Conditions on the Nitrate Removal Capacity of Chlamydomonas sp. MACC-216
2.3. Growth, Nitrate Removal Efficiency and Nitrate Reductase Activity in SWW
2.4. Expression of Genes Involved in Nitrate Transport and Reduction
2.5. Growth and Nitrate Removal Efficiency of Chlorella sp. MACC-38 and Chlorella sp. MACC-360 in SWW
3. Discussion
4. Materials and Methods
4.1. Microalga Strain and Growth Media
4.2. Growth Conditions and Measurement
4.3. Nitrate Measurement
4.4. Nitrate Reductase Activity
4.5. Quantification of Genes Expression
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yu, G.; Wang, J.; Liu, L.; Li, Y.; Zhang, Y.; Wang, S. The analysis of groundwater nitrate pollution and health risk assessment in rural areas of Yantai, China. BMC Public Health 2020, 20, 437. [Google Scholar] [CrossRef] [PubMed]
- Shrimali, M.; Singh, K.P. New methods of nitrate removal from water. Environ. Pollut. 2001, 112, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Taziki, M.; Ahmadzadeh, H.; Murry, M.A.; Lyon, S.R. Nitrate and nitrite removal from wastewater using algae. Curr. Biotechnol. 2015, 4, 426–440. [Google Scholar] [CrossRef]
- Cabanelas, I.T.; Ruiz, J.; Arbib, Z.; Chinalia, F.A.; Garrido-Pérez, C.; Rogalla, F.; Nascimento, I.A.; Perales, J.A. Comparing the use of different domestic wastewaters for coupling microalgal production and nutrient removal. Bioresour. Technol. 2013, 131, 429–436. [Google Scholar] [CrossRef]
- Jia, H.; Yuan, Q. Removal of nitrogen from wastewater using microalgae and microalgae-bacteria consortia. Cogent Environ. Sci. 2016, 2, 1275089. [Google Scholar] [CrossRef]
- Gupta, S.K.; Ansari, F.A.; Nasr, M.; Rawat, I.; Nayunigari, M.K.; Bux, F. Cultivation of Chlorella sorokiniana and Scenedesmus obliquus in wastewater: Fuzzy intelligence for evaluation of growth parameters and metabolites extraction. J. Clean. Prod. 2017, 147, 419–430. [Google Scholar] [CrossRef]
- Ansari, F.A.; Nasr, M.; Rawat, I.; Bux, F. Meeting sustainable development goals (SDGs) through progression of pilot-scale algal system to commercial raceway pond (300,000 L). Biomass Convers. Biorefin. 2021. [Google Scholar] [CrossRef]
- Sæbø, A.; Krekling, T.; Appelgren, M. Light quality affects photosynthesis and leaf anatomy of birch plantlets in vitro. Plant Cell Tissue Organ Cult. 1995, 41, 177–185. [Google Scholar] [CrossRef]
- Maltsev, Y.; Maltseva, K.; Kulikovskiy, M.; Maltseva, S. Influence of light conditions on microalgae growth and content of lipids, carotenoids, and fatty acid composition. Biology 2021, 10, 1060. [Google Scholar] [CrossRef]
- Masojídek, J.; Koblížek, M.; Torzillo, G. Photosynthesis in microalgae. In Handbook of Microalgal Culture: Biotechnology and Applied Phycology; Richmond, A., Ed.; Blackwell Publishing: Oxford, UK, 2003; pp. 20–39. [Google Scholar]
- Das, P.; Lei, W.; Aziz, S.S.; Obbard, J.P. Enhanced algae growth in both phototrophic and mixotrophic culture under blue light. Bioresour. Technol. 2011, 102, 3883–3887. [Google Scholar] [CrossRef]
- Kim, T.H.; Lee, Y.; Han, S.H.; Hwang, S.J. The effects of wavelength and wavelength mixing ratios on microalgae growth and nitrogen, phosphorus removal using Scenedesmus sp. for wastewater treatment. Bioresour. Technol. 2013, 130, 75–80. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Huff, J.; Crunkleton, D.W.; Johannes, T.W. LED alternating between blue and red-orange light improved the biomass and lipid productivity of Chlamydomonas reinhardtii. J. Biotechnol. 2021, 341, 96–102. [Google Scholar] [CrossRef] [PubMed]
- Teo, C.L.; Atta, M.; Bukhari, A.; Taisir, M.; Yusuf, A.M.; Idris, A. Enhancing growth and lipid production of marine microalgae for biodiesel production via the use of different LED wavelengths. Bioresour. Technol. 2014, 162, 38–44. [Google Scholar] [CrossRef]
- Wu, H. Effect of different light qualities on growth, pigment content, chlorophyll fluorescence, and antioxidant enzyme activity in the red alga Pyropia haitanensis (Bangiales, Rhodophyta). BioMed Res. Int. 2016, 2016, 7383918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Figueroa, F.L.; Aguilera, J.; Niell, F.X. Red and blue light regulation of growth and photosynthetic metabolism in Porphyra umbilicalis (Bangiales, Rhodophyta). Eur. J. Phycol. 1995, 30, 11–18. [Google Scholar] [CrossRef] [Green Version]
- Koc, C.; Anderson, G.A.; Kommareddy, A. Use of red and blue light-emitting diodes (LED) and fluorescent lamps to grow microalgae in a photobioreactor. Isr. J. Aquac. 2013, 65, 1–8. [Google Scholar]
- Hempel, N.; Petrick, I.; Behrendt, F. Biomass productivity and productivity of fatty acids and amino acids of microalgae strains as key characteristics of suitability for biodiesel production. J. Appl. Phycol. 2012, 24, 1407–1418. [Google Scholar] [CrossRef] [Green Version]
- Atta, M.; Idris, A.; Bukhari, A.; Wahidin, S. Intensity of blue LED light: A potential stimulus for biomass and lipid content in freshwater microalgae Chlorella vulgaris. Bioresour. Technol. 2013, 148, 373–378. [Google Scholar] [CrossRef]
- He, Q.; Yang, H.; Wu, L.; Hu, C. Effect of light intensity on physiological changes, carbon allocation and neutral lipid accumulation in oleaginous microalgae. Bioresour. Technol. 2015, 191, 219–228. [Google Scholar] [CrossRef]
- Zhang, S.; Kim, T.H.; Han, T.H.; Hwang, S.J. Influence of light conditions of a mixture of red and blue light sources on nitrogen and phosphorus removal in advanced wastewater treatment using Scenedesmus dimorphus. Biotechnol. Bioprocess Eng. 2015, 20, 760–765. [Google Scholar] [CrossRef]
- Treves, H.; Raanan, H.; Finkel, O.M.; Berkowicz, S.M.; Keren, N.; Shotland, Y.; Kaplan, A. A newly isolated Chlorella sp. from desert sand crusts exhibits a unique resistance to excess light intensity. FEMS Microbiol. Ecol. 2013, 86, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Virtanen, O.; Khorobrykh, S.; Tyystjärvi, E. Acclimation of Chlamydomonas reinhardtii to extremely strong light. Photosynth. Res. 2021, 147, 91–106. [Google Scholar] [CrossRef]
- Yan, C.; Zhao, Y.; Zheng, Z.; Luo, X. Effects of various LED light wavelengths and light intensity supply strategies on synthetic high-strength wastewater purification by Chlorella vulgaris. Biodegradation 2013, 24, 721–732. [Google Scholar] [CrossRef] [PubMed]
- Rani, V.; Maróti, G. Assessment of nitrate removal capacity of two selected eukaryotic green microalgae. Cells 2021, 10, 2490. [Google Scholar] [CrossRef] [PubMed]
- Gunawan, T.J.; Ikhwan, Y.; Restuhadi, F.; Pato, U. Effect of light Intensity and photoperiod on growth of Chlorella pyrenoidosa and CO2 biofixation. E3S Web Conf. 2018, 31, 03003. [Google Scholar]
- Yan, C.; Zheng, Z. Performance of mixed LED light wavelengths on biogas upgrade and biogas fluid removal by microalga Chlorella sp. Appl. Energy 2014, 113, 1008–1014. [Google Scholar] [CrossRef]
- Garbayo, I.; Vigara, A.J.; Conchon, V.; Dos Santos, V.A.P.M.; Vílchez, C. Nitrate consumption alterations induced by alginate-entrapment of Chlamydomonas reinhardtii cells. Process Biochem. 2000, 36, 459–466. [Google Scholar] [CrossRef]
- Lee, K.; Lee, C.G. Effect of light/dark cycles on wastewater treatments by microalgae. Biotechnol. Bioprocess Eng. 2001, 6, 194–199. [Google Scholar] [CrossRef]
- Su, Y.; Mennerich, A.; Urban, B. Coupled nutrient removal and biomass production with mixed algal culture: Impact of biotic and abiotic factors. Bioresour. Technol. 2012, 118, 469–476. [Google Scholar] [CrossRef]
- Hillman, W.S. The Physiology of Phytochrome. Annu. Rev. Plant Physiol. 1967, 18, 301–324. [Google Scholar] [CrossRef]
- Sharrock, R.A. The phytochrome red/far-red photoreceptor superfamily. Genome Biol. 2008, 9, 230. [Google Scholar] [CrossRef] [Green Version]
- Figueroa, F.L. Photoregulation of nitrogen metabolism and protein accumulation in the red alga Corallina elongata Ellis et Soland. Z. Naturforsch. 1993, 48, 788–794. [Google Scholar] [CrossRef]
- Aparicio, P.J.; Quiñiones, M.A. Blue light, a positive switch signal for nitrate and nitrite uptake by the green alga Monoraphidium braunii. Plant Physiol. 1991, 95, 374–378. [Google Scholar] [CrossRef] [Green Version]
- Azuara, M.P.; Aparicio, P.J. In vivo blue-light activation of Chlamydomonas reinhardtii. Plant Physiol. 1983, 71, 286–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fernandez, E.; Galvan, A. Inorganic nitrogen assimilation in Chlamydomonas. J. Exp. Bot. 2007, 58, 2279–2287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanz-Luque, E.; Chamizo-Ampudia, A.; Llamas, A.; Galvan, A.; Fernandez, E. Understanding nitrate assimilation and its regulation in microalgae. Front. Plant Sci. 2015, 6, 899. [Google Scholar] [CrossRef] [Green Version]
- Calatrava, V.; Chamizo-Ampudia, A.; Sanz-Luque, E.; Ocaña-Calahorro, F.; Llamas, A.; Fernandez, E.; Galvan, A. How Chlamydomonas handles nitrate and the nitric oxide cycle. J. Exp. Bot. 2017, 68, 2593–2602. [Google Scholar] [CrossRef] [Green Version]
- Higuera, J.J.; Calatrava, V.; González, Z.; Mariscal, V.; Siverio, J.M.; Fernández, E.; Galván, A. NRT2.4 and NRT2.5 are two half-size transporters from the Chlamydomonas NRT2 family. Agronomy 2016, 6, 20. [Google Scholar] [CrossRef] [Green Version]
- Campbell, W.H. Nitrate reductase structure, function and regulation: Bridging the gap between biochemistry and physiology. Annu. Rev. Plant Biol. 1999, 50, 277–303. [Google Scholar] [CrossRef] [Green Version]
- Fischer, K.; Llamas, A.; Tejada-Jimenez, M.; Schrader, N.; Kuper, J.; Ataya, F.S.; Galvan, A.; Mendel, R.R.; Fernandez, E.; Schwarz, G. Function and structure of the molybdenum cofactor carrier protein from Chlamydomonas reinhardtii. J. Biol. Chem. 2006, 281, 30186–30194. [Google Scholar] [CrossRef] [Green Version]
- OECD. Test No. 209: Activated Sludge, Respiration Inhibition Test (Carbon and Ammonium Oxidation). In OECD Guidelines for the Testing of Chemicals, Section 2; OECD Publishing: Paris, France, 2010. [Google Scholar]
- Cataldo, D.A.; Haroon, M.; Schrader, L.E.; Youngs, V.L. Rapid colorimetric determination of nitrate in plant tissue by nitration in salicylic acid. Commun. Soil. Sci. Plant Anal. 1975, 6, 71–80. [Google Scholar] [CrossRef]
- Giovannoni, G.; Land, J.M.; Keir, G.; Thompson, E.J.; Heales, S.J.R. Adaptation of the nitrate reductase and Griess reaction methods for the measurement of serum nitrate plus nitrite levels. Ann. Clin. Biochem. 1998, 34 Pt 2, 193–198. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Light Condition | Growth Medium | Description |
---|---|---|
Blue 50 | TAP-N5 and TAP-N10 | Blue light with 50 µmol m−2 s−1 light intensity |
Blue 25 + Red 25 | TAP-N5 and TAP-N10 | Blue light with 25 µmol m−2 s−1 light intensity + Red light with 25 µmol m−2 s−1 light intensity |
Red 50 | TAP-N5 and TAP-N10 | Red light with 50 µmol m−2 s−1 light intensity |
White 50 | TAP-N5 and TAP-N10 | White light with 50 µmol m−2 s−1 light intensity |
Blue 100 | TAP-N5 and TAP-N10 | Blue light with 100 µmol m−2 s−1 light intensity |
Blue 50 + Red 50 | TAP-N5 and TAP-N10 | Blue light with 50 µmol m−2 s−1 light intensity + Red light with 50 µmol m−2 s−1 light intensity |
Red 100 | TAP-N5 and TAP-N10 | Red light with 100 µmol m−2 s−1 light intensity |
White 100 | TAP-N5 and TAP-N10 | White light with 100 µmol m−2 s−1 light intensity |
Blue 250 | TAP-N5, TAP-N10, and SWW | Blue light with 250 µmol m−2 s−1 light intensity |
Blue 125 + Red 125 | TAP-N5, TAP-N10, and SWW | Blue light with 125 µmol m−2 s−1 light intensity + Red light with 125 µmol m−2 s−1 light intensity |
Red 250 | TAP-N5, TAP-N10, and SWW | Red light with 250 µmol m−2 s−1 light intensity |
White 250 | TAP-N5, TAP-N10, and SWW | White light with 250 µmol m−2 s−1 light intensity |
Gene Name | NCBI Accession Number | Primer (5′→3′) |
---|---|---|
Nitrate Transporter (NRT1) | XM_043061965 | F: AGGCTCTGCCCCTGATAGA R: CCTCCCATCACATTGCAGA |
Nitrate Transporter (NRT2.1) | Z25438 | F: TGAGAAGCCAGCCACAGTAA R: AAGCAAATCCAGGACAGGTG |
Nitrate Transporter (NRT2.2) | Z25439 | F: CCATCTTCGGCCTTATGAAC R: CGTTAGCGAGTTGCTGACCT |
Nitrate reductase (NIA) | AF203033 | F: AGCCGTTGACTTTGACCATG R: GCATGTTCTCCTCCTTGCG |
Molybdenum cofactor (moco) carrier protein (MCP) | AY039706 | F: CATGGCTGGATCTTGCTGAC R: CAGGAAGGACACCGATCGT |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | L27669 | F: ATTGGCCGCCTGGTTATG R: GGTCTTGTGGACCGAGTCAT |
Beta 1 tubulin | M10064 | F: CGCATGATGCTGACCTTCT R: GTCCAGGACCATGCACTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rani, V.; Maróti, G. Light-Dependent Nitrate Removal Capacity of Green Microalgae. Int. J. Mol. Sci. 2023, 24, 77. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24010077
Rani V, Maróti G. Light-Dependent Nitrate Removal Capacity of Green Microalgae. International Journal of Molecular Sciences. 2023; 24(1):77. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24010077
Chicago/Turabian StyleRani, Vaishali, and Gergely Maróti. 2023. "Light-Dependent Nitrate Removal Capacity of Green Microalgae" International Journal of Molecular Sciences 24, no. 1: 77. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24010077