Identification of Key Genes and Regulatory Pathways in Multiple Sclerosis Brain Samples: A Meta-Analysis of Micro-Array Datasets
Abstract
:1. Introduction
2. Results
2.1. Data Collection and Meta-Analysis
2.2. Functional Classification and Pathway Analyses of DEGs
2.3. Unique DEGs Detected from the Meta-Analysis
2.4. Validation of Selected DEGs Using Real-Time Quantitative PCR
3. Discussion
4. Materials and Methods
4.1. Datasets Selection and Pre-Processing of Data
4.2. Meta- and Differential Gene Expression Analysis
4.3. Gene Ontology and Pathway Analysis
4.4. Gene set Variation Analysis
4.5. Human Post-Mortem Brain Tissue
4.6. RNA Isolation and Real-Time Quantitative PCR
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Compston, A.; Coles, A. Multiple sclerosis. Lancet 2008, 372, 1502–1517. [Google Scholar] [CrossRef] [PubMed]
- Ghasemi, N.; Razavi, S.; Nikzad, E. Multiple Sclerosis: Pathogenesis, Symptoms, Diagnoses and Cell-Based Therapy. Cell J. 2017, 19, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Olsson, T.; Barcellos, L.F.; Alfredsson, L. Interactions between genetic, lifestyle and environmental risk factors for multiple sclerosis. Nat. Rev. Neurol. 2017, 13, 25–36. [Google Scholar] [CrossRef] [PubMed]
- Hurwitz, B.J. The diagnosis of multiple sclerosis and the clinical subtypes. Ann. Indian Acad. Neurol. 2009, 12, 226–230. [Google Scholar] [CrossRef] [PubMed]
- Klineova, S.; Lublin, F.D. Clinical Course of Multiple Sclerosis. Cold Spring Harb. Perspect. Med. 2018, 8, a028928. [Google Scholar] [CrossRef] [PubMed]
- Macaron, G.; Ontaneda, D. Diagnosis and Management of Progressive Multiple Sclerosis. Biomedicines 2019, 7, 56. [Google Scholar] [CrossRef] [PubMed]
- Popescu, B.F.; Pirko, I.; Lucchinetti, C.F. Pathology of multiple sclerosis: Where do we stand? Continuum 2013, 19, 901–921. [Google Scholar] [CrossRef]
- Pittock, S.J.; Lucchinetti, C.F. The pathology of MS: New insights and potential clinical applications. Neurologist 2007, 13, 45–56. [Google Scholar] [CrossRef] [PubMed]
- Lassmann, H. Mechanisms of white matter damage in multiple sclerosis. Glia 2014, 62, 1816–1830. [Google Scholar] [CrossRef]
- Levin, M.C.; Douglas, J.N.; Meyers, L.; Lee, S.; Shin, Y.; Gardner, L.A. Neurodegeneration in multiple sclerosis involves multiple pathogenic mechanisms. Degener. Neurol. Neuromuscul. Dis. 2014, 4, 49–63. [Google Scholar] [CrossRef] [PubMed]
- Mey, G.M.; Mahajan, K.R.; DeSilva, T.M. Neurodegeneration in multiple sclerosis. WIREs Mech. Dis. 2023, 15, e1583. [Google Scholar] [CrossRef] [PubMed]
- Chari, D.M. Remyelination In Multiple Sclerosis. Int. Rev. Neurobiol. 2007, 79, 589–620. [Google Scholar]
- Allen, I.V.; McQuaid, S.; Mirakhur, M.; Nevin, G. Pathological abnormalities in the normal-appearing white matter in multiple sclerosis. Neurol. Sci. 2001, 22, 141–144. [Google Scholar] [CrossRef]
- Kirk, J.; Plumb, J.; Mirakhur, M.; McQuaid, S. Tight junctional abnormality in multiple sclerosis white matter affects all calibres of vessel and is associated with blood–brain barrier leakage and active demyelination. J. Pathol. 2003, 201, 319–327. [Google Scholar] [CrossRef]
- Zeis, T.; Graumann, U.; Reynolds, R.; Schaeren-Wiemers, N. Normal-appearing white matter in multiple sclerosis is in a subtle balance between inflammation and neuroprotection. Brain 2008, 131, 288–303. [Google Scholar] [CrossRef]
- Elkjaer, M.L.; Frisch, T.; Reynolds, R.; Kacprowski, T.; Burton, M.; Kruse, T.A.; Thomassen, M.; Baumbach, J.; Illes, Z. Molecular signature of different lesion types in the brain white matter of patients with progressive multiple sclerosis. Acta Neuropathol. Commun. 2019, 7, 205. [Google Scholar] [CrossRef]
- Miedema, A.; Gerrits, E.; Brouwer, N.; Jiang, Q.; Kracht, L.; Meijer, M.; Nutma, E.; Peferoen-Baert, R.; Pijnacker, A.T.E.; Wesseling, E.M.; et al. Brain macrophages acquire distinct transcriptomes in multiple sclerosis lesions and normal appearing white matter. Acta Neuropathol. Commun. 2022, 10, 8. [Google Scholar] [CrossRef] [PubMed]
- Hendrickx, D.A.E.; van Scheppingen, J.; van der Poel, M.; Bossers, K.; Schuurman, K.G.; van Eden, C.G.; Hol, E.M.; Hamann, J.; Huitinga, I. Gene Expression Profiling of Multiple Sclerosis Pathology Identifies Early Patterns of Demyelination Surrounding Chronic Active Lesions. Front. Immunol. 2017, 8, 1810. [Google Scholar] [CrossRef] [PubMed]
- Ramasamy, A.; Mondry, A.; Holmes, C.C.; Altman, D.G. Key issues in conducting a meta-analysis of gene expression microarray datasets. PLoS Med. 2008, 5, e184. [Google Scholar] [CrossRef] [PubMed]
- Taminau, J.; Lazar, C.; Meganck, S.; Nowe, A. Comparison of merging and meta-analysis as alternative approaches for integrative gene expression analysis. ISRN Bioinform. 2014, 2014, 345106. [Google Scholar] [CrossRef]
- Toro-Dominguez, D.; Villatoro-Garcia, J.A.; Martorell-Marugan, J.; Roman-Montoya, Y.; Alarcon-Riquelme, M.E.; Carmona-Saez, P. A survey of gene expression meta-analysis: Methods and applications. Brief Bioinform. 2021, 22, 1694–1705. [Google Scholar] [CrossRef] [PubMed]
- Whitlock, M.C. Combining probability from independent tests: The weighted Z-method is superior to Fisher’s approach. J. Evol. Biol. 2005, 18, 1368–1373. [Google Scholar] [CrossRef] [PubMed]
- Hanzelmann, S.; Castelo, R.; Guinney, J. GSVA: Gene set variation analysis for microarray and RNA-seq data. BMC Bioinform. 2013, 14, 7. [Google Scholar] [CrossRef] [PubMed]
- Sura, P.; Sura, R.; Enayetallah, A.E.; Grant, D.F. Distribution and expression of soluble epoxide hydrolase in human brain. SAGE J. 2008, 56, 950659. [Google Scholar] [CrossRef]
- Lee, H.T.; Lee, K.I.; Chen, C.H.; Lee, T.A.-O. Genetic deletion of soluble epoxide hydrolase delays the progression of Alzheimer’s disease. J. Neuroinflammation 2019, 16, 267. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Hu, X.; Park, J.; Zhu, Y.; Zhu, Q.; Li, H.; Luo, C.; Han, R.; Cooper, N.; Qiu, M. Selective expression of LDLR and VLDLR in myelinating oligodendrocytes. Dev. Dyn. 2007, 236, 2708–2712. [Google Scholar] [CrossRef]
- Melief, J.; Orre, M.; Bossers, K.; van Eden, C.G.; Schuurman, K.G.; Mason, M.R.J.; Verhaagen, J.; Hamann, J.; Huitinga, I. Transcriptome analysis of normal-appearing white matter reveals cortisol- and disease-associated gene expression profiles in multiple sclerosis. Acta Neuropathol. Commun. 2019, 7, 60. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, Y.; Torii, T.; Homma, K.; Oizumi, H.; Ohbuchi, K.; Mizoguchi, K.; Takashima, S.; Yamauchi, J. The adaptor SH2B1 and the phosphatase PTP4A1 regulate the phosphorylation of cytohesin-2 in myelinating Schwann cells in mice. Sci. Signal 2022, 15, eabi5276. [Google Scholar] [CrossRef]
- Yang, H.J.; Vainshtein, A.; Maik-Rachline, G.; Peles, E. G protein-coupled receptor 37 is a negative regulator of oligodendrocyte differentiation and myelination. Nat. Commun. 2016, 7, 10884. [Google Scholar] [CrossRef]
- Keppler-Noreuil, K.M.; Blumhorst, C.; Sapp, J.C.; Brinckman, D.; Johnston, J.; Nopoulos, P.C.; Biesecker, L.G. Brain tissue- and region-specific abnormalities on volumetric MRI scans in 21 patients with Bardet-Biedl syndrome (BBS). BMC Med. Genet. 2011, 12, 101. [Google Scholar] [CrossRef]
- Linneberg, C.; Toft, C.L.F.; Kjaer-Sorensen, K.; Laursen, L.S. L1cam-mediated developmental processes of the nervous system are differentially regulated by proteolytic processing. Sci. Rep. 2019, 9, 3716. [Google Scholar] [CrossRef]
- Lee, N.; Kim, D.; Kim, W.U. Role of NFAT5 in the Immune System and Pathogenesis of Autoimmune Diseases. Front. Immunol. 2019, 10, 270. [Google Scholar] [CrossRef]
- Yang, X.L.; Wang, X.; Peng, B.W. NFAT5 Has a Job in the Brain. Dev. Neurosci. 2018, 40, 289–300. [Google Scholar] [CrossRef] [PubMed]
- Domingues, M.F.; Callai-Silva, N.; Piovesan, A.R.; Carlini, C.R. Soluble Epoxide Hydrolase and Brain Cholesterol Metabolism. Front. Mol. Neurosci. 2019, 12, 325. [Google Scholar] [CrossRef]
- Ahn, K.; Lee, S.J.; Mook-Jung, I. White matter-associated microglia: New players in brain aging and neurodegenerative diseases. Ageing Res. Rev. 2022, 75, 101574. [Google Scholar] [CrossRef]
- Zhou, X.; He, C.; Ren, J.; Dai, C.; Stevens, S.R.; Wang, Q.; Zamler, D.; Shingu, T.; Yuan, L.; Chandregowda, C.R.; et al. Mature myelin maintenance requires Qki to coactivate PPARβ-RXRα-mediated lipid metabolism. J. Clin. Invest. 2020, 130, 2220–2236. [Google Scholar] [CrossRef] [PubMed]
- Berghoff, S.A.; Spieth, L.; Saher, G. Local cholesterol metabolism orchestrates remyelination. Trends Neurosci. 2022, 45, 272–283. [Google Scholar] [CrossRef]
- Elkjaer, M.L.; Röttger, R.; Baumbach, J.; Illes, Z. A Systematic Review of Tissue and Single Cell Transcriptome/Proteome Studies of the Brain in Multiple Sclerosis. Front. Immunol. 2022, 13, 761225. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Argüelles, A.; Méndez-Huerta, M.A.; Lozano, C.D.; Ruiz-Argüelles, G.J. Metabolomic profile of insulin resistance in patients with multiple sclerosis is associated to the severity of the disease. Mult. Scler. Relat. Disord. 2018, 25, 316–321. [Google Scholar] [CrossRef]
- Oliveira, S.R.; Simão, A.N.; Kallaur, A.P.; de Almeida, E.R.; Morimoto, H.K.; Lopes, J.; Dichi, I.; Kaimen-Maciel, D.R.; Reiche, E.M. Disability in patients with multiple sclerosis: Influence of insulin resistance, adiposity, and oxidative stress. Nutrition 2014, 30, 268–273. [Google Scholar] [CrossRef]
- de la Monte, S.M.; Grammas, P. Insulin Resistance and Oligodendrocyte/Microvascular Endothelial Cell Dysfunction as Mediators of White Matter Degeneration in Alzheimer’s Disease. In Alzheimer’s Disease; Wisniewski, T., Ed.; Codon Publications: Brisbane, Australia, 2019. [Google Scholar]
- Bassil, F.; Canron, M.H.; Vital, A.; Bezard, E.; Li, Y.; Greig, N.H.; Gulyani, S.; Kapogiannis, D.; Fernagut, P.O.; Meissner, W.G. Insulin resistance and exendin-4 treatment for multiple system atrophy. Brain 2017, 140, 1420–1436. [Google Scholar] [CrossRef] [PubMed]
- Ewenczyk, A.; Ziplow, J.; Tong, M.; Le, T.; de la Monte, S.M. Sustained Impairments in Brain Insulin/IGF Signaling in Adolescent Rats Subjected to Binge Alcohol Exposures during Development. J. Clin. Exp. Pathol. 2012, 2, 106. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; He, X.; Meng, H.; Li, Y.; Dmitriev, P.; Tian, F.; Page, J.C.; Lu, Q.R.; He, Z. Robust Myelination of Regenerated Axons Induced by Combined Manipulations of GPR17 and Microglia. Neuron 2020, 108, 876–886.e874. [Google Scholar] [CrossRef]
- Bravo, G.; Cedeño, R.R.; Casadevall, M.P.; Ramió-Torrentà, L. Sphingosine-1-Phosphate (S1P) and S1P Signaling Pathway Modulators, from Current Insights to Future Perspectives. Cells 2022, 11, 2058. [Google Scholar] [CrossRef] [PubMed]
- Cartier, A.; Hla, T. Sphingosine 1-phosphate: Lipid signaling in pathology and therapy. Science 2019, 366, eaar5551. [Google Scholar] [CrossRef]
- Calabresi, P.A.; Radue, E.W.; Goodin, D.; Jeffery, D.; Rammohan, K.W.; Reder, A.T.; Vollmer, T.; Agius, M.A.; Kappos, L.; Stites, T.; et al. Safety and efficacy of fingolimod in patients with relapsing-remitting multiple sclerosis (FREEDOMS II): A double-blind, randomised, placebo-controlled, phase 3 trial. Lancet Neurol. 2014, 13, 545–556. [Google Scholar] [CrossRef]
- Kappos, L.; Bar-Or, A.; Cree, B.A.C.; Fox, R.J.; Giovannoni, G.; Gold, R.; Vermersch, P.; Arnold, D.L.; Arnould, S.; Scherz, T.; et al. Siponimod versus placebo in secondary progressive multiple sclerosis (EXPAND): A double-blind, randomised, phase 3 study. Lancet 2018, 391, 1263–1273. [Google Scholar] [CrossRef] [PubMed]
- Kister, A.; Kister, I. Overview of myelin, major myelin lipids, and myelin-associated proteins. Front. Chem. 2022, 10, 1041961. [Google Scholar] [CrossRef] [PubMed]
- Poitelon, Y.; Kopec, A.M.; Belin, S. Myelin Fat Facts: An Overview of Lipids and Fatty Acid Metabolism. Cells 2020, 9, 812. [Google Scholar] [CrossRef] [PubMed]
- Chrast, R.; Saher, G.; Nave, K.A.; Verheijen, M.H. Lipid metabolism in myelinating glial cells: Lessons from human inherited disorders and mouse models. J. Lipid Res. 2011, 52, 419–434. [Google Scholar] [CrossRef]
- Pineda-Torra, I.; Siddique, S.; Waddington, K.E.; Farrell, R.; Jury, E.C. Disrupted Lipid Metabolism in Multiple Sclerosis: A Role for Liver X Receptors? Front. Endocrinol. 2021, 12, 639757. [Google Scholar] [CrossRef] [PubMed]
- van de Kraats, C.; Killestein, J.; Popescu, V.; Rijkers, E.; Vrenken, H.; Lutjohann, D.; Barkhof, F.; Polman, C.H.; Teunissen, C.E. Oxysterols and cholesterol precursors correlate to magnetic resonance imaging measures of neurodegeneration in multiple sclerosis. Mult. Scler. 2014, 20, 412–417. [Google Scholar] [CrossRef]
- Durfinova, M.; Prochazkova, L.; Petrlenicova, D.; Bystricka, Z.; Oresanska, K.; Kuracka, L.; Liska, B. Cholesterol level correlate with disability score in patients with relapsing-remitting form of multiple sclerosis. Neurosci. Lett. 2018, 687, 304–307. [Google Scholar] [CrossRef] [PubMed]
- Uher, T.; Fellows, K.; Horakova, D.; Zivadinov, R.; Vaneckova, M.; Sobisek, L.; Tyblova, M.; Seidl, Z.; Krasensky, J.; Bergsland, N.; et al. Serum lipid profile changes predict neurodegeneration in interferon-beta1a-treated multiple sclerosis patients. J. Lipid Res. 2017, 58, 403–411. [Google Scholar] [CrossRef] [PubMed]
- Weinstock-Guttman, B.; Zivadinov, R.; Horakova, D.; Havrdova, E.; Qu, J.; Shyh, G.; Lakota, E.; O’Connor, K.; Badgett, D.; Tamano-Blanco, M.; et al. Lipid profiles are associated with lesion formation over 24 months in interferon-beta treated patients following the first demyelinating event. J. Neurol. Neurosurg. Psychiatry 2013, 84, 1186–1191. [Google Scholar] [CrossRef] [PubMed]
- Saher, G.; Brugger, B.; Lappe-Siefke, C.; Mobius, W.; Tozawa, R.; Wehr, M.C.; Wieland, F.; Ishibashi, S.; Nave, K.A. High cholesterol level is essential for myelin membrane growth. Nat. Neurosci. 2005, 8, 468–475. [Google Scholar] [CrossRef]
- Hubler, Z.; Allimuthu, D.; Bederman, I.; Elitt, M.S.; Madhavan, M.; Allan, K.C.; Shick, H.E.; Garrison, E.; Molly, T.K.; Factor, D.C.; et al. Accumulation of 8,9-unsaturated sterols drives oligodendrocyte formation and remyelination. Nature 2018, 560, 372–376. [Google Scholar] [CrossRef]
- Yin, J.; Spillman, E.; Cheng, E.S.; Short, J.; Chen, Y.; Lei, J.; Gibbs, M.; Rosenthal, J.S.; Sheng, C.; Chen, Y.X.; et al. Brain-specific lipoprotein receptors interact with astrocyte derived apolipoprotein and mediate neuron-glia lipid shuttling. Nat. Commun. 2021, 12, 2408. [Google Scholar] [CrossRef]
- Cantuti-Castelvetri, L.; Fitzner, D.; Bosch-Queralt, M.; Weil, M.T.; Su, M.; Sen, P.; Ruhwedel, T.; Mitkovski, M.; Trendelenburg, G.; Lutjohann, D.; et al. Defective cholesterol clearance limits remyelination in the aged central nervous system. Science 2018, 359, 684–688. [Google Scholar] [CrossRef]
- Damotte, V.; Guillot-Noel, L.; Patsopoulos, N.A.; Madireddy, L.; El Behi, M.; International Multiple Sclerosis Genetics, C.; Wellcome Trust Case Control, C.; De Jager, P.L.; Baranzini, S.E.; Cournu-Rebeix, I.; et al. A gene pathway analysis highlights the role of cellular adhesion molecules in multiple sclerosis susceptibility. Genes Immun. 2014, 15, 126–132. [Google Scholar] [CrossRef]
- Droogan, A.G.; McMillan, S.A.; Douglas, J.P.; Hawkins, S.A. Serum and cerebrospinal fluid levels of soluble adhesion molecules in multiple sclerosis: Predominant intrathecal release of vascular cell adhesion molecule-1. J. Neuroimmunol. 1996, 64, 185–191. [Google Scholar] [CrossRef]
- Nishihara, H.; Perriot, S.; Gastfriend, B.D.; Steinfort, M.; Cibien, C.; Soldati, S.; Matsuo, K.; Guimbal, S.; Mathias, A.; Palecek, S.P.; et al. Intrinsic blood-brain barrier dysfunction contributes to multiple sclerosis pathogenesis. Brain 2022, 145, 4334–4348. [Google Scholar] [CrossRef] [PubMed]
- Ortiz, G.G.; Pacheco-Moises, F.P.; Macias-Islas, M.A.; Flores-Alvarado, L.J.; Mireles-Ramirez, M.A.; Gonzalez-Renovato, E.D.; Hernandez-Navarro, V.E.; Sanchez-Lopez, A.L.; Alatorre-Jimenez, M.A. Role of the blood-brain barrier in multiple sclerosis. Arch. Med. Res. 2014, 45, 687–697. [Google Scholar] [CrossRef] [PubMed]
- Elazar, N.; Vainshtein, A.; Rechav, K.; Tsoory, M.; Eshed-Eisenbach, Y.; Peles, E. Coordinated internodal and paranodal adhesion controls accurate myelination by oligodendrocytes. J. Cell Biol 2019, 218, 2887–2895. [Google Scholar] [CrossRef] [PubMed]
- Haney, C.A.; Sahenk, Z.; Li, C.; Lemmon, V.P.; Roder, J.; Trapp, B.D. Heterophilic binding of L1 on unmyelinated sensory axons mediates Schwann cell adhesion and is required for axonal survival. J. Cell Biol 1999, 146, 1173–1184. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Fushiki, S.; Kamiguchi, H.; Arnold, B.; Altevogt, P.; Lemmon, V. Disrupted Schwann cell–axon interactions in peripheral nerves of mice with altered L1-integrin interactions. Mol. Cell. Neurosci. 2005, 30, 131–136. [Google Scholar] [CrossRef]
- Mechtersheimer, S.; Gutwein, P.; Agmon-Levin, N.; Stoeck, A.; Oleszewski, M.; Riedle, S.; Postina, R.; Fahrenholz, F.; Fogel, M.; Lemmon, V.; et al. Ectodomain shedding of L1 adhesion molecule promotes cell migration by autocrine binding to integrins. J. Cell Biol. 2001, 155, 661–673. [Google Scholar] [CrossRef]
- Davis, S.; Meltzer, P.S. GEOquery: A bridge between the Gene Expression Omnibus (GEO) and BioConductor. Bioinformatics 2007, 14, 1846–1847. [Google Scholar] [CrossRef]
- Gautier, L.; Cope, L.; Bolstad, B.M.; Irizarry, R.A. Affy-analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 2004, 20, 307–315. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. Limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef]
- Villatoro-García, J.A.; Martorell-Marugán, J.; Toro-Domínguez, D.; Román-Montoya, Y.; Femia, P.; Carmona-Sáez, P. DExMA: An R Package for Performing Gene Expression Meta-Analysis with Missing Genes. Mathematics. 2022, 10, 3376. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef] [PubMed]
- Thomas Broome, S.; Fisher, T.; Faiz, A.; Keay, K.A.; Musumeci, G.; Al-Badri, G.; Castorina, A. Assessing the Anti-Inflammatory Activity of the Anxiolytic Drug Buspirone Using CRISPR-Cas9 Gene Editing in LPS-Stimulated BV-2 Microglial Cells. Cells 2021, 10, 1312. [Google Scholar] [CrossRef] [PubMed]
Top 15 Up-Regulated Genes | ||||
---|---|---|---|---|
Symbol | Stat | Pval | FDR | AveFC |
DOK6 | 2.159879 | 1.54 × 10−2 | 4.91 × 10−2 | 1.669468 |
GPNMB | 4.065861 | 2.39 × 10−5 | 3.15 × 10−4 | 1.58023 |
HOMER1 | 2.621306 | 4.38 × 10−3 | 1.85 × 10−2 | 1.524352 |
SNX10 | 3.492226 | 2.40 × 10−4 | 1.87 × 10−3 | 1.509591 |
FSTL5 | 2.942985 | 1.63 × 10−3 | 8.52 × 10−3 | 1.453001 |
ATRX | 5.076691 | 1.92 × 10−7 | 8.18 × 10−6 | 1.418288 |
IGHM | 2.982941 | 1.43 × 10−3 | 7.68 × 10−3 | 1.402958 |
STK38L | 5.544933 | 1.47 × 10−8 | 1.31 × 10−6 | 1.383691 |
RB1CC1 | 4.329887 | 7.46 × 10−6 | 1.28 × 10−4 | 1.364945 |
PLPPR4 | 2.503236 | 6.15 × 10−3 | 2.41 × 10−2 | 1.350802 |
TRHDE | 2.961552 | 1.53 × 10−3 | 8.14 × 10−3 | 1.333155 |
ZNF184 | 3.273974 | 5.30 × 10−4 | 3.51 × 10−3 | 1.320123 |
VPS13A | 2.325504 | 1.00 × 10−2 | 3.52 × 10−2 | 1.303272 |
PLCXD3 | 3.653899 | 1.29 × 10−4 | 1.16 × 10−3 | 1.294933 |
ESF1 | 6.202506 | 2.78 × 10−10 | 7.22 × 10−8 | 1.293416 |
Top 15 Down-regulated genes | ||||
Symbol | Stat | Pval | FDR | AveFC |
CARNS1 | 4.544461 | 2.75 × 10−6 | 6.09 × 10−5 | −1.96092 |
LDB3 | 5.285667 | 6.26 × 10−8 | 3.69 × 10−6 | −1.79909 |
TMEM63A | 5.921268 | 1.60 × 10−9 | 2.55 × 10−7 | −1.77689 |
MAG | 4.884586 | 5.18 × 10−7 | 1.70 × 10−5 | −1.74786 |
GPIHBP1 | 4.063876 | 2.41 × 10−5 | 3.17 × 10−4 | −1.67791 |
CMTM5 | 4.830894 | 6.80 × 10−7 | 2.09 × 10−5 | −1.64751 |
ZFYVE16 | 2.623818 | 4.35 × 10−3 | 1.84 × 10−2 | −1.62818 |
MOG | 3.347922 | 4.07 × 10−4 | 2.85 × 10−3 | −1.60904 |
OLIG2 | 6.949123 | 1.84 × 10−12 | 1.65 × 10−9 | −1.59546 |
CNDP1 | 2.652296 | 4.00 × 10−3 | 1.72 × 10−2 | −1.59361 |
CDK18 | 7.56455 | 1.95 × 10−14 | 1.14 × 10−10 | −1.58967 |
SLC5A11 | 2.697006 | 3.50 × 10−3 | 1.56 × 10−2 | −1.58249 |
KLK6 | 3.218194 | 6.45 × 10−4 | 4.11 × 10−3 | −1.57037 |
ELOVL1 | 3.35047 | 4.03 × 10−4 | 2.83 × 10−3 | −1.56773 |
CERCAM | 5.915865 | 1.65 × 10−9 | 2.62 × 10−7 | −1.51354 |
Top 15 Up-Regulated Genes | ||||
---|---|---|---|---|
Symbol | Stat | Pval | FDR | AveFC |
BBS7 | 3.507815 | 2.26 × 10−4 | 0.001787 | 1.089201 |
RGS17 | 2.898288 | 1.88 × 10−3 | 0.009556 | 1.042207 |
TNRC6B | 2.655782 | 3.96 × 10−3 | 0.017099 | 1.034418 |
STYK1 | 2.775744 | 2.75 × 10−3 | 0.012905 | 1.031931 |
EPHX4 | 2.36644 | 8.98 × 10−3 | 0.032357 | 0.999705 |
L1CAM | 2.840294 | 2.25 × 10−3 | 0.011056 | 0.911055 |
MFSD4A | 2.591709 | 4.78 × 10−3 | 0.019783 | 0.909036 |
UFL1 | 3.487636 | 2.44 × 10−4 | 0.001901 | 0.90871 |
NFAT5 | 3.960667 | 3.74 × 10−5 | 0.000442 | 0.880825 |
IER5L | 2.431444 | 7.52 × 10−3 | 0.028272 | 0.876896 |
THAP5 | 3.578819 | 1.73 × 10−4 | 0.00146 | 0.874155 |
LRATD1 | 2.224882 | 1.30 × 10−2 | 0.043078 | 0.858158 |
IFT57 | 2.995845 | 1.37 × 10−3 | 0.007434 | 0.852161 |
DMXL2 | 2.36112 | 9.11 × 10−3 | 0.032689 | 0.834282 |
ATP2B1 | 2.917813 | 1.76 × 10−3 | 0.0091 | 0.805719 |
Top 15 Down-regulated genes | ||||
Symbol | Stat | Pval | FDR | AveFC |
CYB5R2 | 2.254104 | 1.21 × 10−2 | 4.06 × 10−2 | −1.20986 |
VGLL1 | 2.62897 | 4.28 × 10−3 | 1.82 × 10−2 | −1.16498 |
SNORC | 2.700465 | 3.46 × 10−3 | 1.54 × 10−2 | −1.06094 |
SS18 | 3.225204 | 6.29 × 10−4 | 4.03 × 10−3 | −1.02363 |
PTP4A1 | 2.885216 | 1.96 × 10−3 | 9.88 × 10−3 | −1.01777 |
GPR37 | 2.553827 | 5.33 × 10−3 | 2.15 × 10−2 | −1.0145 |
NAV2 | 4.894387 | 4.93 × 10−7 | 1.63 × 10−5 | −0.93913 |
VLDLR | 2.282063 | 1.12 × 10−2 | 3.84 × 10−2 | −0.92436 |
YIF1A | 4.376789 | 6.02 × 10−6 | 1.09 × 10−4 | −0.92082 |
SLC35E3 | 2.611671 | 4.51 × 10−3 | 1.89 × 10−2 | −0.8769 |
HSPA2 | 2.945238 | 1.61 × 10−3 | 8.48 × 10−3 | −0.85283 |
DNAJC14 | 2.534753 | 5.63 × 10−3 | 2.25 × 10−2 | −0.83403 |
TRIM27 | 3.574216 | 1.76 × 10−4 | 1.48 × 10−3 | −0.82891 |
TYRO3 | 3.772104 | 8.09 × 10−5 | 8.02 × 10−4 | −0.7971 |
GDE1 | 2.533789 | 5.64 × 10−3 | 2.25 × 10−2 | −0.78212 |
Group | Age (Years) | Place of Birth | Sex | PMI (Hours) | MS Duration (Years) | Lesion Type |
---|---|---|---|---|---|---|
Control | 79 | Australia | Female | 59 | N/A | N/A |
Control | 82 | England | Female | 25 | N/A | N/A |
Control | 83 | Australia | Male | 27 | N/A | N/A |
Control | 73 | Australia | Male | 22 | N/A | N/A |
Control | 73 | Australia | Female | 26.5 | N/A | N/A |
RRMS | 70 | Australia | Male | 21 | 43 | Chronic active |
RRMS | 40 | Australia | Male | 5 | 8 | Chronic active |
RRMS | 72 | Australia | Female | 31 | 20 | Chronic active |
RRMS | 79 | New-Zealand | Female | 24 | 29.5 | Chronic active |
RRMS | 82 | Australia | Female | 19 | 33.1 | Chronic active—minimal regeneration |
SPMS | 57 | Australia | Female | 26.8 | 17.9 | Chronic active—minimal regeneration |
SPMS | 68 | Australia | Female | 15 | 33.5 | Chronic active—minimal regeneration |
SPMS | 69 | New-Zealand | Female | 8.5 | 38 | Chronic active—minimal regeneration |
SPMS | 84 | Australia | Female | 15 | 42 | Chronic active—minimal regeneration |
SPMS | 47 | Australia | Female | 20.8 | 25.8 | Chronic active—minimal regeneration |
SPMS | 55 | Australia | Male | 7 | 40.1 | Chronic active—minimal regeneration |
PPMS | 36 | Australia | Female | 24 | 13 | Chronic active |
PPMS | 83 | Australia | Female | 16 | 16 | Chronic active |
PPMS | 73 | Australia | Male | 25 | 15.6 | Chronic active—moderate regeneration |
PPMS | 73 | England | Male | 24 | 41 | Chronic active—minimal regeneration |
Accession Number | Gene | Primer Sequence (5′-3′) | Length (bp) |
---|---|---|---|
NM_176824.3 | BBS7 | Fwd: CACATCTTGAAAGACTCTATGGC Rev: GCTGCATCGAAGAATGAAATCAA | 151 |
NM_173567.5 | EPHX4 | Fwd: AGATGGCTGAAGTCACAAAGAT Rev: TCACTATGTCAGGTTGGTCTTG | 102 |
NM_001278116.2 | L1CAM | Fwd: AATTTGAGGACAAGGAAATGGC Rev: CTAAAGGTGTAGTGGACATAGGG | 102 |
NM_138714.4 | NFAT5 | Fwd: GAGGACTTGCTGGATAACAGTC Rev: ATCATTGTAGGAACTGGTGCTC | 135 |
NM_001302826.2 | CYB5R2 | Fwd: TGCCCTTGATTGAGAAAGAGAAA Rev: ATAGTTACCTACAGGAAGCCCTA | 101 |
NM_003463.5 | PTP4A1 | Fwd: CTGTATTTGGAGAAGTATCGTCCT Rev: AGTTGTTTCTATGACCGTTGGA | 70 |
NM_005302.5 | GPR37 | Fwd: GCCAAACTTGCTGTTATATGGG Rev: ATGGTGTCTGGTAAATCAGGAG | 152 |
NM_022551.2 | S18 | Fwd: GAGGATGAGGTGGAACGTGT Rev: GGACCTGGCTGTATTTTCCA | 115 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jansen, M.I.; Castorina, A. Identification of Key Genes and Regulatory Pathways in Multiple Sclerosis Brain Samples: A Meta-Analysis of Micro-Array Datasets. Int. J. Mol. Sci. 2023, 24, 9361. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119361
Jansen MI, Castorina A. Identification of Key Genes and Regulatory Pathways in Multiple Sclerosis Brain Samples: A Meta-Analysis of Micro-Array Datasets. International Journal of Molecular Sciences. 2023; 24(11):9361. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119361
Chicago/Turabian StyleJansen, Margo I., and Alessandro Castorina. 2023. "Identification of Key Genes and Regulatory Pathways in Multiple Sclerosis Brain Samples: A Meta-Analysis of Micro-Array Datasets" International Journal of Molecular Sciences 24, no. 11: 9361. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119361