Detection of Antibiotic Resistance in Feline-Origin ESBL Escherichia coli from Different Areas of China and the Resistance Elimination of Garlic Oil to Cefquinome on ESBL E. coli
Abstract
:1. Introduction
2. Results
2.1. Samples and E. coli Isolates
2.2. Antibiotic Susceptibility Testing and ESBL Confirmatory Test
2.3. Synergistic Effect of Garlic Oil in Combination with Cefquinome
2.4. Garlic Oil Enhanced Effects of Cefquinome on Killing ESBL E. coli
2.5. Garlic Oil Enhances the Ability of Cefquinome to Inhibit Growth of ESBL E. coli
2.6. Garlic Oil Restores the Sensitivity of ESBL E. coli to Cefquinome
2.7. Effects of Garlic Oil Combined with Cefquinome on Membrane Destruction
2.8. Scanning Electron Microscope (SEM)
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Bacterial Isolation and Molecular Confirmation
4.3. Antibiotic Susceptibility Testing
4.4. ESBL Confirmatory Test
4.5. Checkerboard Assay
4.6. Time-Kill Curves
4.7. Growth Curves
4.8. Drug-Resistance Curves
4.9. PI Staining and NPN Staining
4.10. Scanning Electron Microscope (SEM)
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners. Braz. J. Microbiol. 2016, 47, 150–158. [Google Scholar] [CrossRef] [PubMed]
- Jang, J.; Hur, H.G.; Sadowsky, M.J.; Byappanahalli, M.N.; Yan, T.; Ishii, S. Environmental Escherichia coli: Ecology and public health implications—A review. J. Appl. Microbiol. 2017, 123, 570–581. [Google Scholar] [CrossRef] [PubMed]
- Rybolt, L.E.; Sabunwala, S.; Greene, J.N. Zoonotic bacterial respiratory infections associated with cats and dogs: A case series and literature review. Cureus 2022, 14, e24414. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Liu, Z.; Zhang, Y.; Zhang, Z.; Lei, L.; Xia, Z. Increasing prevalence of ESBL-producing multidrug resistance Escherichia coli from diseased pets in Beijing, China from 2012 to 2017. Front. Microbiol. 2019, 10, 2852. [Google Scholar] [CrossRef]
- Tamma, P.D.; Aitken, S.L.; Bonomo, R.A.; Mathers, A.J.; van Duin, D.; Clancy, C.J. Infectious Diseases Society of America Guidance on the Treatment of Extended-Spectrum β-lactamase Producing Enterobacterales (ESBL-E), Carbapenem-Resistant Enterobacterales (CRE), and Pseudomonas aeruginosa with Difficult-to-Treat Resistance (DTR-P. aeruginosa). Clin. Infect. Dis. 2021, 72, e169–e183. [Google Scholar] [CrossRef]
- Porras, G.; Chassagne, F.; Lyles, J.T.; Marquez, L.; Dettweiler, M.; Salam, A.M. Ethnobotany and the role of plant natural products in antibiotic drug discovery. Chem. Rev. 2021, 121, 3495–3560. [Google Scholar] [CrossRef]
- Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance. Microbiol. Spectr. 2016, 4, 10. [Google Scholar] [CrossRef]
- Christaki, E.; Marcou, M.; Tofarides, A. Antimicrobial resistance in bacteria: Mechanisms, evolution, and persistence. J. Mol. Evol. 2020, 88, 26–40. [Google Scholar] [CrossRef]
- Oyedemi, B.O.; Shinde, V.; Shinde, K.; Kakalou, D.; Stapleton, P.D.; Gibbons, S. Novel R-plasmid conjugal transfer inhibitory and antibacterial activities of phenolic compounds from Mallotus philippensis (Lam.). Mull. Arg. J. Glob. Antimicrob. Resist. 2016, 5, 15–21. [Google Scholar] [CrossRef]
- Qu, S.; Dai, C.; Shen, Z.; Tang, Q.; Wang, H.; Zhai, B.; Zhao, L.; Hao, Z. Mechanism of synergy between tetracycline and quercetin against antibiotic resistant Escherichia coli. Front. Microbiol. 2019, 10, 2536. [Google Scholar] [CrossRef]
- Shi, C.; Bao, J.; Sun, Y.; Kang, X.; Lao, X.; Zheng, H. Discovery of Baicalin as NDM-1 inhibitor: Virtual screening, biological evaluation and molecular simulation. Bioorg. Chem. 2019, 88, 102953. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.Y.; Yuan, M.; Wu, Z.M.; Song, K.; Zhang, C.L.; An, Q. Anti-bacterial activity of baicalin against APEC through inhibition of quorum sensing and inflammatory responses. Sci. Rep. 2019, 9, 4063. [Google Scholar] [CrossRef] [PubMed]
- Hwang, D.; Lim, Y.H. Resveratrol controls Escherichia coli growth by inhibiting the AcrAB-TolC efflux pump. FEMS Microbiol. Lett. 2019, 366, fnz030. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Qu, Z.; Song, A.; Yang, J.; Yu, J.; Zhang, W.; Zhuang, C. Garlic oil blocks tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)-induced lung tumorigenesis by inducing phase II drug-metabolizing enzymes. Food Chem. Toxicol. 2021, 157, 112581. [Google Scholar] [CrossRef]
- Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Hsu, C.N. Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease. Nutrients 2022, 14, 4624. [Google Scholar] [CrossRef] [PubMed]
- Kuna, L.; Zjalic, M.; Kizivat, T.; Roguljic, H.; Nincevic, V.; Omanovic Kolaric, T.; Wu, C.H.; Vcev, A.; Smolic, M.; Smolic, R. Pretreatment of Garlic Oil Extracts Hampers Epithelial Damage in Cell Culture Model of Peptic Ulcer Disease. Medicina 2022, 58, 91. [Google Scholar] [CrossRef]
- Liu, M.; Pan, Y.; Feng, M.; Guo, W.; Fan, X.; Feng, L.; Huang, J.; Cao, Y. Garlic essential oil in water nanoemulsion prepared by high-power ultrasound: Properties, stability and its antibacterial mechanism against MRSA isolated from pork. Ultrason. Sonochem. 2022, 90, 106201. [Google Scholar] [CrossRef]
- Ashrit, P.; Sadanandan, B.; Shetty, K.; Vaniyamparambath, V. Polymicrobial Biofilm Dynamics of Multidrug-Resistant Candida albicans and Ampicillin-Resistant Escherichia coli and Antimicrobial Inhibition by Aqueous Garlic Extract. Antibiotics 2022, 11, 573. [Google Scholar] [CrossRef]
- Jinno, C.; Kim, K.; Wong, B.; Wall, E.; Sripathy, R.; Liu, Y. Dietary Supplementation with Botanical Blends Modified Intestinal Microbiota and Metabolomics of Weaned Pigs Experimentally Infected with Enterotoxigenic Escherichia coli. Microorganisms 2023, 11, 320. [Google Scholar] [CrossRef]
- Tong, Y.C.; Zhang, Y.N.; Li, P.C.; Cao, Y.L.; Ding, D.Z.; Yang, Y.; Lin, Q.Y.; Gao, Y.N.; Sun, S.Q.; Fan, Y.P.; et al. Detection of antibiotic-resistant canine origin Escherichia coli and the synergistic effect of magnolol in reducing the resistance of multidrug-resistant Escherichia coli. Front. Vet. Sci. 2023, 10, 1104812. [Google Scholar] [CrossRef]
- Liao, K.; Chen, Y.; Wang, M.; Guo, P.; Yang, Q.; Ni, Y. Molecular characteristics of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae causing intra-abdominal infections from 9 tertiary hospitals in China. Diagn. Microbiol. Infect. Dis. 2017, 87, 45–48. [Google Scholar] [CrossRef] [PubMed]
- Chong, Y.; Shimoda, S.; Shimono, N. Current epidemiology, genetic evolution and clinical impact of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Infect. Genet. Evol. 2018, 61, 185–188. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zeng, Z.; Chen, S.; Ma, J.; He, L.; Liu, Y.; Deng, Y.; Lei, T.; Zhao, J.; Liu, J.H. High prevalence of bla(CTX-M) extended-spectrum β-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China. Clin. Microbiol. Infect. 2010, 16, 1475–1481. [Google Scholar] [CrossRef]
- Sun, L.; Meng, N.; Wang, Z.; Hong, J.; Dai, Y.; Wang, Z.; Wang, J.; Jiao, X. Genomic Characterization of ESBL/AmpC-Producing Escherichia coli in Stray Dogs Sheltered in Yangzhou, China. Infect. Drug Resist. 2022, 15, 7741–7750. [Google Scholar] [CrossRef]
- Zhou, Y.; Ji, X.; Liang, B.; Jiang, B.; Li, Y.; Yuan, T. Antimicrobial resistance and prevalence of extended spectrum β-lactamase-producing Escherichia coli from dogs and cats in northeastern China from 2012 to 2021. Antibiotics 2022, 11, 1506. [Google Scholar] [CrossRef]
- Gruel, G.; Couvin, D.; Guyomard-Rabenirina, S.; Arlet, G.; Bambou, J.C.; Pot, M.; Roy, X.; Talarmin, A.; Tressieres, B.; Ferdinand, S.; et al. High Prevalence of blaCTXM-1/IncI1-Iγ/ST3 Plasmids in Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates Collected From Domestic Animals in Guadeloupe (French West Indies). Front. Microbiol. 2022, 13, 882422. [Google Scholar] [CrossRef] [PubMed]
- Dazio, V.; Nigg, A.; Schmidt, J.S.; Brilhante, M.; Mauri, N.; Kuster, S.P.; Brawand, S.G.; Schüpbach-Regula, G.; Willi, B.; Endimiani, A.; et al. Acquisition and carriage of multidrug-resistant organisms in dogs and cats presented to small animal practices and clinics in Switzerland. J. Vet. Intern. Med. 2021, 35, 970–979. [Google Scholar] [CrossRef] [PubMed]
- Silva, M.M.; Sellera, F.P.; Fernandes, M.R.; Moura, Q.; Garino, F.; Azevedo, S.S.; Lincopan, N. Genomic features of a highly virulent, ceftiofur-resistant, CTX-M-8-producing Escherichia coli ST224 causing fatal infection in a domestic cat. J. Glob. Antimicrob. Resist. 2018, 15, 252–253. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Lin, R.; Zhou, Z.; Ma, J.; Lin, H.; Zheng, X. Antimicrobial resistance and genomic characterization of Escherichia coli from pigs and chickens in Zhejiang, China. Front. Microbiol. 2022, 13, 1018682. [Google Scholar] [CrossRef] [PubMed]
- Hordijk, J.; Schoormans, A.; Kwakernaak, M.; Duim, B.; Broens, E.; Dierikx, C.; Mevius, D.; Wagenaar, J.A. High prevalence of fecal carriage of extended spectrum β-lactamase/AmpC-producing Enterobacteriaceae in cats and dogs. Front. Microbiol. 2013, 4, 242. [Google Scholar] [CrossRef]
- Ortiz-Díez, G.; Mengíbar, R.L.; Turrientes, M.C.; Artigao, M.B.; Gallifa, R.L.; Tello, A.M.; Pérez, C.F.; Santiago, T.A. Prevalence, incidence and risk factors for acquisition and colonization of extended-spectrum beta-lactamase- and carbapenemase-producing Enterobacteriaceae from dogs attended at a veterinary hospital in Spain. Comp. Immunol. Microbiol. Infect. Dis. 2023, 92, 101922. [Google Scholar] [CrossRef]
- Schmidt, V.M.; Pinchbeck, G.L.; Nuttall, T.; McEwan, N.; Dawson, S.; Williams, N.J. Antimicrobial resistance risk factors and characterisation of faecal E. coli isolated from healthy Labrador retrievers in the United Kingdom. Prev. Vet. Med. 2015, 119, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Qekwana, D.N.; Phophi, L.; Naidoo, V.; Oguttu, J.W.; Odoi, A. Antimicrobial resistance among Escherichia coli isolates from dogs presented with urinary tract infections at a veterinary teaching hospital in South Africa. BMC Vet. Res. 2018, 14, 228. [Google Scholar] [CrossRef] [PubMed]
- Tudu, R.; Banerjee, J.; Habib, M.; Bandyopadhyay, S.; Biswas, S.; Kesh, S.S.; Maity, A.; Batabyal, S.; Polley, S. Prevalence and molecular characterization of extended-spectrum β-lactamase (ESBL) producing Escherichia coli isolated from dogs suffering from diarrhea in and around Kolkata. Iran. J. Vet. Res. 2022, 23, 237–246. [Google Scholar] [CrossRef] [PubMed]
- Habibzadeh, N.; Peeri Doghaheh, H.; Manouchehri Far, M.; Alimohammadi Asl, H.; Iranpour, S.; Arzanlou, M. Fecal Carriage of Extended-Spectrum β-Lactamases and pAmpC Producing Enterobacterales in an Iranian Community: Prevalence, Risk Factors, Molecular Epidemiology, and Antibiotic Resistance. Microb. Drug Resist. 2022, 28, 921–934. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fernández, R.; Durán, I.; Molina-López, R.A.; Darwich, L. Antimicrobial Resistance in Bacteria Isolated from Cats and Dogs From the Iberian Peninsula. Front. Microbiol. 2021, 11, 621597. [Google Scholar] [CrossRef]
- Carvalho, I.; Safia Chenouf, N.; Cunha, R.; Martins, C.; Pimenta, P.; Pereira, A.R.; Martínez-Álvarez, S.; Ramos, S.; Silva, V.; Igrejas, G.; et al. Antimicrobial Resistance Genes and Diversity of Clones among ESBL- and Acquired AmpC-Producing Escherichia coli Isolated from Fecal Samples of Healthy and Sick Cats in Portugal. Antibiotics 2021, 10, 262. [Google Scholar] [CrossRef]
- Liu, X.; Thungrat, K.; Boothe, D.M. Occurrence of OXA-48 Carbapenemase and Other β-Lactamase Genes in ESBL-Producing Multidrug Resistant Escherichia coli from Dogs and Cats in the United States, 2009–2013. Front. Microbiol. 2016, 7, 1057. [Google Scholar] [CrossRef]
- McDanel, J.; Schweizer, M.; Crabb, V.; Nelson, R.; Samore, M.; Khader, K. Incidence of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli and Klebsiella infections in the United States: A systematic literature review. Infect. Control Hosp. Epidemiol. 2017, 38, 1209–1215. [Google Scholar] [CrossRef]
- Avato, P.; Tursil, E.; Vitali, C.; Miccolis, V.; Candido, V. Allylsulfide constituents of garlic volatile oil as antimicrobial agents. Phytomedicine 2000, 7, 239–243. [Google Scholar] [CrossRef]
- Piletti, R.; Zanetti, M.; Jung, G.; de Mello, J.M.M.; Dalcanton, F.; Soares, C.; Riella, H.G.; Fiori, M.A. Microencapsulation of garlic oil by β-cyclodextrin as a thermal protection method for antibacterial action. Mater. Sci. Eng. C Mater. Biol. Appl. 2019, 94, 139–149. [Google Scholar] [CrossRef]
- Rodjan, P.; Wattanasit, S.; Thongprajukaew, K.; Faroongsarng, D. Effect of dietary coated granules containing garlic oil diallyl disulphide and diallyl trisulphide on performance, in vitro digestibility and gastrointestinal functionality in laying hens. J. Anim. Physiol. Anim. Nutr. 2022, 106, 118–131. [Google Scholar] [CrossRef]
- Sielaff, H.; Duncan, T.M.; Börsch, M. The regulatory subunit ε in Escherichia coli FOF1-ATP synthase. Biochim. Biophys. Acta Bioenerg. 2018, 1859, 775–788. [Google Scholar] [CrossRef] [PubMed]
- Lakhani, M.; Azim, S.; Akhtar, S.; Ahmad, Z. Inhibition of Escherichia coli ATP synthase and cell growth by dietary pomegranate phenolics. Int. J. Biol. Macromol. 2022, 213, 195–209. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Zhu, H.; Chen, Y.; Yang, Y. Antibacterial pathway of cefquinome against Staphylococcus aureus based on label-free quantitative proteomics analysis. J. Microbiol. 2021, 59, 1112–1124. [Google Scholar] [CrossRef] [PubMed]
- Thakur, P.; Chawla, R.; Tanwar, A.; Chakotiya, A.S.; Narula, A.; Goel, R.; Arora, R.; Sharma, R.K. Attenuation of adhesion, quorum sensing and biofilm mediated virulence of carbapenem resistant Escherichia coli by selected natural plant products. Microb. Pathog. 2016, 92, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Liu, X.; Li, J.; Zhang, Q.; Li, X.; An, Q.; Ye, X.; Zhao, Z.; Cai, L.; Han, Y.; et al. Antibacterial mechanism of the synergistic combination between streptomycin and alcohol extracts from the Chimonanthus salicifolius S. Y. Hu. leaves. J. Ethnopharmacol. 2020, 250, 112467. [Google Scholar] [CrossRef]
- Yi, K.; Liu, S.; Liu, P.; Luo, X.; Zhao, J.; Yan, F.; Pan, Y.; Liu, J.; Zhai, Y.; Hu, G. Synergistic antibacterial activity of tetrandrine combined with colistin against MCR-mediated colistin-resistant Salmonella. Biomed. Pharmacother. 2022, 149, 112873. [Google Scholar] [CrossRef]
- Cortinovis, C.; Caloni, F. Household Food Items Toxic to Dogs and Cats. Front. Vet. Sci. 2016, 3, 26. [Google Scholar] [CrossRef]
- Kaye, A.D.; Nossaman, B.D.; Ibrahim, I.N.; Feng, C.J.; McNamara, D.B.; Agrawal, K.C.; Kadowitz, P.J. Analysis of responses of allicin, a compound from garlic, in the pulmonary vascular bed of the cat and in the rat. Eur. J. Pharmacol. 1995, 276, 21–26. [Google Scholar] [CrossRef]
- Saki, M.; Amin, M.; Savari, M.; Hashemzadeh, M.; Seyedian, S.S. Beta-lactamase determinants and molecular typing of carbapenem-resistant classic and hypervirulent Klebsiella pneumoniae clinical isolates from southwest of Iran. Front. Microbiol. 2022, 13, 9686. [Google Scholar] [CrossRef]
- Srivastava, S.; Singh, V.; Kumar, V.; Verma, P.C.; Srivastava, R.; Basu, V. Identification of regulatory elements in 16S rRNA gene of Acinetobacter species isolated from water sample. Bioinformation 2008, 3, 173–176. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Chen, W.; Zhou, R.; Yang, J.; Wu, Y.; Zheng, J. Characteristics of the plasmid-mediated colistin-resistance gene mcr-1 in Escherichia coli isolated from a veterinary hospital in Shanghai. Front. Microbiol. 2022, 13, 2827. [Google Scholar] [CrossRef] [PubMed]
- Dierikx, C.M.; van Duijkeren, E.; Schoormans, A.H.; van Essen-Zandbergen, A.; Veldman, K.; Kant, A.; Huijsdens, X.W.; van der Zwaluw, K.; Wagenaar, J.A.; Mevius, D.J. Occurrence and characteristics of extended-spectrum-β-lactamase- and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother. 2012, 67, 1368–1374. [Google Scholar] [CrossRef]
- Antimicrobial Susceptibility Testing System; European Committee on Antimicrobial Susceptibility Testing; Peking Union Medical College Press: Beijing, China, 2022.
- Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023.
- Vilaró, A.; Novell, E.; Enrique-Tarancon, V.; Balielles, J.; Migura-García, L.; Fraile, L. Antimicrobial susceptibility testing of porcine bacterial pathogens: Investigating the prospect of testing a representative drug for each antimicrobial family. Antibiotics 2022, 11, 638. [Google Scholar] [CrossRef]
- Kojima, A.; Ishii, Y.; Ishihara, K.; Esaki, H.; Asai, T.; Oda, C.; Tamura, Y.; Takahashi, T.; Yamaguchi, K. Extended-spectrum-beta-lactamase-producing Escherichia coli strains isolated from farm animals from 1999 to 2002: Report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. Antimicrob. Agents Chemother. 2005, 49, 3533–3537. [Google Scholar] [CrossRef]
- Briñas, L.; Moreno, M.A.; Zarazaga, M.; Porrero, C.; Sáenz, Y.; García, M.; Dominguez, L.; Torres, C. Detection of CMY-2, CTX-M-14, and SHV-12 beta-lactamases in Escherichia coli fecal-sample isolates from healthy chickens. Antimicrob. Agents Chemother. 2003, 47, 2056–2058. [Google Scholar] [CrossRef]
- Gundran, R.S.; Cardenio, P.A.; Villanueva, M.A.; Sison, F.B.; Benigno, C.C.; Kreausukon, K.; Pichpol, D.; Punyapornwithaya, V. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended- spectrum β- lactamase- producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res. 2019, 15, 227. [Google Scholar] [CrossRef]
- Ibrahim, D.R.; Dodd, C.E.R.; Stekel, D.J.; Meshioye, R.T.; Diggle, M.; Lister, M.; Hobman, J.L. Multidrug-Resistant ESBL-Producing E. coli in Clinical Samples from the UK. Antibiotics 2023, 12, 169. [Google Scholar] [CrossRef]
- El-Badawy, M.F.; Tawakol, W.M.; Maghrabi, I.A.; Mansy, M.S.; Shohayeb, M.M.; Ashour, M.S. Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates of E. coli Fingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence of E. coli O25b-ST131clone Harboring blaGES. Microb. Drug Resist. 2017, 23, 703–717. [Google Scholar] [CrossRef]
- El Aila, N.A.; Al Laham, N.A.; Ayesh, B.M. Prevalence of extended spectrum beta lactamase and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Gram negative bacilli isolates from pediatric patient population in Gaza strip. BMC Infect. Dis. 2023, 23, 99. [Google Scholar] [CrossRef]
- Bradford, P.A. Extended-spectrum beta-lactamases in the 21st century: Characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 2001, 14, 933–951. [Google Scholar] [CrossRef] [PubMed]
- Draper, L.A.; Cotter, P.D.; Hill, C.; Ross, R.P. The two peptide lantibiotic lacticin 3147 acts synergistically with polymyxin to inhibit Gram negative bacteria. BMC Microbiol. 2013, 13, 212. [Google Scholar] [CrossRef]
- Wang, Y.M.; Kong, L.C.; Liu, J.; Ma, H.X. Synergistic effect of eugenol with Colistin against clinical isolated Colistin-resistant Escherichia coli strains. Antimicrob. Resist. Infect. Control 2018, 7, 17. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Jia, Y.; Yang, K.; Li, R.; Xiao, X.; Zhu, K. Metformin restores tetracyclines susceptibility against multidrug resistant bacteria. Adv. Sci. 2020, 7, 1902227. [Google Scholar] [CrossRef] [PubMed]
ESBL Genes Group | Isolates | Type | ESBL Genes Group | Isolates | Type |
---|---|---|---|---|---|
CTX-M-1 | GZ8 | CTX-M-1 | CTX-M-9 | LZ2-7 | CTX-M-27 |
KM1 | CTX-M-1 | LZ2-8 | CTX-M-14 | ||
KM2 | CTX-M-1 | LZ2-9 | CTX-M-104 | ||
LZ2-6 | CTX-M-15 | SH2 | CTX-M-14 | ||
QP4 | CTX-M-1 | SY13 | CTX-M-14 | ||
SH3 | CTX-M-254 | SY14 | CTX-M-14 | ||
SY10 | CTX-M-230 | SY16 | CTX-M-14 | ||
SY12 | CTX-M-1 | SY18 | CTX-M-14 | ||
SY13 | CTX-M-1 | SY19 | CTX-M-14 | ||
SY20 | CTX-M-1 | SY20 | CTX-M-27 | ||
SY22 | CTX-M-1 | SY22 | CTX-M-14 | ||
SY3 | CTX-M-230 | ZZ1-1 | CTX-M-14 | ||
SY4 | CTX-M-15 | ZZ3 | CTX-M-14 | ||
SY5 | CTX-M-1 | ZZ5 | CTX-M-27 | ||
SY6 | CTX-M-1 | ZZ6 | CTX-M-14 | ||
SY7 | CTX-M-1 | TEM | LZ2-6 | TEM-116 | |
SY8 | CTX-M-1 | SY13 | TEM-116 | ||
SY9 | CTX-M-230 | SY14 | TEM-116 | ||
TS5-2 | CTX-M-15 | SY16 | TEM-116 | ||
TS6 | CTX-M-1 | SY18 | TEM-116 | ||
TS7 | CTX-M-1 | SY19 | TEM-116 | ||
TS8-2 | CTX-M-15 | SY4 | TEM-116 | ||
ZZ4 | CTX-M-1 | SY9 | TEM-116 | ||
ZZ7-1 | CTX-M-1 | TS8-1 | TEM-116 | ||
ZZ8 | CTX-M-1 | ||||
ZZ9 | CTX-M-1 |
Strain | MIC (Alone)/μg/mL | MIC (Combined)/μg/mL | FICI | Outcome | ||
---|---|---|---|---|---|---|
Garlic Oil | Cefquinome | Garlic Oil | Cefquinome | |||
ATCC® 25922TM | 512 | 0.5 | 128 | 0.125 | 0.5 | Synergy |
ZZ4 | 1024 | 2048 | 128 | 128 | 0.1875 | Synergy |
ZZ7-1 | 512 | 256 | 32 | 128 | 0.5625 | Additive effect |
ZZ8 | 512 | 256 | 256 | 64 | 0.75 | Additive effect |
ZZ9 | 512 | 2048 | 256 | 256 | 0.625 | Additive effect |
TS5-2 | 512 | 256 | 64 | 32 | 0.25 | Synergy |
TS6 | 512 | 1024 | 64 | 256 | 0.375 | Synergy |
TS7 | 1024 | 2048 | 128 | 128 | 0.1875 | Synergy |
GZ8 | 512 | 1024 | 64 | 256 | 0.375 | Synergy |
SY4 | 128 | 512 | 32 | 32 | 0.3125 | Synergy |
SY9 | 1024 | 8 | 512 | 2 | 0.75 | Additive effect |
SY18 | 1024 | 8 | 256 | 2 | 0.5 | Synergy |
SY19 | 512 | 16 | 128 | 2 | 0.375 | Synergy |
SH2 | 1024 | 256 | 32 | 64 | 0.28125 | Synergy |
LZ2-3 | 512 | 1024 | 64 | 128 | 0.25 | Synergy |
GZ8 | 1024 | 2048 | 256 | 512 | 0.5 | Synergy |
KM1 | 2048 | 256 | 256 | 128 | 0.625 | Additive effect |
Gene | Sequence of Primer (5′~3′) | Size of Product/bp | Tm/°C | Reference |
---|---|---|---|---|
16s rDNA | F:AGAGTTTGATCCTGGCTCAG | 306 | 55.0 | [19,20] |
R: CTTGTGCGGGCCCCCGTCAATTC | ||||
CTX-M Family | F-ATGTGCAGYACCAGTAARGTKATGGC | 592 | 55.0 | [52] |
R-TGGGTRAARTARGTSACCAGAAYSAGCGG | ||||
CTX-M-1 Group | F-ACCGCGATATCGTTGGT | 550 | 55.0 | [54] |
R-CGCTTTGCGATGTGCAG | ||||
CTX-M-2 Group | F-ATGATGACTCAGAGCATTCG | 856 | 55.0 | [53] |
R-TCAGAAACCGTGGGTTACGA | ||||
CTX-M-8 | F-GTGACAAAGAGAGTGCAACGG | 666 | 52.0 | [55] |
R-ATGATTCTCGCCGCTGAAGCC | ||||
CTX-M-9 Group | F-GCACGATGACATTCGGG | 857 | 52.0 | [56] |
R-AACCCACGATGTGGGTAGC | ||||
TEM Group | F-ATGAGTATTCAACATTTCCG | 858 | 55.0 | [54] |
R-CCAATGCTTAATCAGTGAGG | ||||
SHV Group | F-ATGAGTATTCAACATTTTCG | 841 | 55.0 | [53] |
R-TTACCAATGCTTAATCAGTG | ||||
OXA-1 | F-ATGCGTTATATTCGCCTGTG | 820 | 55.0 | [52,57] |
R-TTAGCGTTGCCAGTGCTCGA | ||||
OXA-2 | F-ATGAAAAACACAATACATATCAACTTCGC | 601 | 55.0 | [52,57] |
R-GTGTGTTTAGAATGGTGATCGCATT | ||||
OXA-10 | F-ACGATAGTTGTGGCAGACGAAC | 277 | 55.0 | [54] |
R-ATYCTGTTTGGCGTATCRATATTC |
FICI | Meaning |
---|---|
FICI ≤ 0.5 | Synergistic effect |
0.5 < FICI ≤ 0.75 | Partial synergistic effect |
0.75 < FICI ≤ 1 | Additive effect |
1 < FICI ≤ 4 | Indifferent effect |
FICI > 4 | Antagonism |
Group | Incubation Time/h | Isolates | Dilution Ratio |
---|---|---|---|
Positive control | 0 | TS7, ZZ4 and SH2 | 105 |
2 | TS7, ZZ4 and SH2 | 105 | |
4 | TS7, ZZ4 and SH2 | 107 | |
6 | TS7, ZZ4 and SH2 | 109 | |
8 | TS7, ZZ4 and SH2 | 109 | |
24 | TS7, ZZ4 and SH2 | 109 | |
CEF | 0 | TS7, ZZ4 and SH2 | 105 |
2 | TS7, ZZ4 and SH2 | 105 | |
4 | TS7 and ZZ4 | 106 | |
SH2 | 104 | ||
6 | TS7 and ZZ4 | 106 | |
SH2 | 104 | ||
8 | TS7 and ZZ4 | 109 | |
SH2 | 107 | ||
24 | TS7 and ZZ4 | 106 | |
SH2 | 105 | ||
GAR | 0 | TS7, ZZ4 and SH2 | 105 |
2 | TS7, ZZ4 and SH2 | 105 | |
4 | TS7, ZZ4 and SH2 | 105 | |
6 | TS7, ZZ4 and SH2 | 105 | |
8 | TS7, ZZ4 and SH2 | 105 | |
24 | TS7, ZZ4 and SH2 | 106 | |
COM (low) | 0 | TS7, ZZ4 and SH2 | 105 |
2 | TS7 and ZZ4 | 105 | |
SH2 | 104 | ||
4 | TS7 and ZZ4 | 104 | |
SH2 | 103 | ||
6 | TS7 and SH2 | 103 | |
ZZ4 | 104 | ||
8 | TS7 and SH2 | 103 | |
ZZ4 | 104 | ||
24 | TS7 and SH2 | 103 | |
ZZ4 | 104 | ||
COM (high) | 0 | TS7, ZZ4 and SH2 | 106 |
2 | TS7, ZZ4 and SH2 | 104 | |
4 | TS7, ZZ4 and SH2 | 101 | |
6 | TS7, ZZ4 and SH2 | 100 | |
8 | TS7, ZZ4 and SH2 | 100 | |
24 | TS7, ZZ4 and SH2 | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, Y.-C.; Li, P.-C.; Yang, Y.; Lin, Q.-Y.; Liu, J.-T.; Gao, Y.-N.; Zhang, Y.-N.; Jin, S.; Qing, S.-Z.; Xing, F.-S.; et al. Detection of Antibiotic Resistance in Feline-Origin ESBL Escherichia coli from Different Areas of China and the Resistance Elimination of Garlic Oil to Cefquinome on ESBL E. coli. Int. J. Mol. Sci. 2023, 24, 9627. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119627
Tong Y-C, Li P-C, Yang Y, Lin Q-Y, Liu J-T, Gao Y-N, Zhang Y-N, Jin S, Qing S-Z, Xing F-S, et al. Detection of Antibiotic Resistance in Feline-Origin ESBL Escherichia coli from Different Areas of China and the Resistance Elimination of Garlic Oil to Cefquinome on ESBL E. coli. International Journal of Molecular Sciences. 2023; 24(11):9627. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119627
Chicago/Turabian StyleTong, Yin-Chao, Peng-Cheng Li, Yang Yang, Qing-Yi Lin, Jin-Tong Liu, Yi-Nuo Gao, Yi-Ning Zhang, Shuo Jin, Su-Zhu Qing, Fu-Shan Xing, and et al. 2023. "Detection of Antibiotic Resistance in Feline-Origin ESBL Escherichia coli from Different Areas of China and the Resistance Elimination of Garlic Oil to Cefquinome on ESBL E. coli" International Journal of Molecular Sciences 24, no. 11: 9627. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms24119627