Limited Cheese Intake Paradigm Replaces Patterns of Behavioral Disorders in Experimental PTSD: Focus on Resveratrol Supplementation
Abstract
:1. Introduction
2. Results
2.1. Behavioral Activity in the Elevated Plus Maze Test
2.2. Neurochemical Abnormalities in the Hippocampus of PS Rats
Impact of PS on Hippocampal Monoamine Concentrations and Their Metabolites
2.3. The Impact of PS on Hippocampal DAT, MAO-A, MAO-B, COMT, and BDNF mRNA Expression
2.4. Effect of LCI on Behavioral Activity of PS Rats in the EPM Test
2.4.1. LCI Prevented the Development of Anxiety-like Behavior and Simultaneously Increased Freezing in PS# and RES+ Rats
2.4.2. LCI Segregated RES+ Rats into Two Behavioral Phenotypes Based on Their Freezing Levels
2.5. LCI Reduces Hippocampal MAO-A/MAO-B Activities, Prevents Abnormalities in DA Metabolism in the Hippocampus of PS# Rats, but Cannot Correct Abnormalities in 5-HT Metabolism
2.6. Effects of RES Supplementation and LCI on Hippocampal MAO-A/MAO-B Activities and Monoamine Abnormalities in PS-Subjected Rats
2.7. LCI Enhanced the Impact of PS on the Expression of Genes Related to Monoamine Metabolism, as Well as on the Genes of DAT and BDNF in the Hippocampus
2.8. Divergent Effects of RES Supplementation on Hippocampal Gene Expression in Two Behavioral Phenotypes of RES+ Rats
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.1.1. Predator Stress (PS)
4.1.2. Limited Cheese Intake (LCI) Paradigm
4.2. Behavioral Testing
4.3. Measurement of Hippocampal Concentrations of DA and Its Metabolites
4.4. Measurement of mRNAs
4.4.1. RNA Isolation
4.4.2. cDNA Synthesis and Real-Time RT–PCR
4.5. Evaluation of MAO-A and MAO-B Activity
4.6. Data Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Manukhina, E.B.; Tseilikman, V.; Karpenko, M.N.; Pestereva, N.; Tseilikman, O.; Komelkova, M.; Kondashevskaya, M.V.; Goryacheva, A.V.; Lapshin, M.; Platkovskii, P.O.; et al. Intermittent Hypoxic Conditioning Alleviates Post-Traumatic Stress Disorder-Induced Damage and Dysfunction of Rat Visceral Organs and Brain. Int. J. Mol. Sci. 2020, 21, 345. [Google Scholar] [CrossRef]
- Oroian, B.A.; Ciobica, A.; Timofte, D.; Stefanescu, C.; Serban, I.L. New Metabolic, Digestive, and Oxidative Stress-Related Manifestations Associated with Posttraumatic Stress Disorder. Oxidative Med. Cell. Longev. 2021, 2021, 5599265. [Google Scholar] [CrossRef] [PubMed]
- Michopoulos, V.; Vester, A.; Neigh, G. Posttraumatic stress disorder: A metabolic disorder in disguise? Exp. Neurol. 2016, 284, 220–229. [Google Scholar] [CrossRef]
- DePierro, J.; Lepow, L.; Feder, A.; Yehuda, R. Translating Molecular and Neuroendocrine Findings in Posttraumatic Stress Disorder and Resilience to Novel Therapies. Biol. Psychiatry 2019, 86, 454–463. [Google Scholar] [CrossRef] [PubMed]
- Edmondson, D.; Von Känel, R. Post-Traumatic Stress Disorder and Cardiovascular Disease. Lancet Psychiatry 2017, 4, 320–329. [Google Scholar] [CrossRef]
- Kibler, J.L.; Joshi, K.; Mindy, M. Hypertension in Relation to Posttraumatic Stress Disorder and Depression in the US National Comorbidity Survey. Behav. Med. 2009, 34, 125–132. [Google Scholar] [CrossRef]
- Pietrzak, R.H.; Goldstein, R.B.; Southwick, S.M.; Grant, B.F. Medical Comorbidity of Full and Partial Posttraumatic Stress Disorder in US Adults. Psychosom. Med. 2011, 73, 697–707. [Google Scholar] [CrossRef]
- Raabe, F.; Spengler, D. Epigenetic Risk Factors in PTSD and Depression. Front. Psychiatry 2013, 4, 80. [Google Scholar] [CrossRef] [PubMed]
- Auxéméry, Y. L’état de Stress Post-Traumatique Comme Conséquence de l’interaction Entre Une Susceptibilité Génétique Individuelle, Un Évènement Traumatogène et Un Contexte Social. L’Encéphale 2012, 38, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Waddington, A.; Ampelas, J.-F.; Mauriac, F.; Bronchard, M.; Zeltner, L.; Mallat, V. Post-Traumatic Stress Disorder (PTSD): The Syndrome with Multiple Faces. Encephale 2003, 29, 20–27. [Google Scholar] [PubMed]
- Lima, M.G.; Silva, R.X.D.C.; De Nazaré Dos Santos Silva, S.; Rodrigues, L.D.S.D.S.; Oliveira, K.R.M.; De Jesus Oliveira Batista, E.; Maximino, C.; Herculano, A.M. Time-Dependent Sensitization of Stress Responses in Zebrafish: A Putative Model for Post-Traumatic Stress Disorder. Behav. Process. 2016, 128, 70–82. [Google Scholar] [CrossRef] [PubMed]
- Harvey, B.H.; Naciti, C.; Brand, L.; Stein, D.J. Endocrine, Cognitive and Hippocampal/Cortical 5HT1A/2A Receptor Changes Evoked by a Time-Dependent Sensitisation (TDS) Stress Model in Rats. Brain Res. 2003, 983, 97–107. [Google Scholar] [CrossRef]
- Brand, S.J.; Harvey, B.H. Exploring a Post-Traumatic Stress Disorder Paradigm in Flinders Sensitive Line Rats to Model Treatment-Resistant Depression II: Response to Antidepressant Augmentation Strategies. Acta Neuropsychiatr. 2016, 29, 207–221. [Google Scholar] [CrossRef]
- Rajbhandari, A.K.; Baldo, B.A.; Bakshi, V.P. Predator Stress-Induced CRF Release Causes Enduring Sensitization of Basolateral Amygdala Norepinephrine Systems That Promote PTSD-Like Startle Abnormalities. J. Neurosci. 2015, 35, 14270–14285. [Google Scholar] [CrossRef]
- Shang, C.; Guo, Y.; Yao, J.-Q.; Fang, X.; Sun, L.; Jiang, X.-Y.; Ding, Z.-C.; Ran, Y.-H.; Wang, H.-L.; Zhang, L.; et al. Rapid Anti-PTSD-like Activity of the TSPO Agonist YL-IPA08: Emphasis on Brain GABA, Neurosteroids and HPA Axis Function. Behav. Brain Res. 2020, 379, 112320. [Google Scholar] [CrossRef] [PubMed]
- Toledano, D.; Tassin, J.-P.; Gisquet-Verrier, P. Traumatic Stress in Rats Induces Noradrenergic-Dependent Long-Term Behavioral Sensitization: Role of Individual Differences and Similarities with Dependence on Drugs of Abuse. Psychopharmacology 2013, 230, 465–476. [Google Scholar] [CrossRef]
- Ben-Zion, Z.; Korem, N.; Spiller, T.R.; Duek, O.; Keynan, J.N.; Admon, R.; Harpaz-Rotem, I.; Liberzon, I.; Shalev, A.Y.; Hendler, T. Longitudinal Volumetric Evaluation of Hippocampus and Amygdala Subregions in Recent Trauma Survivors. Mol. Psychiatry 2022, 28, 657–667. [Google Scholar] [CrossRef]
- Szeszko, P.R.; Bierer, L.M.; Bader, H.N.; Chu, K.-W.; Tang, C.Y.; Murphy, K.M.; Hazlett, E.A.; Flory, J.D.; Yehuda, R. Cingulate and Hippocampal Subregion Abnormalities in Combat-Exposed Veterans with PTSD. J. Affect. Disord. 2022, 311, 432–439. [Google Scholar] [CrossRef] [PubMed]
- Giotakos, O. Neurobiology of Emotional Trauma. Psychiatrikī 2020, 31, 162–171. [Google Scholar] [CrossRef]
- Tseilikman, V.; Komelkova, M.; Lapshin, M.; Alliluev, A.; Tseilikman, O.; Karpenko, M.N.; Pestereva, N.; Manukhina, E.B.; Downey, H.F.; Kondashevskaya, M.V.; et al. High and Low Anxiety Phenotypes in a Rat Model of Complex Post-Traumatic Stress Disorder Are Associated with Different Alterations in Regional Brain Monoamine Neurotransmission. Psychoneuroendocrinology 2020, 117, 104691. [Google Scholar] [CrossRef] [PubMed]
- Wilson, C.B.; Ebenezer, P.J.; McLaughlin, L.D.; Francis, J. Predator Exposure/Psychosocial Stress Animal Model of Post-Traumatic Stress Disorder Modulates Neurotransmitters in the Rat Hippocampus and Prefrontal Cortex. PLoS ONE 2014, 9, e89104. [Google Scholar] [CrossRef] [PubMed]
- Wilson, C.B.; McLaughlin, L.D.; Ebenezer, P.J.; Nair, A.; Francis, J. Valproic Acid Effects in the Hippocampus and Prefrontal Cortex in an Animal Model of Post-Traumatic Stress Disorder. Behav. Brain Res. 2014, 268, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Tseilikman, V.; Lapshin, M.; Klebanov, I.R.; Chrousos, G.P.; Vasilieva, M.V.; Pashkov, A.; Fedotova, J.; Tseilikman, D.; Shatilov, V.A.; Manukhina, E.B.; et al. The Link between Activities of Hepatic 11beta-Hydroxysteroid Dehydrogenase-1 and Monoamine Oxidase-A in the Brain Following Repeated Predator Stress: Focus on Heightened Anxiety. Int. J. Mol. Sci. 2022, 23, 4881. [Google Scholar] [CrossRef]
- Lin, C.-C.; Tung, C.-S.; Liu, Y.-P. Escitalopram Reversed the Traumatic Stress-Induced Depressed and Anxiety-like Symptoms but Not the Deficits of Fear Memory. Psychopharmacology 2016, 233, 1135–1146. [Google Scholar] [CrossRef]
- Cho, M.; Nayak, S.U.; Jennings, T.; Tallarida, C.S.; Rawls, S.M. Predator Odor Produces Anxiety-like Behavioral Phenotype in Planarians That Is Counteracted by Fluoxetine. Physiol. Behav. 2019, 206, 181–184. [Google Scholar] [CrossRef] [PubMed]
- Pedraza, L.K.; Sierra, R.O.; Giachero, M.; Nunes-Souza, W.; Lotz, F.N.; De Oliveira Alvares, L. Chronic Fluoxetine Prevents Fear Memory Generalization and Enhances Subsequent Extinction by Remodeling Hippocampal Dendritic Spines and Slowing down Systems Consolidation. Transl. Psychiatry 2019, 9, 53. [Google Scholar] [CrossRef] [PubMed]
- Uniyal, A.; Singh, R.; Akhtar, A.; Bansal, Y.; Kuhad, A.; Sah, S.P. Co-Treatment of Piracetam with Risperidone Rescued Extinction Deficits in Experimental Paradigms of Post-Traumatic Stress Disorder by Restoring the Physiological Alterations in Cortex and Hippocampus. Pharmacol. Biochem. Behav. 2019, 185, 172763. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Zhang, Y.; Wang, B.; Bai, L.; Lu, S.; Zhu, L.; Bai, M.; Li, Y.; Xu, E. Effects of Resveratrol on the Levels of ATP, 5-HT and GAP-43 in the Hippocampus of Mice Exposed to Chronic Unpredictable Mild Stress. Neurosci. Lett. 2020, 735, 135232. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Wang, G.; Shi, J.; Xie, X.; Fei, N.; Chen, L.; Liu, N.; Yang, M.; Pan, J.; Huang, W.; et al. Trans-Resveratrol Ameliorates Anxiety-like Behaviors and Fear Memory Deficits in a Rat Model of Post-Traumatic Stress Disorder. Neuropharmacology 2018, 133, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Tseilikman, V.; Tseilikman, O.; Pashkov, A.; Ivleva, I.; Karpenko, M.N.; Shatilov, V.A.; Zhukov, M.S.; Fedotova, J.; Kondashevskaya, M.V.; Downey, H.F.; et al. Mechanisms of Susceptibility and Resilience to PTSD: Role of Dopamine Metabolism and BDNF Expression in the Hippocampus. Int. J. Mol. Sci. 2022, 23, 14575. [Google Scholar] [CrossRef] [PubMed]
- Blanchard, O.L.; Friesenhahn, G.; Javors, M.A.; Smoliga, J.M. Development of a lozenge for oral transmucosal delivery of trans-resveratrol in humans: Proof of concept. PLoS ONE 2014, 9, e90131. [Google Scholar] [CrossRef]
- Anton, S.D.; Ebner, N.; Dzierzewski, J.M.; Zlatar, Z.Z.; Gurka, M.J.; Dotson, V.M.; Kirton, J.; Mankowski, R.T.; Marsiske, M.; Manini, T.M. Effects of 90 Days of Resveratrol Supplementation on Cognitive Function in Elders: A Pilot Study. J. Altern. Complement. Med. 2018, 24, 725–732. [Google Scholar] [CrossRef]
- Chaplin, A.; Carpéné, C.; Mercader, J.M. Resveratrol, Metabolic Syndrome, and Gut Microbiota. Nutrients 2018, 10, 1651. [Google Scholar] [CrossRef] [PubMed]
- Repossi, G.; Das, U.N.; Eynard, A.R. Molecular Basis of the Beneficial Actions of Resveratrol. Arch. Med. Res. 2020, 51, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Basholli-Salihu, M.; Schuster, R.; Mulla, D.; Praznik, W.; Viernstein, H.; Mueller, M. Bioconversion of Piceid to Resveratrol by Selected Probiotic Cell Extracts. Bioprocess Biosyst. Eng. 2016, 39, 1879–1885. [Google Scholar] [CrossRef]
- Fei, Y.; Zhang, S.; Han, S.; Qiu, B.; Lu, Y.; Huang, W.; Li, F.; Chen, D.; Berglund, B.; Xiao, H.; et al. The Role of Dihydroresveratrol in Enhancing the Synergistic Effect of Ligilactobacillus salivarius Li01 and Resveratrol in Ameliorating Colitis in Mice. Research 2022, 2022, 9863845. [Google Scholar] [CrossRef]
- Fourman, S.; Buesing, D.; Girvin, S.; Nashawi, H.; Ulrich-Lai, Y.M. Limited Cheese Intake Reduces HPA Axis and Behavioral Stress Responses in Male Rats. Physiol. Behav. 2021, 242, 113614. [Google Scholar] [CrossRef]
- Barrington, W.E.; Beresford, S.A.A.; McGregor, B.A.; White, E. Perceived Stress and Eating Behaviors by Sex, Obesity Status, and Stress Vulnerability: Findings from the Vitamins and Lifestyle (VITAL) Study. J. Acad. Nutr. Diet. 2014, 114, 1791–1799. [Google Scholar] [CrossRef] [PubMed]
- Anderson, K.E.; Rosner, W.; Khan, M.S.; New, M.I.; Pang, S.; Wissel, P.; Kappas, A. Diet-Hormone Interactions: Protein/Carbohydrate Ratio Alters Reciprocally the Plasma Levels of Testosterone and Cortisol and Their Respective Binding Globulins in Man. Life Sci. 1987, 40, 1761–1768. [Google Scholar] [CrossRef] [PubMed]
- Kondashevskaya, M.V.; Downey, H.F.; Tseilikman, V.; Aleksandrin, V.V.; Artemyeva, K.A.; Aleksankina, V.V.; Tseilikman, O.; Pashkov, A.; Goryacheva, A.V.; Ivleva, I.; et al. Cerebral Blood Flow in Predator Stress-Resilient and -Susceptible Rats and Mechanisms of Resilience. Int. J. Mol. Sci. 2022, 23, 14729. [Google Scholar] [CrossRef]
- Blum, K. Diagnosis and Healing in Veterans Suspected of Suffering from Post- Traumatic Stress Disorder (PTSD) Using Reward Gene Testing and Reward Circuitry Natural Dopaminergic Activation. J. Genet. Syndr. Gene Ther. 2012, 3, 1000116. [Google Scholar] [CrossRef]
- McLaughlin, T.J.; Blum, K.; Oscar-Berman, M.; Febo, M.; Agan, G.; Fratantonio, J.; Simpatico, T.; Gold, M.S. Putative Dopamine Agonist (KB220Z) Attenuates Lucid Nightmares in PTSD Patients: Role of Enhanced Brain Reward Functional Connectivity and Homeostasis Redeeming Joy. J. Behav. Addict. 2015, 4, 106–115. [Google Scholar] [CrossRef] [PubMed]
- Curvêllo, V.P.; Hekierski, H.; Pastor, P.; Vavilala, M.S.; Armstead, W.M. Dopamine Protects Cerebral Autoregulation and Prevents Hippocampal Necrosis after Traumatic Brain Injury via Block of ERK MAPK in Juvenile Pigs. Brain Res. 2017, 1670, 118–124. [Google Scholar] [CrossRef]
- Gainetdinov, R.R.; Hoener, M.C. Berry Trace Amines and Their Receptors. Pharmacol. Rev. 2018, 70, 549–620. [Google Scholar] [CrossRef]
- Linares, D.M.; Del Rio, B.; Ladero, V.; Martínez, N.; Fernández, M.; Martín, M.C.; Alvarez, M.A. Factors Influencing Biogenic Amines Accumulation in Dairy Products. Front. Microbiol. 2012, 3, 180. [Google Scholar] [CrossRef]
- Li, Y.; Huang, Y.; Song, Y.; Ming-Xin, Z.; Lu, M.; Yang, T.; Aizhen, W.; Han, X. An Shen Ding Zhi Ling Ameliorates the Symptoms of Attention Deficit Hyperactivity Disorder via Modulating Brain-Derived Neurotrophic Factor-Related Signaling Pathways. Evid. -Based Complement. Altern. Med. 2022, 2022, 5471586. [Google Scholar] [CrossRef]
- Politis, I.; Bizelis, I.; Tsiaras, A.; Baldi, A. Effect of vitamin E supplementation on neutrophil function, milk composition and plasmin activity in dairy cows in a commercial herd. J. Dairy Res. 2004, 71, 273–278. [Google Scholar] [CrossRef]
- Santillo, A.; Ciliberti, M.G.; Ciampi, F.; Luciano, G.; Natalello, A.; Menci, R.; Caccamo, M.; Sevi, A.; Albenzio, M. Feeding tannins to dairy cows in different seasons improves the oxidative status of blood plasma and the antioxidant capacity of cheese. J. Dairy Sci. 2022, 105, 8609–8620. [Google Scholar] [CrossRef]
- Stairs, D.J.; Chacho, N.M.; Wunsch, C.; Pipitone, L.; Dravid, S.M. Environmental Enrichment Increases Cue-Dependent Freezing and Behavioral Despair but Decreases Anxiety-like Behavior in Rats. Pharmacol. Biochem. Behav. 2020, 196, 172979. [Google Scholar] [CrossRef] [PubMed]
- Sur, B.; Lee, B. Myricetin Inhibited Fear and Anxiety-Like Behaviors by HPA Axis Regulation and Activation of the BDNF-ERK Signaling Pathway in Posttraumatic Stress Disorder Rats. Evid.-Based Complement. Altern. Med. 2022, 2022, 8320256. [Google Scholar] [CrossRef]
- Chen, S.; Chen, X.; Su, H.; Guo, M.; Liu, H. Advances in Synthetic-Biology-Based Whole-Cell Biosensors: Principles, Genetic Modules, and Applications in Food Safety. Int. J. Mol Sci. 2023, 24, 7989. [Google Scholar] [CrossRef]
- Tseilikman, V.; Komelkova, M.; Kondashevskaya, M.V.; Manukhina, E.B.; Downey, H.F.; Chereshnev, V.A.; Chereshneva, M.V.; Platkovsii, P.O.; Goryacheva, A.V.; Pashkov, A.; et al. A Rat Model of Post-Traumatic Stress Syndrome Causes Phenotype-Associated Morphological Changes and Hypofunction of the Adrenal Gland. Int. J. Mol. Sci. 2021, 22, 13235. [Google Scholar] [CrossRef]
- Lazuko, S.S.; Kuzhel, O.P.; Belyaeva, L.E.; Manukhina, E.B.; Downey, H.F.; Tseilikman, O.; Komelkova, M.; Tseilikman, V. Posttraumatic Stress Disorder Disturbs Coronary Tone and Its Regulatory Mechanisms. Cell. Mol. Neurobiol. 2017, 38, 209–217. [Google Scholar] [CrossRef]
- Cohen, H.; Matar, M.A.; Richter-Levin, G.; Zohar, J. The Contribution of an Animal Model toward Uncovering Biological Risk Factors for PTSD. Ann. N. Y. Acad. Sci. 2006, 1071, 335–350. [Google Scholar] [CrossRef] [PubMed]
- Slotkin, T.A.; Kreider, M.L.; Tate, C.A.; Seidler, F.J. Critical Prenatal and Postnatal Periods for Persistent Effects of Dexamethasone on Serotonergic and Dopaminergic Systems. Neuropsychopharmacology 2005, 31, 904–911. [Google Scholar] [CrossRef]
- Tipton, K.F.; Davey, G.P.; Motherway, M. Monoamine Oxidase Assays. Curr. Protoc. Toxicol. 2006, 9, 3–6. [Google Scholar] [CrossRef] [PubMed]
Variables | Control (n = 10) | PS (n = 15) |
---|---|---|
time spent in open arms (s) | 51.85 (46.1; 58.3) | 34.25 * (22.5; 41.4) |
time spent in closed arms (s) | 248.14 (253.9; 269.7) | 265.75 * (258.6;277.5) |
entries into open arms (s) | 5.0 (2; 7) | 2.0 * (1;4) |
entries into closed arms (s) | 7.0 (5; 11) | 10.0 * (5; 12) |
anxiety index (AI) | 0.706 (0.64; 0.73) | 0.86 (0.8; 0.91) |
freezing (number acts in EPM) | 1.0 (0; 1) | 2.1 (0; 4) |
Name of the Gene | Primer Sequence 5′→3′ | Annealing Temperature, °C |
---|---|---|
PPI | F GATTTGGCTATAAGGGTTC R GTTGTCCACAGTCGGAGA | 60 |
MAO-A | F GCCAGGAACGGAAATTTGTA R TCTCAGGTGGAAGCTCTGGT | 64 |
MAO-B | F TGGGCCAAGAGATTCCCAGTGATG R AGAGTGTGGCAATCTGCTTTGTAG | 60 |
Comt | F CTGGAGGCCATCGACACCTA R AGTAAGCTCCCAGCTCCAGCA | 60 |
BDNF | F GAAAGTCCCGGTATCAAAAG R CGCCAGCCAATTCTCTTTTTG | 60 |
DAT | F TTGGGTTTGGAGTGCTGATTGC R AGAAGACGACGAAGCCAGAGG | 55 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tseilikman, V.E.; Shatilov, V.A.; Zhukov, M.S.; Buksha, I.A.; Epitashvily, A.E.; Lipatov, I.A.; Aristov, M.R.; Koshelev, A.G.; Karpenko, M.N.; Traktirov, D.S.; et al. Limited Cheese Intake Paradigm Replaces Patterns of Behavioral Disorders in Experimental PTSD: Focus on Resveratrol Supplementation. Int. J. Mol. Sci. 2023, 24, 14343. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241814343
Tseilikman VE, Shatilov VA, Zhukov MS, Buksha IA, Epitashvily AE, Lipatov IA, Aristov MR, Koshelev AG, Karpenko MN, Traktirov DS, et al. Limited Cheese Intake Paradigm Replaces Patterns of Behavioral Disorders in Experimental PTSD: Focus on Resveratrol Supplementation. International Journal of Molecular Sciences. 2023; 24(18):14343. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241814343
Chicago/Turabian StyleTseilikman, Vadim E., Vladislav A. Shatilov, Maxim S. Zhukov, Irina A. Buksha, Alexandr E. Epitashvily, Ilya A. Lipatov, Maxim R. Aristov, Alexandr G. Koshelev, Marina N. Karpenko, Dmitrii S. Traktirov, and et al. 2023. "Limited Cheese Intake Paradigm Replaces Patterns of Behavioral Disorders in Experimental PTSD: Focus on Resveratrol Supplementation" International Journal of Molecular Sciences 24, no. 18: 14343. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241814343