Arginine Expedites Erastin-Induced Ferroptosis through Fumarate
Abstract
:1. Introduction
2. Results
2.1. Arginine Deprivation Inhibits Erastin-Induced Ferroptosis, but Not RSL3-Induced Ferroptosis
2.2. Arginine Promotes Erastin-Induced Ferroptosis by Reducing GSH Levels
2.3. Arginine Deprivation Protects Cells against Ferroptosis through Reducing Fumarate Biosynthesis
2.4. Knockdown of Asl Decreases Fumarate and Desensitizes Cells to Erastin-Induced Ferroptosis
2.5. Fumarate Is Decreased in Response to Erastin Exposure
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Reagents
4.3. PI Staining
4.4. Cell Viability Assay
4.5. Intracellular GSH Content Measurement
4.6. Lipid Peroxidation and ROS Measurement
4.7. Western Blotting
4.8. Metabolite Extraction
4.9. Fumarate Measurement by HPLC
4.10. Gene Knockdown with siRNA
4.11. RT-qPCR
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Nishizawa, H.; Matsumoto, M.; Chen, G.; Ishii, Y.; Tada, K.; Onodera, M.; Kato, H.; Muto, A.; Tanaka, K.; Igarashi, K. Lipid peroxidation and the subsequent cell death transmitting from ferroptotic cells to neighboring cells. Cell Death Dis. 2021, 12, 332. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Roh, J.L. Targeting GPX4 in human cancer: Implications of ferroptosis induction for tackling cancer resilience. Cancer Lett. 2023, 559, 216119. [Google Scholar] [CrossRef]
- Wang, L.; Liu, Y.; Du, T.; Yang, H.; Lei, L.; Guo, M.; Ding, H.F.; Zhang, J.; Wang, H.; Chen, X.; et al. ATF3 promotes erastin-induced ferroptosis by suppressing system Xc(). Cell Death Differ. 2020, 27, 662–675. [Google Scholar] [CrossRef]
- Sui, X.; Zhang, R.; Liu, S.; Duan, T.; Zhai, L.; Zhang, M.; Han, X.; Xiang, Y.; Huang, X.; Lin, H.; et al. RSL3 Drives Ferroptosis Through GPX4 Inactivation and ROS Production in Colorectal Cancer. Front. Pharmacol. 2018, 9, 1371. [Google Scholar] [CrossRef] [PubMed]
- Koppula, P.; Lei, G.; Zhang, Y.; Yan, Y.; Mao, C.; Kondiparthi, L.; Shi, J.; Liu, X.; Horbath, A.; Das, M.; et al. A targetable CoQ-FSP1 axis drives ferroptosis- and radiation-resistance in KEAP1 inactive lung cancers. Nat. Commun. 2022, 13, 2206. [Google Scholar] [CrossRef]
- Wang, F.; Min, J. DHODH tangoing with GPX4 on the ferroptotic stage. Signal Transduct. Target. Ther. 2021, 6, 244. [Google Scholar] [CrossRef] [PubMed]
- Kraft, V.A.N.; Bezjian, C.T.; Pfeiffer, S.; Ringelstetter, L.; Muller, C.; Zandkarimi, F.; Merl-Pham, J.; Bao, X.; Anastasov, N.; Kossl, J.; et al. GTP Cyclohydrolase 1/Tetrahydrobiopterin Counteract Ferroptosis through Lipid Remodeling. ACS Cent. Sci. 2020, 6, 41–53. [Google Scholar] [CrossRef]
- He, F.; Huang, X.; Wei, G.; Lin, X.; Zhang, W.; Zhuang, W.; He, W.; Zhan, T.; Hu, H.; Yang, H. Regulation of ACSL4-Catalyzed Lipid Peroxidation Process Resists Cisplatin Ototoxicity. Oxid. Med. Cell. Longev. 2022, 2022, 3080263. [Google Scholar] [CrossRef]
- Wang, L.; Ouyang, S.; Li, B.; Wu, H.; Wang, F. GSK-3beta manipulates ferroptosis sensitivity by dominating iron homeostasis. Cell Death Discov. 2021, 7, 334. [Google Scholar] [CrossRef] [PubMed]
- Lei, G.; Zhuang, L.; Gan, B. Targeting ferroptosis as a vulnerability in cancer. Nat. Rev. Cancer 2022, 22, 381–396. [Google Scholar] [CrossRef] [PubMed]
- Daher, B.; Vucetic, M.; Pouyssegur, J. Cysteine Depletion, a Key Action to Challenge Cancer Cells to Ferroptotic Cell Death. Front. Oncol. 2020, 10, 723. [Google Scholar] [CrossRef] [PubMed]
- Bonifacio, V.D.B.; Pereira, S.A.; Serpa, J.; Vicente, J.B. Cysteine metabolic circuitries: Druggable targets in cancer. Br. J. Cancer 2021, 124, 862–879. [Google Scholar] [CrossRef]
- Yang, P.; Luo, X.; Li, J.; Zhang, T.; Gao, X.; Hua, J.; Li, Y.; Ding, N.; He, J.; Zhang, Y.; et al. Ionizing Radiation Upregulates Glutamine Metabolism and Induces Cell Death via Accumulation of Reactive Oxygen Species. Oxid. Med. Cell. Longev. 2021, 2021, 5826932. [Google Scholar] [CrossRef]
- Luo, M.; Wu, L.; Zhang, K.; Wang, H.; Zhang, T.; Gutierrez, L.; O’Connell, D.; Zhang, P.; Li, Y.; Gao, T.; et al. miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma. Cell Death Differ. 2018, 25, 1457–1472. [Google Scholar] [CrossRef]
- Yang, J.; Dai, X.; Xu, H.; Tang, Q.; Bi, F. Regulation of Ferroptosis by Amino Acid Metabolism in Cancer. Int. J. Biol. Sci. 2022, 18, 1695–1705. [Google Scholar] [CrossRef] [PubMed]
- Zeitler, L.; Fiore, A.; Meyer, C.; Russier, M.; Zanella, G.; Suppmann, S.; Gargaro, M.; Sidhu, S.S.; Seshagiri, S.; Ohnmacht, C.; et al. Anti-ferroptotic mechanism of IL4i1-mediated amino acid metabolism. Elife 2021, 10, e64806. [Google Scholar] [CrossRef]
- Liu, D.; Liang, C.H.; Huang, B.; Zhuang, X.; Cui, W.; Yang, L.; Yang, Y.; Zhang, Y.; Fu, X.; Zhang, X.; et al. Tryptophan Metabolism Acts as a New Anti-Ferroptotic Pathway to Mediate Tumor Growth. Adv. Sci. 2023, 10, e2204006. [Google Scholar] [CrossRef]
- Fiore, A.; Zeitler, L.; Russier, M.; Gross, A.; Hiller, M.K.; Parker, J.L.; Stier, L.; Kocher, T.; Newstead, S.; Murray, P.J. Kynurenine importation by SLC7A11 propagates anti-ferroptotic signaling. Mol. Cell 2022, 82, 920–932.e7. [Google Scholar] [CrossRef]
- Zou, S.; Wang, X.; Liu, P.; Ke, C.; Xu, S. Arginine metabolism and deprivation in cancer therapy. Biomed. Pharmacother. 2019, 118, 109210. [Google Scholar] [CrossRef]
- Marti, I.L.A.A.; Reith, W. Arginine-dependent immune responses. Cell. Mol. Life Sci. 2021, 78, 5303–5324. [Google Scholar] [CrossRef] [PubMed]
- Takahara, T.; Amemiya, Y.; Sugiyama, R.; Maki, M.; Shibata, H. Amino acid-dependent control of mTORC1 signaling: A variety of regulatory modes. J. Biomed. Sci. 2020, 27, 87. [Google Scholar] [CrossRef] [PubMed]
- Fultang, L.; Vardon, A.; De Santo, C.; Mussai, F. Molecular basis and current strategies of therapeutic arginine depletion for cancer. Int. J. Cancer 2016, 139, 501–509. [Google Scholar] [CrossRef] [PubMed]
- Conlon, M.; Poltorack, C.D.; Forcina, G.C.; Armenta, D.A.; Mallais, M.; Perez, M.A.; Wells, A.; Kahanu, A.; Magtanong, L.; Watts, J.L.; et al. A compendium of kinetic modulatory profiles identifies ferroptosis regulators. Nat. Chem. Biol. 2021, 17, 665–674. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.S.; Stockwell, B.R. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016, 26, 165–176. [Google Scholar] [CrossRef]
- Conrad, M.; Angeli, J.P.; Vandenabeele, P.; Stockwell, B.R. Regulated necrosis: Disease relevance and therapeutic opportunities. Nat. Rev. Drug Discov. 2016, 15, 348–366. [Google Scholar] [CrossRef]
- Mishima, E.; Sato, E.; Ito, J.; Yamada, K.I.; Suzuki, C.; Oikawa, Y.; Matsuhashi, T.; Kikuchi, K.; Toyohara, T.; Suzuki, T.; et al. Drugs Repurposed as Antiferroptosis Agents Suppress Organ Damage, Including AKI, by Functioning as Lipid Peroxyl Radical Scavengers. J. Am. Soc. Nephrol. 2020, 31, 280–296. [Google Scholar] [CrossRef]
- Habib, E.; Linher-Melville, K.; Lin, H.X.; Singh, G. Expression of xCT and activity of system xc(-) are regulated by NRF2 in human breast cancer cells in response to oxidative stress. Redox Biol. 2015, 5, 33–42. [Google Scholar] [CrossRef]
- Lassila, T.; Rousu, T.; Mattila, S.; Chesné, C.; Pelkonen, O.; Turpeinen, M.; Tolonen, A. Formation of GSH-trapped reactive metabolites in human liver microsomes, S9 fraction, HepaRG-cells, and human hepatocytes. J. Pharm. Biomed. Anal. 2015, 115, 345–351. [Google Scholar] [CrossRef]
- Zheng, L.; Cardaci, S.; Jerby, L.; MacKenzie, E.D.; Sciacovelli, M.; Johnson, T.I.; Gaude, E.; King, A.; Leach, J.D.; Edrada-Ebel, R.; et al. Fumarate induces redox-dependent senescence by modifying glutathione metabolism. Nat. Commun. 2015, 6, 6001. [Google Scholar] [CrossRef]
- Fuhler, G.M.; Eppinga, H.; Peppelenbosch, M.P. Fumarates and Cancer. Trends Mol. Med. 2017, 23, 3–5. [Google Scholar] [CrossRef]
- Jirovsky, D.; Wiegrebe, W. HPLC-Analysis of Fumarates in Biological Matrices. Monatsh. Chem. Chem. Mon. 2004, 135, 1563–1568. [Google Scholar] [CrossRef]
- Chen, X.; Wu, J.; Song, W.; Zhang, L.; Wang, H.; Liu, L. Fumaric acid production by Torulopsis glabrata: Engineering the urea cycle and the purine nucleotide cycle. Biotechnol. Bioeng. 2015, 112, 156–167. [Google Scholar] [CrossRef]
- Shi, Z.; Ge, X.; Li, M.; Yin, J.; Wang, X.; Zhang, J.; Chen, D.; Li, X.; Wang, X.; Ji, J.; et al. Argininosuccinate lyase drives activation of mutant TERT promoter in glioblastomas. Mol. Cell 2022, 82, 3919–3931.e7. [Google Scholar] [CrossRef]
- Kajarabille, N.; Latunde-Dada, G.O. Programmed Cell-Death by Ferroptosis: Antioxidants as Mitigators. Int. J. Mol. Sci. 2019, 20, 4968. [Google Scholar] [CrossRef] [PubMed]
- Morris, S.M., Jr. Arginine: Beyond protein. Am. J. Clin. Nutr. 2006, 83, 508s–512s. [Google Scholar] [CrossRef]
- Mori, M.; Gotoh, T. Regulation of Nitric Oxide Production by Arginine Metabolic Enzymes. Biochem. Biophys. Res. Commun. 2000, 275, 715–719. [Google Scholar] [CrossRef]
- Murphy, M.P. Nitric oxide and cell death. Biochim. Biophys. Acta BBA Bioenerg. 1999, 1411, 401–414. [Google Scholar] [CrossRef]
- Soneja, A.; Drews, M.; Malinski, T. Role of nitric oxide, nitroxidative and oxidative stress in wound healing. Pharmacol. Rep. 2005, 57, 108–119. [Google Scholar] [PubMed]
- Wyant, G.A.; Abu-Remaileh, M.; Wolfson, R.L.; Chen, W.W.; Freinkman, E.; Danai, L.V.; Vander Heiden, M.G.; Sabatini, D.M. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient. Cell 2017, 171, 642–654.e12. [Google Scholar] [CrossRef]
- Jung, J.W.; Macalino, S.J.Y.; Cui, M.; Kim, J.E.; Kim, H.J.; Song, D.G.; Nam, S.H.; Kim, S.; Choi, S.; Lee, J.W. Transmembrane 4 L Six Family Member 5 Senses Arginine for mTORC1 Signaling. Cell Metab. 2019, 29, 1306–1319.e7. [Google Scholar] [CrossRef]
- Chantranupong, L.; Scaria, S.M.; Saxton, R.A.; Gygi, M.P.; Shen, K.; Wyant, G.A.; Wang, T.; Harper, J.W.; Gygi, S.P.; Sabatini, D.M. The CASTOR Proteins Are Arginine Sensors for the mTORC1 Pathway. Cell 2016, 165, 153–164. [Google Scholar] [CrossRef]
- Jin, H.O.; Hong, S.E.; Kim, J.Y.; Jang, S.K.; Park, I.C. Amino acid deprivation induces AKT activation by inducing GCN2/ATF4/REDD1 axis. Cell Death Dis. 2021, 12, 1127. [Google Scholar] [CrossRef]
- Wortel, I.M.N.; van der Meer, L.T.; Kilberg, M.S.; van Leeuwen, F.N. Surviving Stress: Modulation of ATF4-Mediated Stress Responses in Normal and Malignant Cells. Trends Endocrinol. Metab. 2017, 28, 794–806. [Google Scholar] [CrossRef]
- Rabinovich, S.; Adler, L.; Yizhak, K.; Sarver, A.; Silberman, A.; Agron, S.; Stettner, N.; Sun, Q.; Brandis, A.; Helbling, D.; et al. Diversion of aspartate in ASS1-deficient tumours fosters de novo pyrimidine synthesis. Nature 2015, 527, 379–383. [Google Scholar] [CrossRef]
- Chen, C.L.; Hsu, S.C.; Chung, T.Y.; Chu, C.Y.; Wang, H.J.; Hsiao, P.W.; Yeh, S.D.; Ann, D.K.; Yen, Y.; Kung, H.J. Arginine is an epigenetic regulator targeting TEAD4 to modulate OXPHOS in prostate cancer cells. Nat. Commun. 2021, 12, 2398. [Google Scholar] [CrossRef]
- Patil, M.D.; Bhaumik, J.; Babykutty, S.; Banerjee, U.C.; Fukumura, D. Arginine dependence of tumor cells: Targeting a chink in cancer’s armor. Oncogene 2016, 35, 4957–4972. [Google Scholar] [CrossRef]
- Kim, R.H.; Coates, J.M.; Bowles, T.L.; McNerney, G.P.; Sutcliffe, J.; Jung, J.U.; Gandour-Edwards, R.; Chuang, F.Y.; Bold, R.J.; Kung, H.J. Arginine deiminase as a novel therapy for prostate cancer induces autophagy and caspase-independent apoptosis. Cancer Res. 2009, 69, 700–708. [Google Scholar] [CrossRef]
- Delage, B.; Luong, P.; Maharaj, L.; O’Riain, C.; Syed, N.; Crook, T.; Hatzimichael, E.; Papoudou-Bai, A.; Mitchell, T.J.; Whittaker, S.J.; et al. Promoter methylation of argininosuccinate synthetase-1 sensitises lymphomas to arginine deiminase treatment, autophagy and caspase-dependent apoptosis. Cell Death Dis. 2012, 3, e342. [Google Scholar] [CrossRef]
- Changou, C.A.; Chen, Y.R.; Xing, L.; Yen, Y.; Chuang, F.Y.; Cheng, R.H.; Bold, R.J.; Ann, D.K.; Kung, H.J. Arginine starvation-associated atypical cellular death involves mitochondrial dysfunction, nuclear DNA leakage, and chromatin autophagy. Proc. Natl. Acad. Sci. USA 2014, 111, 14147–14152. [Google Scholar] [CrossRef]
- Qiu, F.; Chen, Y.R.; Liu, X.; Chu, C.Y.; Shen, L.J.; Xu, J.; Gaur, S.; Forman, H.J.; Zhang, H.; Zheng, S.; et al. Arginine starvation impairs mitochondrial respiratory function in ASS1-deficient breast cancer cells. Sci. Signal. 2014, 7, ra31. [Google Scholar] [CrossRef]
- Long, Y.; Tsai, W.B.; Wangpaichitr, M.; Tsukamoto, T.; Savaraj, N.; Feun, L.G.; Kuo, M.T. Arginine deiminase resistance in melanoma cells is associated with metabolic reprogramming, glucose dependence, and glutamine addiction. Mol. Cancer Ther. 2013, 12, 2581–2590. [Google Scholar] [CrossRef]
- Chen, X.; Kang, R.; Kroemer, G.; Tang, D. Broadening horizons: The role of ferroptosis in cancer. Nat. Rev. Clin. Oncol. 2021, 18, 280–296. [Google Scholar] [CrossRef]
- Mak, T.W.; Grusdat, M.; Duncan, G.S.; Dostert, C.; Nonnenmacher, Y.; Cox, M.; Binsfeld, C.; Hao, Z.; Brüstle, A.; Itsumi, M.; et al. Glutathione Primes T Cell Metabolism for Inflammation. Immunity 2017, 46, 675–689. [Google Scholar] [CrossRef]
- Bartolacci, C.; Andreani, C.; El-Gammal, Y.; Scaglioni, P.P. Lipid Metabolism Regulates Oxidative Stress and Ferroptosis in RAS-Driven Cancers: A Perspective on Cancer Progression and Therapy. Front. Mol. Biosci. 2021, 8, 706650. [Google Scholar] [CrossRef]
- Du, Y.; Guo, Z. Recent progress in ferroptosis: Inducers and inhibitors. Cell Death Discov. 2022, 8, 501. [Google Scholar] [CrossRef]
- Soula, M.; Weber, R.A.; Zilka, O.; Alwaseem, H.; La, K.; Yen, F.; Molina, H.; Garcia-Bermudez, J.; Pratt, D.A.; Birsoy, K. Metabolic determinants of cancer cell sensitivity to canonical ferroptosis inducers. Nat. Chem. Biol. 2020, 16, 1351–1360. [Google Scholar] [CrossRef]
- Yang, M.; Soga, T.; Pollard, P.J.; Adam, J. The emerging role of fumarate as an oncometabolite. Front. Oncol. 2012, 2, 85. [Google Scholar] [CrossRef]
- Isaacs, J.S.; Jung, Y.J.; Mole, D.R.; Lee, S.; Torres-Cabala, C.; Chung, Y.L.; Merino, M.; Trepel, J.; Zbar, B.; Toro, J.; et al. HIF overexpression correlates with biallelic loss of fumarate hydratase in renal cancer: Novel role of fumarate in regulation of HIF stability. Cancer Cell 2005, 8, 143–153. [Google Scholar] [CrossRef]
- Schroeder, A.; Warnken, U.; Roth, D.; Klika, K.D.; Vobis, D.; Barnert, A.; Bujupi, F.; Oberacker, T.; Schnolzer, M.; Nicolay, J.P.; et al. Targeting Thioredoxin-1 by dimethyl fumarate induces ripoptosome-mediated cell death. Sci. Rep. 2017, 7, 43168. [Google Scholar] [CrossRef]
- Humphries, F.; Shmuel-Galia, L.; Ketelut-Carneiro, N.; Li, S.; Wang, B.; Nemmara, V.V.; Wilson, R.; Jiang, Z.; Khalighinejad, F.; Muneeruddin, K.; et al. Succination inactivates gasdermin D and blocks pyroptosis. Science 2020, 369, 1633–1637. [Google Scholar] [CrossRef]
- Xie, X.; Zhao, Y.; Ma, C.-Y.; Xu, X.-M.; Zhang, Y.-Q.; Wang, C.-G.; Jin, J.; Shen, X.; Gao, J.-L.; Li, N.; et al. Dimethyl fumarate induces necroptosis in colon cancer cells through GSH depletion/ROS increase/MAPKs activation pathway. Br. J. Pharmacol. 2015, 172, 3929–3943. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhao, S.; Fu, Y.; Yan, L.; Feng, Y.; Chen, Y.; Wu, Y.; Deng, Y.; Zhang, G.; Chen, Z.; et al. Computational repositioning of dimethyl fumarate for treating alcoholic liver disease. Cell Death Dis. 2020, 11, 641. [Google Scholar] [CrossRef]
- Qi, D.; Chen, P.; Bao, H.; Zhang, L.; Sun, K.; Song, S.; Li, T. Dimethyl fumarate protects against hepatic ischemia-reperfusion injury by alleviating ferroptosis via the NRF2/SLC7A11/HO-1 axis. Cell Cycle 2023, 22, 818–828. [Google Scholar] [CrossRef]
- Yang, Y.; Cai, F.; Zhou, N.; Liu, S.; Wang, P.; Zhang, S.; Zhang, Y.; Zhang, A.; Jia, Z.; Huang, S. Dimethyl fumarate prevents ferroptosis to attenuate acute kidney injury by acting on NRF2. Clin. Transl. Med. 2021, 11, e382. [Google Scholar] [CrossRef]
- Kerins, M.J.; Milligan, J.; Wohlschlegel, J.A.; Ooi, A. Fumarate hydratase inactivation in hereditary leiomyomatosis and renal cell cancer is synthetic lethal with ferroptosis induction. Cancer Sci. 2018, 109, 2757–2766. [Google Scholar] [CrossRef]
- Schmitt, A.; Xu, W.; Bucher, P.; Grimm, M.; Konantz, M.; Horn, H.; Zapukhlyak, M.; Berning, P.; Brändle, M.; Jarboui, M.A.; et al. Dimethyl fumarate induces ferroptosis and impairs NF-κB/STAT3 signaling in DLBCL. Blood 2021, 138, 871–884. [Google Scholar] [CrossRef]
- Sullivan, L.B.; Martinez-Garcia, E.; Nguyen, H.; Mullen, A.R.; Dufour, E.; Sudarshan, S.; Licht, J.D.; Deberardinis, R.J.; Chandel, N.S. The proto-oncometabolite fumarate binds glutathione to amplify ROS-dependent signaling. Mol. Cell 2013, 51, 236–248. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Actin | CATTGCTGACAGGATGCAGAAGG | TGCTGGAAGGTGGACAGTGAGG |
Asl | GGCAGAGACTAAAGGAGTGGCT | TCGACACTGGATTTCGCTGTGC |
Gclc | ACACCTGGATGATGCCAACGAG | CCTCCATTGGTCGGAACTCTAC |
Gclm | TCCTGCTGTGTGATGCCACCAG | GCTTCCTGGAAACTTGCCTCAG |
Gss | CCAGGAAGTTGCTGTGGTGTAC | GCTGTATGGCAATGTCTGGACAC |
Gsr | GTTTACCGCTCCACACATCCTG | GCTGAAAGAAGCCATCACTGGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, X.; Guo, Y.; Li, J.; Liu, Q.; Wu, H. Arginine Expedites Erastin-Induced Ferroptosis through Fumarate. Int. J. Mol. Sci. 2023, 24, 14595. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241914595
Guo X, Guo Y, Li J, Liu Q, Wu H. Arginine Expedites Erastin-Induced Ferroptosis through Fumarate. International Journal of Molecular Sciences. 2023; 24(19):14595. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241914595
Chicago/Turabian StyleGuo, Xinxin, Yubo Guo, Jiahuan Li, Qian Liu, and Hao Wu. 2023. "Arginine Expedites Erastin-Induced Ferroptosis through Fumarate" International Journal of Molecular Sciences 24, no. 19: 14595. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241914595