TLDc Domain-Containing Genes in Autism Spectrum Disorder: New Players in the Oxidative Stress Response
Abstract
:1. Introduction
2. Results
2.1. Expression of Genes Coding for TLDc Domain-Containing Proteins
2.2. miR-200b-3p, miR-32-5p, and lncRNA TUG1 Expression
2.3. TLDc Family Gene Expression: Correlation between Clinical Features and Inflammation/Oxidation-Related Genes
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Sample Collection and mRNA Extraction
4.3. cDNA Synthesis and Quantitative Real-Time PCR (qPCR)
4.4. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, 5th ed.; American Psychiatric Association: Washington, DC, USA, 2013. [Google Scholar]
- Autism Spectrum Disorder (ASD). Centers for Disease Control and Prevention. Available online: https://www.cdc.gov/ncbddd/autism/index.html (accessed on 24 July 2023).
- Khachadourian, V.; Mahjani, B.; Sandin, S.; Kolevzon, A.; Buxbaum, J.D.; Reichenberg, A.; Janecka, M. Comorbidities in autism spectrum disorder and their etiologies. Transl. Psychiatry 2023, 13, 71. [Google Scholar] [CrossRef] [PubMed]
- Yoon, S.H.; Choi, J.; Lee, W.J.; Do, J.T. Genetic and Epigenetic Etiology Underlying Autism Spectrum Disorder. J. Clin. Med. 2020, 9, 966. [Google Scholar] [CrossRef] [PubMed]
- Vohra, R.; Madhavan, S.; Sambamoorthi, U. Comorbidity prevalence, healthcare utilization, and expenditures of Medicaid enrolled adults with autism spectrum disorders. Autism 2017, 21, 995–1009. [Google Scholar] [CrossRef] [PubMed]
- Lukmanji, S.; Manji, S.A.; Kadhim, S.; Sauro, K.M.; Wirrell, E.C.; Kwon, C.S.; Jetté, N. The co-occurrence of epilepsy and autism: A systematic review. Epilepsy Behav. 2019, 98, 238–248. [Google Scholar] [CrossRef] [PubMed]
- Gładysz, D.; Krzywdzińska, A.; Hozyasz, K.K. Immune Abnormalities in Autism Spectrum Disorder-Could They Hold Promise for Causative Treatment? Mol. Neurobiol. 2018, 55, 6387–6435. [Google Scholar] [CrossRef]
- Yektaş, Ç.; Alpay, M.; Tufan, A.E. Comparison of serum B12, folate and homocysteine concentrations in children with autism spectrum disorder or attention deficit hyperactivity disorder and healthy controls. Neuropsychiatr. Dis. Treat. 2019, 15, 2213–2219. [Google Scholar] [CrossRef] [PubMed]
- Ministry of Health. Available online: https://www.salute.gov.it/portale/saluteMentale/dettaglioContenutiSaluteMentale.jsp?id=5613&area=salute%20mentale&menu=vuoto (accessed on 19 October 2023).
- van’t Hof, M.; Tisseur, C.; van Berckelear-Onnes, I.; van Nieuwenhuyzen, A.; Daniels, A.M.; Deen, M.; Hoek, H.W.; Ester, W.A. Age at autism spectrum disorder diagnosis: A systematic review and meta-analysis from 2012 to 2019. Autism 2021, 25, 862–873. [Google Scholar] [CrossRef]
- Chlebowski, C.; Green, J.A.; Barton, M.L.; Fein, D. Using the childhood autism rating scale to diagnose autism spectrum disorders. J. Autism Dev. Disord. 2010, 40, 787–799. [Google Scholar] [CrossRef]
- Lord, C.; Elsabbagh, M.; Baird, G.; Veenstra-Vanderweele, J. Autism spectrum disorder. Lancet 2018, 392, 508–520. [Google Scholar] [CrossRef]
- Eissa, N.; Al-Houqani, M.; Sadeq, A.; Ojha, S.K.; Sasse, A.; Sadek, B. Current Enlightenment About Etiology and Pharmacological Treatment of Autism Spectrum Disorder. Front. Neurosci. 2018, 12, 304. [Google Scholar] [CrossRef]
- LaSalle, J.M. Epigenomic signatures reveal mechanistic clues and predictive markers for autism spectrum disorder. Mol. Psychiatry 2023, 28, 1890–1901. [Google Scholar] [CrossRef] [PubMed]
- Panisi, C.; Guerini, F.R.; Abruzzo, P.M.; Balzola, F.; Biava, P.M.; Bolotta, A.; Brunero, M.; Burgio, E.; Chiara, A.; Clerici, M.; et al. Autism Spectrum Disorder from the Womb to Adulthood: Suggestions for a Paradigm Shift. J. Pers. Med. 2021, 11, 70. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Lin, J.; Zhang, H.; Khan, N.U.; Zhang, J.; Tang, X.; Cao, X.; Shen, L. Oxidative Stress in Autism Spectrum Disorder-Current Progress of Mechanisms and Biomarkers. Front. Psychiatry 2022, 13, 813304. [Google Scholar] [CrossRef] [PubMed]
- Bjørklund, G.; Meguid, N.A.; El-Bana, M.A.; Tinkov, A.A.; Saad, K.; Dadar, M.; Hemimi, M.; Skalny, A.V.; Hosnedlová, B.; Kizek, R.; et al. Oxidative Stress in Autism Spectrum Disorder. Mol. Neurobiol. 2020, 57, 2314–2332. [Google Scholar] [CrossRef] [PubMed]
- Pangrazzi, L.; Balasco, L.; Bozzi, Y. Oxidative Stress and Immune System Dysfunction in Autism Spectrum Disorders. Int. J. Mol. Sci. 2020, 21, 3293. [Google Scholar] [CrossRef] [PubMed]
- Sies, H. Oxidative Stress: Concept and Some Practical Aspects. Antioxidants 2020, 9, 852. [Google Scholar] [CrossRef] [PubMed]
- Abruzzo, P.M.; Matté, A.; Bolotta, A.; Federti, E.; Ghezzo, A.; Guarnieri, T.; Marini, M.; Posar, A.; Siciliano, A.; De Franceschi, L.; et al. Plasma peroxiredoxin changes and inflammatory cytokines support the involvement of neuro-inflammation and oxidative stress in Autism Spectrum Disorder. J. Transl. Med. 2019, 17, 332. [Google Scholar] [CrossRef] [PubMed]
- Bolotta, A.; Battistelli, M.; Falcieri, E.; Ghezzo, A.; Manara, M.C.; Manfredini, S.; Marini, M.; Posar, A.; Visconti, P.; Abruzzo, P.M. Oxidative Stress in Autistic Children Alters Erythrocyte Shape in the Absence of Quantitative Protein Alterations and of Loss of Membrane Phospholipid Asymmetry. Oxid. Med. Cell Longev. 2018, 2018, 6430601. [Google Scholar] [CrossRef]
- Anwar, A.; Abruzzo, P.M.; Pasha, S.; Rajpoot, K.; Bolotta, A.; Ghezzo, A.; Marini, M.; Posar, A.; Visconti, P.; Thornalley, P.J.; et al. Advanced glycation endproducts, dityrosine and arginine transporter dysfunction in autism—A source of biomarkers for clinical diagnosis. Mol. Autism. 2018, 9, 3. [Google Scholar] [CrossRef]
- Anwar, A.; Marini, M.; Abruzzo, P.M.; Bolotta, A.; Ghezzo, A.; Visconti, P.; Thornalley, P.J.; Rabbani, N. Quantitation of plasma thiamine, related metabolites and plasma protein oxidative damage markers in children with autism spectrum disorder and healthy controls. Free Radic. Res. 2016, 50, S85–S90. [Google Scholar] [CrossRef]
- Ghezzo, A.; Visconti, P.; Abruzzo, P.M.; Bolotta, A.; Ferreri, C.; Gobbi, G.; Malisardi, G.; Manfredini, S.; Marini, M.; Nanetti, L.; et al. Oxidative Stress and Erythrocyte Membrane Alterations in Children with Autism: Correlation with Clinical Features. PLoS ONE 2013, 8, e66418. [Google Scholar] [CrossRef] [PubMed]
- Rossignol, D.A.; Frye, R.E. Evidence linking oxidative stress, mitochondrial dysfunction, and inflammation in the brain of individuals with autism. Front. Physiol. 2014, 5, 150. [Google Scholar] [CrossRef] [PubMed]
- Rossignol, D.A.; Frye, R.E. Mitochondrial dysfunction in autism spectrum disorders: A systematic review and meta-analysis. Mol. Psychiatry 2012, 17, 290–314. [Google Scholar] [CrossRef] [PubMed]
- Abdolmaleky, H.M.; Martin, M.; Zhou, J.R.; Thiagalingam, S. Epigenetic Alterations of Brain Non-Neuronal Cells in Major Mental Diseases. Genes 2023, 14, 896. [Google Scholar] [CrossRef]
- Huguet, G.; Ey, E.; Bourgeron, T. The genetic landscapes of autism spectrum disorders. Annu. Rev. Genom. Hum. Genet. 2013, 14, 191–213. [Google Scholar] [CrossRef] [PubMed]
- Kushima, I.; Aleksic, B.; Nakatochi, M.; Shimamura, T.; Okada, T.; Uno, Y.; Morikawa, M.; Ishizuka, K.; Shiino, T.; Kimura, H.; et al. Comparative Analyses of Copy-Number Variation in Autism Spectrum Disorder and Schizophrenia Reveal Etiological Overlap and Biological Insights. Cell Rep. 2018, 24, 2838–2856. [Google Scholar] [CrossRef] [PubMed]
- Usui, N.; Kobayashi, H.; Shimada, S. Neuroinflammation and Oxidative Stress in the Pathogenesis of Autism Spectrum Disorder. Int. J. Mol. Sci. 2023, 24, 5487. [Google Scholar] [CrossRef]
- Finelli, M.J.; Sanchez-Pulido, L.; Liu, K.X.; Davies, K.E.; Oliver, P.L. The Evolutionarily Conserved Tre2/Bub2/Cdc16 (TBC), Lysin Motif (LysM), Domain Catalytic (TLDc) Domain Is Neuroprotective against Oxidative Stress. J. Biol. Chem. 2016, 291, 2751–2763. [Google Scholar] [CrossRef]
- Finelli, M.J.; Oliver, P.L. TLDc proteins: New players in the oxidative stress response and neurological disease. Mamm. Genom. 2017, 28, 395–406. [Google Scholar] [CrossRef]
- Kim, Y.; Vadodaria, K.C.; Lenkei, Z.; Kato, T.; Gage, F.H.; Marchetto, M.C.; Santos, R. Mitochondria, Metabolism, and Redox Mechanisms in Psychiatric Disorders. Antioxid. Redox Signal. 2019, 31, 275–317. [Google Scholar] [CrossRef]
- Patel, M. Targeting Oxidative Stress in Central Nervous System Disorders. Trends Pharmacol. Sci. 2016, 37, 768–778. [Google Scholar] [CrossRef] [PubMed]
- Natoli, R.; Provis, J.; Valter, K.; Stone, J. Expression and role of the early-response gene Oxr1 in the hyperoxia-challenged mouse retina. Investig. Opthalmology Vis. Sci. 2008, 49, 4561–4567. [Google Scholar] [CrossRef] [PubMed]
- Murray, A.R.; Chen, Q.; Takahashi, Y.; Zhou, K.K.; Park, K.; Ma, J.X. MicroRNA-200b downregulates oxidation resistance 1 (Oxr1) expression in the retina of type 1 diabetes model. Investig. Opthalmology Vis. Sci. 2013, 54, 1689–1697. [Google Scholar] [CrossRef] [PubMed]
- Finelli, M.J.; Liu, K.X.; Wu, Y.; Oliver, P.L.; Davies, K.E. Oxr1 improves pathogenic cellular features of ALS-associated FUS and TDP-43 mutations. Hum. Mol. Genet. 2015, 24, 3529–3544. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.X.; Edwards, B.; Lee, S.; Finelli, M.J.; Davies, B.; Davies, K.E.; Oliver, P.L. Neuron-specific antioxidant OXR1 extends survival of a mouse model of amyotrophic lateral sclerosis. Brain 2015, 138, 1167–1181. [Google Scholar] [CrossRef]
- Puspita, L.; Chung, S.Y.; Shim, J.W. Oxidative stress and cellular pathologies in Parkinson’s disease. Mol. Brain 2017, 10, 53. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Liu, J.; Chen, L.; Jin, Y.; Zhang, G.; Lin, Z.; Du, S.; Fu, Z.; Chen, T.; Qin, Y.; et al. Serum secreted miR-137-containing exosomes affects oxidative stress of neurons by regulating OXR1 in Parkinson’s disease. Brain Res. 2019, 1722, 146331. [Google Scholar] [CrossRef]
- Williamson, M.G.; Finelli, M.J.; Sleigh, J.N.; Reddington, A.; Gordon, D.; Talbot, K.; Davies, K.E.; Oliver, P.L. Neuronal over-expression of Oxr1 is protective against ALS-associated mutant TDP-43 mislocalisation in motor neurons and neuromuscular defects in vivo. Hum. Mol. Genet. 2019, 28, 3584–3599. [Google Scholar] [CrossRef]
- Balestrini, S.; Milh, M.; Castiglioni, C.; Lüthy, K.; Finelli, M.J.; Verstreken, P.; Cardon, A.; Stražišar, B.G.; Holder, J.L., Jr.; Lesca, G.; et al. TBC1D24 genotype-phenotype correlation: Epilepsies and other neurologic features. Neurology 2016, 87, 77–85. [Google Scholar] [CrossRef]
- Wang, J.; Rousseau, J.; Kim, E.; Ehresmann, S.; Cheng, Y.T.; Duraine, L.; Zuo, Z.; Park, Y.J.; Li-Kroeger, D.; Bi, W.; et al. Loss of Oxidation Resistance 1, OXR1, Is Associated with an Autosomal-Recessive Neurological Disease with Cerebellar Atrophy and Lysosomal Dysfunction. Am. J. Hum. Genet. 2019, 105, 1237–1253. [Google Scholar] [CrossRef]
- Doan, R.N.; Lim, E.T.; De Rubeis, S.; Betancur, C.; Cutler, D.J.; Chiocchetti, A.G.; Overman, L.M.; Soucy, A.; Goetze, S.; Autism Sequencing Consortium; et al. Recessive gene disruptions in autism spectrum disorder. Nat. Genet. 2019, 51, 1092–1098. [Google Scholar] [CrossRef] [PubMed]
- Castroflorio, E.; den Hoed, J.; Svistunova, D.; Finelli, M.J.; Cebrian-Serrano, A.; Corrochano, S.; Bassett, A.R.; Davies, B.; Oliver, P.L. The Ncoa7 locus regulates V-ATPase formation and function, neurodevelopment and behaviour. Cell Mol. Life Sci. 2021, 78, 3503–3524. [Google Scholar] [CrossRef] [PubMed]
- Yuan, P.; Tang, C.; Chen, B.; Lei, P.; Song, J.; Xin, G.; Wang, Z.; Hui, Y.; Yao, W.; Wang, G.; et al. miR-32-5p suppresses the proliferation and migration of pancreatic adenocarcinoma cells by targeting TLDC1. Mol. Med. Rep. 2021, 24, 752. [Google Scholar] [CrossRef] [PubMed]
- Han, S.H.; Kumar, D.; Ferreira, V.H.; Egli, A.; Hirsch, H.H.; Weisser, M.; Garzoni, C.; van Delden, C.; Bochud, P.Y.; Manuel, O.; et al. Human MicroRNA Responses Predict Cytomegalovirus Replication Following Solid Organ Transplantation. J. Infect. Dis. 2017, 215, 537–546. [Google Scholar] [CrossRef] [PubMed]
- Rahimi, Z.; Ghorbani, Z.; Motamed, H.; Jalilian, N. Aberrant expression profile of miR-32, miR-98 and miR-374 in chronic lymphocytic leukemia. Leuk. Res. 2021, 111, 106691. [Google Scholar] [CrossRef] [PubMed]
- Sayad, A.; Omrani, M.D.; Fallah, H.; Taheri, M.; Ghafouri-Fard, S. Aberrant Expression of Long Non-coding RNAs in Peripheral Blood of Autistic Patients. J. Mol. Neurosci. 2019, 67, 276–281. [Google Scholar] [CrossRef]
- Khalil, A.M.; Guttman, M.; Huarte, M.; Garber, M.; Raj, A.; Rivea Morales, D.; Thomas, K.; Presser, A.; Bernstein, B.E.; van Oudenaarden, A.; et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc. Natl. Acad. Sci. USA 2009, 106, 11667–16672. [Google Scholar] [CrossRef]
- Bolotta, A.; Visconti, P.; Fedrizzi, G.; Ghezzo, A.; Marini, M.; Manunta, P.; Messaggio, E.; Posar, A.; Vignini, A.; Abruzzo, P.M. Na+, K+ -ATPase activity in children with autism spectrum disorder: Searching for the reason(s) of its decrease in blood cells. Autism Res. 2018, 11, 1388–1403. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. B. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Mosig, M.O.; Lipkin, E.; Khutoreskaya, G.; Tchourzyna, E.; Soller, M.; Friedmann, A. A whole genome scan for quantitative trait loci affecting milk protein percentage in Israeli-Holstein cattle, by means of selective milk DNA pooling in a daughter design, using an adjusted false discovery rate criterion. Genetics 2001, 157, 1683–1698. [Google Scholar] [CrossRef]
- Falace, A.; Buhler, E.; Fadda, M.; Watrin, F.; Lippiello, P.; Pallesi-Pocachard, E.; Baldelli, P.; Benfenati, F.; Zara, F.; Represa, A.; et al. TBC1D24 regulates neuronal migration and maturation through modulation of the ARF6-dependent pathway. Proc. Natl. Acad. Sci. USA 2014, 111, 2337–2342. [Google Scholar] [CrossRef] [PubMed]
- Falace, A.; Filipello, F.; La Padula, V.; Vanni, N.; Madia, F.; De Pietri Tonelli, D.; de Falco, F.A.; Striano, P.; Dagna Bricarelli, F.; Minetti, C.; et al. TBC1D24, an ARF6-interacting protein, is mutated in familial infantile myoclonic epilepsy. Am. J. Hum. Genet. 2010, 87, 365–370. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Wang, W.; Yang, M.; Damseh, N.; de Sousa, M.M.L.; Jacob, F.; Lång, A.; Kristiansen, E.; Pannone, M.; Kissova, M.; et al. A loss-of-function mutation in human Oxidation Resistance 1 disrupts the spatial-temporal regulation of histone arginine methylation in neurodevelopment. Genom. Biol. 2023, 24, 216. [Google Scholar] [CrossRef] [PubMed]
- Oliver, P.L.; Finelli, M.J.; Edwards, B.; Bitoun, E.; Butts, D.L.; Becker, E.B.; Cheeseman, M.T.; Davies, B.; Davies, K.E. Oxr1 is essential for protection against oxidative stress-induced neurodegeneration. PLoS Genet. 2011, 7, e1002338. [Google Scholar] [CrossRef] [PubMed]
- Vaishnavi, V.; Manikandan, M.; Tiwary, B.K.; Munirajan, A.K. Insights on the functional impact of microRNAs present in autism-associated copy number variants. PLoS ONE 2013, 8, e56781. [Google Scholar] [CrossRef]
- Sehovic, E.; Spahic, L.; Smajlovic-Skenderagic, L.; Pistoljevic, N.; Dzanko, E.; Hajdarpasic, A. Identification of developmental disorders including autism spectrum disorder using salivary miRNAs in children from Bosnia and Herzegovina. PLoS ONE 2020, 15, e0232351. [Google Scholar] [CrossRef]
- Hicks, S.D.; Middleton, F.A. A Comparative Review of microRNA Expression Patterns in Autism Spectrum Disorder. Front. Psychiatry 2016, 7, 176. [Google Scholar] [CrossRef] [PubMed]
- Ludwig, N.; Leidinger, P.; Becker, K.; Backes, C.; Fehlmann, T.; Pallasch, C.; Rheinheimer, S.; Meder, B.; Stähler, C.; Meese, E.; et al. Distribution of miRNA expression across human tissues. Nucleic Acids Res. 2016, 44, 3865–3877. [Google Scholar] [CrossRef]
- Volkert, M.R.; Crowley, D.J. Preventing Neurodegeneration by Controlling Oxidative Stress: The Role of OXR1. Front. Neurosci. 2020, 14, 611904. [Google Scholar] [CrossRef]
- Rolland, T.; Taşan, M.; Charloteaux, B.; Pevzner, S.J.; Zhong, Q.; Sahni, N.; Yi, S.; Lemmens, I.; Fontanillo, C.; Mosca, R.; et al. A proteome-scale map of the human interactome network. Cell 2014, 159, 1212–1226. [Google Scholar] [CrossRef]
- Baird, L.; Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef] [PubMed]
- James, S.J.; Melnyk, S.; Jernigan, S.; Cleves, M.A.; Halsted, C.H.; Wong, D.H.; Cutler, P.; Bock, K.; Boris, M.; Bradstreet, J.J.; et al. Metabolic endophenotype and related genotypes are associated with oxidative stress in children with autism. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2006, 141B, 947–956. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, A.; Chauhan, V. Oxidative stress in autism. Pathophysiology 2006, 13, 171–181. [Google Scholar] [CrossRef] [PubMed]
- Matta, S.M.; Hill-Yardin, E.L.; Crack, P.J. The influence of neuroinflammation in Autism Spectrum Disorder. Brain Behav. Immun. 2019, 79, 75–90. [Google Scholar] [CrossRef]
- Siniscalco, D.; Schultz, S.; Brigida, A.L.; Antonucci, N. Inflammation and Neuro-Immune Dysregulations in Autism Spectrum Disorders. Pharmaceuticals 2018, 11, 56. [Google Scholar] [CrossRef]
- Morgan, J.T.; Chana, G.; Pardo, C.A.; Achim, C.; Semendeferi, K.; Buckwalter, J.; Courchesne, E.; Everall, I.P. Microglial activation and increased microglial density observed in the dorsolateral prefrontal cortex in autism. Biol. Psychiatry 2010, 68, 368–376. [Google Scholar] [CrossRef] [PubMed]
- Osokine, I.; Erlebacher, A. Inflammation and Autism: From Maternal Gut to Fetal Brain. Trends Mol. Med. 2017, 23, 1070–1071. [Google Scholar] [CrossRef]
- Yu, L.; Croze, E.; Yamaguchi, K.D.; Tran, T.; Reder, A.T.; Litvak, V.; Volkert, M.R. Induction of a unique isoform of the NCOA7 oxidation resistance gene by interferon β-1b. J. Interferon Cytokine Res. 2015, 35, 186–199. [Google Scholar] [CrossRef]
- American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, 4th ed.; American Psychiatric Association (text revised): Washington, DC, USA, 2000. [Google Scholar]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Abruzzo, P.M.; Marini, M.; Bolotta, A.; Malisardi, G.; Manfredini, S.; Ghezzo, A.; Pini, A.; Tasco, G.; Casadio, R. Frataxin mRNA isoforms in FRDA patients and normal subjects: Effect of tocotrienol supplementation. Biomed. Res. Int. 2013, 2013, 276808. [Google Scholar] [CrossRef]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genom. Biol. 2007, 8, R19. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Huang, F.; Zhou, T.; Yao, X.; Yi, J.; Zhou, F.; Long, Z.; Hou, X.; Wang, C.; Chen, Z.; Jiang, H. miRNA profiling in autism spectrum disorder in China. Genom. Data 2015, 6, 108–109. [Google Scholar] [CrossRef]
- Nakata, M.; Kimura, R.; Funabiki, Y.; Awaya, T.; Murai, T.; Hagiwara, M. MicroRNA profiling in adults with high-functioning autism spectrum disorder. Mol. Brain 2019, 12, 82. [Google Scholar] [CrossRef] [PubMed]
TLDc Genes | Correlations of Gene Expression with CARS Global Score |
---|---|
OXR1 | r = 0.6055 p = 0.0129 pFDR = 0.0258 |
TLDC1 | r = 0.5421 p = 0.0301 pFDR = 0.0401 |
NCOA7 | NS |
TBC1D24 | r = 0.7613 p = 0.0006 pFDR = 0.0024 |
TLDc Genes | Inflammation/Oxidation-Related Genes | |||||
---|---|---|---|---|---|---|
IL1B | TNF-Alpha | COX2 | AHR | NRF2 | PRDX2 | |
OXR1 | r = 0.5082 | NS | r = 0.5727 | NS | NS | NS |
p = 0.0444 | p = 0.0204 | |||||
pFDR = 0.0999 | pFDR = 0.0999 | |||||
TLDC1 | r = 0.4926 p = 0.0525 pFDR = 0.0787 | r = 0.5401 p = 0.0308 pFDR = 0.0616 | NS | r = 0.5885 p = 0.0165 pFDR = 0.0495 | r = 0.6189 p = 0.0106 pFDR = 0.0495 | NS |
NCOA7 | NS | NS | r = 0.5302 | NS | r = 0.525 | NS |
p = 0.0346 | p = 0.0368 | |||||
pFDR = 0.1104 | pFDR = 0.1104 | |||||
TBC1D24 | r = 0.6682 p = 0.0047 pFDR = 0.0094 | r = 0.6249 p = 0.0096 pFDR = 0.0144 | NS | r = 0.8831 p =< 0.0001 pFDR = 0.0006 | r = 0.6972 p = 0.0027 pFDR = 0.0081 | NS |
Gene ID | GENE | Left Primer | Right Primer | Amplicon Length (bp) |
---|---|---|---|---|
55074 | OXR1 | acaggtttttggtgcgttagc | ccaaagcgcaaattctcctcc | 193 |
57707 | TLDC1 | tgtacacacacacgggctac | acatccacccaaagcccaaa | 118 |
135112 | NCOA7 | gctctaccggaaatcggcat | gaaaagtttcgcctgtgccat | 137 |
57465 | TBC1D24 | ttgctcatcaagaccacgca | cttgatcaccacccactcgt | 165 |
140711 | C20Orf118 | aagggagacttggattcactgatg | tgtttacaaactccctctcctgc | 246 |
55000 | TUG1 | gcaccagattccagaaaaggc | aagggcttcatggccaca | 104 |
60 | ACTB 1 | tgtggcatccacgaaactac | tgatcttgatcttcattgtgct | 175 |
2597 | GAPDH 1 | ggcctccaaggagtaagacc | ctgtgaggaggggagattca | 130 |
ncRNA | Qiagen GeneGlobe ID |
---|---|
miR-200b-3p | YP00206071 |
miR-32-5p | YP00204792 |
miR-16-5p 1 | YP00205702 |
U6 snRNA 1 | YP02119464 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zucchini, C.; Serpe, C.; De Sanctis, P.; Ghezzo, A.; Visconti, P.; Posar, A.; Facchin, F.; Marini, M.; Abruzzo, P.M. TLDc Domain-Containing Genes in Autism Spectrum Disorder: New Players in the Oxidative Stress Response. Int. J. Mol. Sci. 2023, 24, 15802. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242115802
Zucchini C, Serpe C, De Sanctis P, Ghezzo A, Visconti P, Posar A, Facchin F, Marini M, Abruzzo PM. TLDc Domain-Containing Genes in Autism Spectrum Disorder: New Players in the Oxidative Stress Response. International Journal of Molecular Sciences. 2023; 24(21):15802. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242115802
Chicago/Turabian StyleZucchini, Cinzia, Carmela Serpe, Paola De Sanctis, Alessandro Ghezzo, Paola Visconti, Annio Posar, Federica Facchin, Marina Marini, and Provvidenza Maria Abruzzo. 2023. "TLDc Domain-Containing Genes in Autism Spectrum Disorder: New Players in the Oxidative Stress Response" International Journal of Molecular Sciences 24, no. 21: 15802. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242115802